mirror of
https://github.com/boostorg/algorithm.git
synced 2026-08-24 14:14:03 +02:00
Compare commits
75
Commits
| Author | SHA1 | Date | |
|---|---|---|---|
|
|
84a2aaeae1 | ||
|
|
caea7bd125 | ||
|
|
81b04cde96 | ||
|
|
276073ca64 | ||
|
|
a7f5bdd781 | ||
|
|
0c0a866f07 | ||
|
|
9d25072f2f | ||
|
|
823b199df3 | ||
|
|
fecd440527 | ||
|
|
3325d3a3f8 | ||
|
|
ebf104c127 | ||
|
|
3b76763807 | ||
|
|
62df1eb048 | ||
|
|
f5dd47883f | ||
|
|
9d68c4280c | ||
|
|
1e8b3ee752 | ||
|
|
42147c8385 | ||
|
|
672775545d | ||
|
|
46ed1bf987 | ||
|
|
6289ed7f98 | ||
|
|
8e97668b1f | ||
|
|
e7c23d2f13 | ||
|
|
a1e7512012 | ||
|
|
31b5842441 | ||
|
|
4515bc182e | ||
|
|
7e2e6856cc | ||
|
|
235c81be61 | ||
|
|
1eb3d83534 | ||
|
|
8f2b8d4888 | ||
|
|
6c0f953c01 | ||
|
|
e439792494 | ||
|
|
236b142308 | ||
|
|
9bad789175 | ||
|
|
d84f81d841 | ||
|
|
ce98e8b87e | ||
|
|
e8a2596637 | ||
|
|
7b2754b937 | ||
|
|
784402e5c0 | ||
|
|
1188575e7b | ||
|
|
bff2a1e112 | ||
|
|
6d5e7b5a04 | ||
|
|
760af1798b | ||
|
|
1f5542b44c | ||
|
|
baf3dd99e2 | ||
|
|
7299b29bf8 | ||
|
|
539c170b9d | ||
|
|
c81ee948b7 | ||
|
|
ba5e4c30c6 | ||
|
|
cd26ed816c | ||
|
|
4e15767bed | ||
|
|
9fa2f90db4 | ||
|
|
35f317aeac | ||
|
|
d0a03fdb4e | ||
|
|
346f032be2 | ||
|
|
a389d768c4 | ||
|
|
90fca39906 | ||
|
|
5b24f31486 | ||
|
|
b25d6511b3 | ||
|
|
1541a554f5 | ||
|
|
7a97b3390e | ||
|
|
6e5a7497ae | ||
|
|
f0b8b60379 | ||
|
|
66019abb2f | ||
|
|
8758222006 | ||
|
|
4eef56761a | ||
|
|
b94a3fbfba | ||
|
|
614cc2ebab | ||
|
|
869660ed14 | ||
|
|
777f30780e | ||
|
|
26aa37733b | ||
|
|
f1e60579c2 | ||
|
|
389dd3c863 | ||
|
|
f23f61ae9b | ||
|
|
608112b112 | ||
|
|
b21b54dc4e |
@@ -1,42 +0,0 @@
|
||||
# Boost.Algorithm
|
||||
#
|
||||
# Copyright (c) 2010-2012 Marshall Clow
|
||||
#
|
||||
# Distributed under the Boost Software License, Version 1.0.
|
||||
# (See accompanying file LICENSE_1_0.txt or copy at
|
||||
# http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
|
||||
# Quickbook
|
||||
# -----------------------------------------------------------------------------
|
||||
|
||||
import os ;
|
||||
|
||||
using quickbook ;
|
||||
using doxygen ;
|
||||
using boostbook ;
|
||||
|
||||
doxygen autodoc
|
||||
:
|
||||
[ glob ../../../boost/algorithm/*.hpp ../../../boost/algorithm/searching/*.hpp ]
|
||||
:
|
||||
<doxygen:param>"PREDEFINED=\"BOOST_ALGORITHM_DOXYGEN=1\""
|
||||
<doxygen:param>WARNINGS=YES # Default NO, but useful to see warnings, especially in a logfile.
|
||||
;
|
||||
|
||||
|
||||
xml algorithm : algorithm.qbk ;
|
||||
|
||||
boostbook standalone
|
||||
:
|
||||
algorithm
|
||||
:
|
||||
<dependency>autodoc
|
||||
<xsl:param>boost.root=../../../..
|
||||
<xsl:param>"boost.doxygen.reftitle=Boost.Algorithms C++ Reference"
|
||||
<xsl:param>chapter.autolabel=0
|
||||
<xsl:param>chunk.section.depth=8
|
||||
<xsl:param>toc.section.depth=2
|
||||
<xsl:param>toc.max.depth=2
|
||||
<xsl:param>generate.section.toc.level=1
|
||||
;
|
||||
@@ -1,68 +0,0 @@
|
||||
[library The Boost Algorithm Library
|
||||
[quickbook 1.5]
|
||||
[id algorithm]
|
||||
[dirname algorithm]
|
||||
[purpose Library of useful algorithms]
|
||||
[category algorithms]
|
||||
[authors [Clow, Marshall]]
|
||||
[copyright 2010-2012 Marshall Clow]
|
||||
[source-mode c++]
|
||||
[license
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at
|
||||
[@http://www.boost.org/LICENSE_1_0.txt])
|
||||
]
|
||||
]
|
||||
|
||||
[section Description and Rationale]
|
||||
|
||||
Boost.Algorithm is a collection of general purpose algorithms. While Boost contains many libraries of data structures, there is no single library for general purpose algorithms. Even though the algorithms are generally useful, many tend to be thought of as "too small" for Boost.
|
||||
|
||||
An implementation of Boyer-Moore searching, for example, might take a developer a week or so to implement, including test cases and documentation. However, scheduling a review to include that code into Boost might take several months, and run into resistance because "it is too small". Nevertheless, a library of tested, reviewed, documented algorithms can make the developer's life much easier, and that is the purpose of this library.
|
||||
|
||||
[heading Future plans]
|
||||
|
||||
I will be soliciting submissions from other developers, as well as looking through the literature for existing algorithms to include. The Adobe Source Library, for example, contains many useful algorithms that already have documentation and test cases. Knuth's _The Art of Computer Programming_ is chock-full of algorithm descriptions, too.
|
||||
|
||||
My goal is to run regular algorithm reviews, similar to the Boost library review process, but with smaller chunks of code.
|
||||
|
||||
[heading Dependencies]
|
||||
|
||||
Boost.Algorithm uses Boost.Range, Boost.Assert, Boost.Array, Boost.TypeTraits, and Boost.StaticAssert.
|
||||
|
||||
|
||||
[heading Acknowledgements]
|
||||
|
||||
Thanks to all the people who have reviewed this library and made suggestions for improvements. Steven Watanabe and Sean Parent, in particular, have provided a great deal of help.
|
||||
|
||||
[endsect]
|
||||
|
||||
[/ include toc.qbk]
|
||||
|
||||
|
||||
[section:Searching Searching Algorithms]
|
||||
[include boyer_moore.qbk]
|
||||
[include boyer_moore_horspool.qbk]
|
||||
[include knuth_morris_pratt.qbk]
|
||||
[endsect]
|
||||
|
||||
[section:CXX11 C++11 Algorithms]
|
||||
[include all_of.qbk]
|
||||
[include any_of.qbk]
|
||||
[include none_of.qbk]
|
||||
[include one_of.qbk]
|
||||
[include ordered-hpp.qbk]
|
||||
[include is_partitioned.qbk]
|
||||
[include partition_point.qbk]
|
||||
[endsect]
|
||||
|
||||
[section:Misc Other Algorithms]
|
||||
[include clamp-hpp.qbk]
|
||||
[include hex.qbk]
|
||||
[endsect]
|
||||
|
||||
|
||||
|
||||
[xinclude autodoc.xml]
|
||||
|
||||
|
||||
@@ -1,89 +0,0 @@
|
||||
[/ File all_of.qbk]
|
||||
|
||||
[section:all_of all_of]
|
||||
|
||||
[/license
|
||||
Copyright (c) 2010-2012 Marshall Clow
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
]
|
||||
|
||||
The header file 'boost/algorithm/cxx11/all_of.hpp' contains four variants of a single algorithm, `all_of`. The algorithm tests all the elements of a sequence and returns true if they all share a property.
|
||||
|
||||
The routine `all_of` takes a sequence and a predicate. It will return true if the predicate returns true when applied to every element in the sequence.
|
||||
|
||||
The routine `all_of_equal` takes a sequence and a value. It will return true if every element in the sequence compares equal to the passed in value.
|
||||
|
||||
Both routines come in two forms; the first one takes two iterators to define the range. The second form takes a single range parameter, and uses Boost.Range to traverse it.
|
||||
|
||||
|
||||
[heading interface]
|
||||
|
||||
The function `all_of` returns true if the predicate returns true for every item in the sequence. There are two versions; one takes two iterators, and the other takes a range.
|
||||
|
||||
``
|
||||
namespace boost { namespace algorithm {
|
||||
template<typename InputIterator, typename Predicate>
|
||||
bool all_of ( InputIterator first, InputIterator last, Predicate p );
|
||||
template<typename Range, typename Predicate>
|
||||
bool all_of ( const Range &r, Predicate p );
|
||||
}}
|
||||
``
|
||||
|
||||
The function `all_of_equal` is similar to `all_of`, but instead of taking a predicate to test the elements of the sequence, it takes a value to compare against.
|
||||
|
||||
``
|
||||
namespace boost { namespace algorithm {
|
||||
template<typename InputIterator, typename V>
|
||||
bool all_of_equal ( InputIterator first, InputIterator last, V const &val );
|
||||
template<typename Range, typename V>
|
||||
bool all_of_equal ( const Range &r, V const &val );
|
||||
}}
|
||||
``
|
||||
|
||||
[heading Examples]
|
||||
|
||||
Given the container `c` containing `{ 0, 1, 2, 3, 14, 15 }`, then
|
||||
``
|
||||
bool isOdd ( int i ) { return i % 2 == 1; }
|
||||
bool lessThan10 ( int i ) { return i < 10; }
|
||||
|
||||
using boost::algorithm;
|
||||
all_of ( c, isOdd ) --> false
|
||||
all_of ( c.begin (), c.end (), lessThan10 ) --> false
|
||||
all_of ( c.begin (), c.begin () + 3, lessThan10 ) --> true
|
||||
all_of ( c.end (), c.end (), isOdd ) --> true // empty range
|
||||
all_of_equal ( c, 3 ) --> false
|
||||
all_of_equal ( c.begin () + 3, c.begin () + 4, 3 ) --> true
|
||||
all_of_equal ( c.begin (), c.begin (), 99 ) --> true // empty range
|
||||
``
|
||||
|
||||
[heading Iterator Requirements]
|
||||
|
||||
`all_of` and `all_of_equal` work on all iterators except output iterators.
|
||||
|
||||
[heading Complexity]
|
||||
|
||||
All of the variants of `all_of` and `all_of_equal` run in ['O(N)] (linear) time; that is, they compare against each element in the list once. If any of the comparisons fail, the algorithm will terminate immediately, without examining the remaining members of the sequence.
|
||||
|
||||
[heading Exception Safety]
|
||||
|
||||
All of the variants of `all_of` and `all_of_equal` take their parameters by value or const reference, and do not depend upon any global state. Therefore, all the routines in this file provide the strong exception guarantee.
|
||||
|
||||
[heading Notes]
|
||||
|
||||
* The routine `all_of` is part of the C++11 standard. When compiled using a C++11 implementation, the implementation from the standard library will be used.
|
||||
|
||||
* `all_of` and `all_of_equal` both return true for empty ranges, no matter what is passed to test against. When there are no items in the sequence to test, they all satisfy the condition to be tested against.
|
||||
|
||||
* The second parameter to `all_of_value` is a template parameter, rather than deduced from the first parameter (`std::iterator_traits<InputIterator>::value_type`) because that allows more flexibility for callers, and takes advantage of built-in comparisons for the type that is pointed to by the iterator. The function is defined to return true if, for all elements in the sequence, the expression `*iter == val` evaluates to true (where `iter` is an iterator to each element in the sequence)
|
||||
|
||||
[endsect]
|
||||
|
||||
[/ File all_of.qbk
|
||||
Copyright 2011 Marshall Clow
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt).
|
||||
]
|
||||
|
||||
@@ -1,89 +0,0 @@
|
||||
[/ File any_of.qbk]
|
||||
|
||||
[section:any_of any_of]
|
||||
|
||||
[/license
|
||||
Copyright (c) 2010-2012 Marshall Clow
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
]
|
||||
|
||||
The header file 'boost/algorithm/cxx11/any_of.hpp' contains four variants of a single algorithm, `any_of`. The algorithm tests the elements of a sequence and returns true if any of the elements has a particular property.
|
||||
|
||||
The routine `any_of` takes a sequence and a predicate. It will return true if the predicate returns true for any element in the sequence.
|
||||
|
||||
The routine `any_of_equal` takes a sequence and a value. It will return true if any element in the sequence compares equal to the passed in value.
|
||||
|
||||
Both routines come in two forms; the first one takes two iterators to define the range. The second form takes a single range parameter, and uses Boost.Range to traverse it.
|
||||
|
||||
|
||||
[heading interface]
|
||||
|
||||
The function `any_of` returns true if the predicate returns true any item in the sequence. There are two versions; one takes two iterators, and the other takes a range.
|
||||
|
||||
``
|
||||
namespace boost { namespace algorithm {
|
||||
template<typename InputIterator, typename Predicate>
|
||||
bool any_of ( InputIterator first, InputIterator last, Predicate p );
|
||||
template<typename Range, typename Predicate>
|
||||
bool any_of ( const Range &r, Predicate p );
|
||||
}}
|
||||
``
|
||||
|
||||
The function `any_of_equal` is similar to `any_of`, but instead of taking a predicate to test the elements of the sequence, it takes a value to compare against.
|
||||
|
||||
``
|
||||
namespace boost { namespace algorithm {
|
||||
template<typename InputIterator, typename V>
|
||||
bool any_of_equal ( InputIterator first, InputIterator last, V const &val );
|
||||
template<typename Range, typename V>
|
||||
bool any_of_equal ( const Range &r, V const &val );
|
||||
}}
|
||||
``
|
||||
|
||||
[heading Examples]
|
||||
|
||||
Given the container `c` containing `{ 0, 1, 2, 3, 14, 15 }`, then
|
||||
``
|
||||
bool isOdd ( int i ) { return i % 2 == 1; }
|
||||
bool lessThan10 ( int i ) { return i < 10; }
|
||||
|
||||
using boost::algorithm;
|
||||
any_of ( c, isOdd ) --> true
|
||||
any_of ( c.begin (), c.end (), lessThan10 ) --> true
|
||||
any_of ( c.begin () + 4, c.end (), lessThan10 ) --> false
|
||||
any_of ( c.end (), c.end (), isOdd ) --> false // empty range
|
||||
any_of_equal ( c, 3 ) --> true
|
||||
any_of_equal ( c.begin (), c.begin () + 3, 3 ) --> false
|
||||
any_of_equal ( c.begin (), c.begin (), 99 ) --> false // empty range
|
||||
``
|
||||
|
||||
[heading Iterator Requirements]
|
||||
|
||||
`any_of` and `any_of_equal` work on all iterators except output iterators.
|
||||
|
||||
[heading Complexity]
|
||||
|
||||
All of the variants of `any_of` and `any_of_equal` run in ['O(N)] (linear) time; that is, they compare against each element in the list once. If any of the comparisons succeed, the algorithm will terminate immediately, without examining the remaining members of the sequence.
|
||||
|
||||
[heading Exception Safety]
|
||||
|
||||
All of the variants of `any_of` and `any_of_equal` take their parameters by value or const reference, and do not depend upon any global state. Therefore, all the routines in this file provide the strong exception guarantee.
|
||||
|
||||
[heading Notes]
|
||||
|
||||
* The routine `any_of` is part of the C++11 standard. When compiled using a C++11 implementation, the implementation from the standard library will be used.
|
||||
|
||||
* `any_of` and `any_of_equal` both return false for empty ranges, no matter what is passed to test against.
|
||||
|
||||
* The second parameter to `any_of_value` is a template parameter, rather than deduced from the first parameter (`std::iterator_traits<InputIterator>::value_type`) because that allows more flexibility for callers, and takes advantage of built-in comparisons for the type that is pointed to by the iterator. The function is defined to return true if, for any element in the sequence, the expression `*iter == val` evaluates to true (where `iter` is an iterator to each element in the sequence)
|
||||
|
||||
[endsect]
|
||||
|
||||
[/ File any_of.qbk
|
||||
Copyright 2011 Marshall Clow
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt).
|
||||
]
|
||||
|
||||
@@ -1,95 +0,0 @@
|
||||
[/ QuickBook Document version 1.5 ]
|
||||
|
||||
[section:BoyerMoore Boyer-Moore Search]
|
||||
|
||||
[/license
|
||||
|
||||
Copyright (c) 2010-2012 Marshall Clow
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at
|
||||
http://www.boost.org/LICENSE_1_0.txt)
|
||||
]
|
||||
|
||||
|
||||
[heading Overview]
|
||||
|
||||
The header file 'boyer_moore.hpp' contains an an implementation of the Boyer-Moore algorithm for searching sequences of values.
|
||||
|
||||
The Boyer–Moore string search algorithm is a particularly efficient string searching algorithm, and it has been the standard benchmark for the practical string search literature. The Boyer-Moore algorithm was invented by Bob Boyer and J. Strother Moore, and published in the October 1977 issue of the Communications of the ACM , and a copy of that article is available at [@http://www.cs.utexas.edu/~moore/publications/fstrpos.pdf].
|
||||
|
||||
The Boyer-Moore algorithm uses two precomputed tables to give better performance than a naive search. These tables depend on the pattern being searched for, and give the Boyer-Moore algorithm larger a memory footprint and startup costs than a simpler algorithm, but these costs are recovered quickly during the searching process, especially if the pattern is longer than a few elements.
|
||||
|
||||
However, the Boyer-Moore algorithm cannot be used with comparison predicates like `std::search`.
|
||||
|
||||
Nomenclature: I refer to the sequence being searched for as the "pattern", and the sequence being searched in as the "corpus".
|
||||
|
||||
[heading Interface]
|
||||
|
||||
For flexibility, the Boyer-Moore algorithm has has two interfaces; an object-based interface and a procedural one. The object-based interface builds the tables in the constructor, and uses operator () to perform the search. The procedural interface builds the table and does the search all in one step. If you are going to be searching for the same pattern in multiple corpora, then you should use the object interface, and only build the tables once.
|
||||
|
||||
Here is the object interface:
|
||||
``
|
||||
template <typename patIter>
|
||||
class boyer_moore {
|
||||
public:
|
||||
boyer_moore ( patIter first, patIter last );
|
||||
~boyer_moore ();
|
||||
|
||||
template <typename corpusIter>
|
||||
corpusIter operator () ( corpusIter corpus_first, corpusIter corpus_last );
|
||||
};
|
||||
``
|
||||
|
||||
and here is the corresponding procedural interface:
|
||||
|
||||
``
|
||||
template <typename patIter, typename corpusIter>
|
||||
corpusIter boyer_moore_search (
|
||||
corpusIter corpus_first, corpusIter corpus_last,
|
||||
patIter pat_first, patIter pat_last );
|
||||
``
|
||||
|
||||
Each of the functions is passed two pairs of iterators. The first two define the corpus and the second two define the pattern. Note that the two pairs need not be of the same type, but they do need to "point" at the same type. In other words, `patIter::value_type` and `curpusIter::value_type` need to be the same type.
|
||||
|
||||
The return value of the function is an iterator pointing to the start of the pattern in the corpus. If the pattern is not found, it returns the end of the corpus (`corpus_last`).
|
||||
|
||||
[heading Performance]
|
||||
|
||||
The execution time of the Boyer-Moore algorithm, while still linear in the size of the string being searched, can have a significantly lower constant factor than many other search algorithms: it doesn't need to check every character of the string to be searched, but rather skips over some of them. Generally the algorithm gets faster as the pattern being searched for becomes longer. Its efficiency derives from the fact that with each unsuccessful attempt to find a match between the search string and the text it is searching, it uses the information gained from that attempt to rule out as many positions of the text as possible where the string cannot match.
|
||||
|
||||
[heading Memory Use]
|
||||
|
||||
The algorithm allocates two internal tables. The first one is proportional to the length of the pattern; the second one has one entry for each member of the "alphabet" in the pattern. For (8-bit) character types, this table contains 256 entries.
|
||||
|
||||
[heading Complexity]
|
||||
|
||||
The worst-case performance to find a pattern in the corpus is ['O(N)] (linear) time; that is, proportional to the length of the corpus being searched. In general, the search is sub-linear; not every entry in the corpus need be checked.
|
||||
|
||||
[heading Exception Safety]
|
||||
|
||||
Both the object-oriented and procedural versions of the Boyer-Moore algorithm take their parameters by value and do not use any information other than what is passed in. Therefore, both interfaces provide the strong exception guarantee.
|
||||
|
||||
[heading Notes]
|
||||
|
||||
* When using the object-based interface, the pattern must remain unchanged for during the searches; i.e, from the time the object is constructed until the final call to operator () returns.
|
||||
|
||||
* The Boyer-Moore algorithm requires random-access iterators for both the pattern and the corpus.
|
||||
|
||||
[heading Customization points]
|
||||
|
||||
The Boyer-Moore object takes a traits template parameter which enables the caller to customize how one of the precomputed tables is stored. This table, called the skip table, contains (logically) one entry for every possible value that the pattern can contain. When searching 8-bit character data, this table contains 256 elements. The traits class defines the table to be used.
|
||||
|
||||
The default traits class uses a `boost::array` for small 'alphabets' and a `tr1::unordered_map` for larger ones. The array-based skip table gives excellent performance, but could be prohibitively large when the 'alphabet' of elements to be searched grows. The unordered_map based version only grows as the number of unique elements in the pattern, but makes many more heap allocations, and gives slower lookup performance.
|
||||
|
||||
To use a different skip table, you should define your own skip table object and your own traits class, and use them to instantiate the Boyer-Moore object. The interface to these objects is described TBD.
|
||||
|
||||
|
||||
[endsect]
|
||||
|
||||
[/ File boyer_moore.qbk
|
||||
Copyright 2011 Marshall Clow
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt).
|
||||
]
|
||||
|
||||
@@ -1,93 +0,0 @@
|
||||
[/ QuickBook Document version 1.5 ]
|
||||
|
||||
[section:BoyerMooreHorspool Boyer-Moore-Horspool Search]
|
||||
|
||||
[/license
|
||||
|
||||
Copyright (c) 2010-2012 Marshall Clow
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at
|
||||
http://www.boost.org/LICENSE_1_0.txt)
|
||||
]
|
||||
|
||||
|
||||
[heading Overview]
|
||||
|
||||
The header file 'boyer_moore_horspool.hpp' contains an an implementation of the Boyer-Moore-Horspool algorithm for searching sequences of values.
|
||||
|
||||
The Boyer-Moore-Horspool search algorithm was published by Nigel Horspool in 1980. It is a refinement of the Boyer-Moore algorithm that trades space for time. It uses less space for internal tables than Boyer-Moore, and has poorer worst-case performance.
|
||||
|
||||
The Boyer-Moore-Horspool algorithm cannot be used with comparison predicates like `std::search`.
|
||||
|
||||
[heading Interface]
|
||||
|
||||
Nomenclature: I refer to the sequence being searched for as the "pattern", and the sequence being searched in as the "corpus".
|
||||
|
||||
For flexibility, the Boyer-Moore-Horspool algorithm has has two interfaces; an object-based interface and a procedural one. The object-based interface builds the tables in the constructor, and uses operator () to perform the search. The procedural interface builds the table and does the search all in one step. If you are going to be searching for the same pattern in multiple corpora, then you should use the object interface, and only build the tables once.
|
||||
|
||||
Here is the object interface:
|
||||
``
|
||||
template <typename patIter>
|
||||
class boyer_moore_horspool {
|
||||
public:
|
||||
boyer_moore_horspool ( patIter first, patIter last );
|
||||
~boyer_moore_horspool ();
|
||||
|
||||
template <typename corpusIter>
|
||||
corpusIter operator () ( corpusIter corpus_first, corpusIter corpus_last );
|
||||
};
|
||||
``
|
||||
|
||||
and here is the corresponding procedural interface:
|
||||
|
||||
``
|
||||
template <typename patIter, typename corpusIter>
|
||||
corpusIter boyer_moore_horspool_search (
|
||||
corpusIter corpus_first, corpusIter corpus_last,
|
||||
patIter pat_first, patIter pat_last );
|
||||
``
|
||||
|
||||
Each of the functions is passed two pairs of iterators. The first two define the corpus and the second two define the pattern. Note that the two pairs need not be of the same type, but they do need to "point" at the same type. In other words, `patIter::value_type` and `curpusIter::value_type` need to be the same type.
|
||||
|
||||
The return value of the function is an iterator pointing to the start of the pattern in the corpus. If the pattern is not found, it returns the end of the corpus (`corpus_last`).
|
||||
|
||||
[heading Performance]
|
||||
|
||||
The execution time of the Boyer-Moore-Horspool algorithm is linear in the size of the string being searched; it can have a significantly lower constant factor than many other search algorithms: it doesn't need to check every character of the string to be searched, but rather skips over some of them. Generally the algorithm gets faster as the pattern being searched for becomes longer. Its efficiency derives from the fact that with each unsuccessful attempt to find a match between the search string and the text it is searching, it uses the information gained from that attempt to rule out as many positions of the text as possible where the string cannot match.
|
||||
|
||||
[heading Memory Use]
|
||||
|
||||
The algorithm an internal table that has one entry for each member of the "alphabet" in the pattern. For (8-bit) character types, this table contains 256 entries.
|
||||
|
||||
[heading Complexity]
|
||||
|
||||
The worst-case performance is ['O(m x n)], where ['m] is the length of the pattern and ['n] is the length of the corpus. The average time is ['O(n)]. The best case performance is sub-linear, and is, in fact, identical to Boyer-Moore, but the initialization is quicker and the internal loop is simpler than Boyer-Moore.
|
||||
|
||||
[heading Exception Safety]
|
||||
|
||||
Both the object-oriented and procedural versions of the Boyer-Moore-Horspool algorithm take their parameters by value and do not use any information other than what is passed in. Therefore, both interfaces provide the strong exception guarantee.
|
||||
|
||||
[heading Notes]
|
||||
|
||||
* When using the object-based interface, the pattern must remain unchanged for during the searches; i.e, from the time the object is constructed until the final call to operator () returns.
|
||||
|
||||
* The Boyer-Moore-Horspool algorithm requires random-access iterators for both the pattern and the corpus.
|
||||
|
||||
[heading Customization points]
|
||||
|
||||
The Boyer-Moore-Horspool object takes a traits template parameter which enables the caller to customize how the precomputed table is stored. This table, called the skip table, contains (logically) one entry for every possible value that the pattern can contain. When searching 8-bit character data, this table contains 256 elements. The traits class defines the table to be used.
|
||||
|
||||
The default traits class uses a `boost::array` for small 'alphabets' and a `tr1::unordered_map` for larger ones. The array-based skip table gives excellent performance, but could be prohibitively large when the 'alphabet' of elements to be searched grows. The unordered_map based version only grows as the number of unique elements in the pattern, but makes many more heap allocations, and gives slower lookup performance.
|
||||
|
||||
To use a different skip table, you should define your own skip table object and your own traits class, and use them to instantiate the Boyer-Moore-Horspool object. The interface to these objects is described TBD.
|
||||
|
||||
|
||||
[endsect]
|
||||
|
||||
[/ File boyer_moore_horspool.qbk
|
||||
Copyright 2011 Marshall Clow
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt).
|
||||
]
|
||||
|
||||
@@ -1,73 +0,0 @@
|
||||
[/ QuickBook Document version 1.5 ]
|
||||
[section:clamp clamp]
|
||||
|
||||
[/license
|
||||
|
||||
Copyright (c) 2010-2012 Marshall Clow
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at
|
||||
http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
]
|
||||
|
||||
|
||||
The header file clamp.hpp contains two functions for "clamping" a value between a pair of boundary values.
|
||||
|
||||
[heading clamp]
|
||||
|
||||
The function `clamp (v, lo, hi)` returns:
|
||||
|
||||
* lo if v < lo
|
||||
* hi if hi < v
|
||||
* otherwise, v
|
||||
|
||||
Note: using `clamp` with floating point numbers may give unexpected results if one of the values is `NaN`.
|
||||
|
||||
There is also a version that allows the caller to specify a comparison predicate to use instead of `operator <`.
|
||||
|
||||
``
|
||||
template<typename V>
|
||||
V clamp ( V val, V lo, V hi );
|
||||
|
||||
template<typename V, typename Pred>
|
||||
V clamp ( V val, V lo, V hi, Pred p );
|
||||
``
|
||||
|
||||
The following code: ``
|
||||
int foo = 23;
|
||||
foo = clamp ( foo, 1, 10 );
|
||||
``
|
||||
will leave `foo` with a value of 10
|
||||
|
||||
Complexity:
|
||||
`clamp` will make either one or two calls to the comparison predicate before returning one of the three parameters.
|
||||
|
||||
[heading clamp_range]
|
||||
There are also four range-based versions of clamp, that apply clamping to a series of values. You could write them yourself with std::transform and bind, like this: `std::transform ( first, last, out, bind ( clamp ( _1, lo, hi )))`, but they are provided here for your convenience.
|
||||
|
||||
``
|
||||
template<typename InputIterator, typename OutputIterator>
|
||||
OutputIterator clamp_range ( InputIterator first, InputIterator last, OutputIterator out,
|
||||
typename std::iterator_traits<InputIterator>::value_type lo,
|
||||
typename std::iterator_traits<InputIterator>::value_type hi );
|
||||
|
||||
template<typename Range, typename OutputIterator>
|
||||
OutputIterator clamp_range ( const Range &r, OutputIterator out,
|
||||
typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type lo,
|
||||
typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type hi );
|
||||
|
||||
template<typename InputIterator, typename OutputIterator, typename Pred>
|
||||
OutputIterator clamp_range ( InputIterator first, InputIterator last, OutputIterator out,
|
||||
typename std::iterator_traits<InputIterator>::value_type lo,
|
||||
typename std::iterator_traits<InputIterator>::value_type hi, Pred p );
|
||||
|
||||
template<typename Range, typename OutputIterator, typename Pred>
|
||||
OutputIterator clamp_range ( const Range &r, OutputIterator out,
|
||||
typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type lo,
|
||||
typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type hi,
|
||||
Pred p );
|
||||
``
|
||||
|
||||
|
||||
[endsect]
|
||||
-109
@@ -1,109 +0,0 @@
|
||||
[/ File hex.qbk]
|
||||
|
||||
[section:hex hex]
|
||||
|
||||
[/license
|
||||
Copyright (c) 2011-2012 Marshall Clow
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
]
|
||||
|
||||
The header file `'boost/algorithm/hex.hpp'` contains three variants each of two algorithms, `hex` and `unhex`. They are inverse algorithms; that is, one undoes the effort of the other. `hex` takes a sequence of values, and turns them into hexadecimal characters. `unhex` takes a sequence of hexadecimal characters, and outputs a sequence of values.
|
||||
|
||||
`hex` and `unhex` come from MySQL, where they are used in database queries and stored procedures.
|
||||
|
||||
[heading interface]
|
||||
|
||||
The function `hex` takes a sequence of values and writes hexadecimal characters. There are three different interfaces, differing only in how the input sequence is specified.
|
||||
|
||||
The first one takes an iterator pair. The second one takes a pointer to the start of a zero-terminated sequence, such as a c string, and the third takes a range as defined by the Boost.Range library.
|
||||
|
||||
``
|
||||
template <typename InputIterator, typename OutputIterator>
|
||||
OutputIterator hex ( InputIterator first, InputIterator last, OutputIterator out );
|
||||
|
||||
template <typename T, typename OutputIterator>
|
||||
OutputIterator hex ( const T *ptr, OutputIterator out );
|
||||
|
||||
template <typename Range, typename OutputIterator>
|
||||
OutputIterator hex ( const Range &r, OutputIterator out );
|
||||
``
|
||||
|
||||
`hex` writes only values in the range '0'..'9' and 'A'..'F', but is not limited to character output. The output iterator could refer to a wstring, or a vector of integers, or any other integral type.
|
||||
|
||||
The function `unhex` takes the output of `hex` and turns it back into a sequence of values.
|
||||
|
||||
The input parameters for the different variations of `unhex` are the same as `hex`.
|
||||
|
||||
``
|
||||
template <typename InputIterator, typename OutputIterator>
|
||||
OutputIterator unhex ( InputIterator first, InputIterator last, OutputIterator out );
|
||||
|
||||
template <typename T, typename OutputIterator>
|
||||
OutputIterator unhex ( const T *ptr, OutputIterator out );
|
||||
|
||||
template <typename Range, typename OutputIterator>
|
||||
OutputIterator unhex ( const Range &r, OutputIterator out );
|
||||
``
|
||||
|
||||
[heading Error Handling]
|
||||
The header 'hex.hpp' defines three exception classes:
|
||||
``
|
||||
struct hex_decode_error: virtual boost::exception, virtual std::exception {};
|
||||
struct not_enough_input : public hex_decode_error;
|
||||
struct non_hex_input : public hex_decode_error;
|
||||
``
|
||||
|
||||
If the input to `unhex` does not contain an "even number" of hex digits, then an exception of type `boost::algorithm::not_enough_input` is thrown.
|
||||
|
||||
If the input to `unhex` contains any non-hexadecimal characters, then an exception of type `boost::algorithm::non_hex_input` is thrown.
|
||||
|
||||
If you want to catch all the decoding errors, you can catch exceptions of type `boost::algorithm::hex_decode_error`.
|
||||
|
||||
[heading Examples]
|
||||
|
||||
Assuming that `out` is an iterator that accepts `char` values, and `wout` accepts `wchar_t` values (and that sizeof ( wchar_t ) == 2)
|
||||
|
||||
``
|
||||
hex ( "abcde", out ) --> "616263646566"
|
||||
hex ( "32", out ) --> "3332"
|
||||
hex ( "abcde", wout ) --> "006100620063006400650066"
|
||||
hex ( "32", wout ) --> "00330032"
|
||||
|
||||
unhex ( "616263646566", out ) --> "abcde"
|
||||
unhex ( "3332", out ) --> "32"
|
||||
unhex ( "616263646566", wout ) --> "\6162\6364\6566" ( i.e, a 3 character string )
|
||||
unhex ( "3332", wout ) --> "\3233" ( U+3332, SQUARE HUARADDO )
|
||||
|
||||
unhex ( "3", out ) --> Error - not enough input
|
||||
unhex ( "32", wout ) --> Error - not enough input
|
||||
|
||||
unhex ( "ACEG", out ) --> Error - non-hex input
|
||||
|
||||
``
|
||||
|
||||
[heading Iterator Requirements]
|
||||
|
||||
`hex` and `unhex` work on all iterator types.
|
||||
|
||||
[heading Complexity]
|
||||
|
||||
All of the variants of `hex` and `unhex` run in ['O(N)] (linear) time; that is, that is, they process each element in the input sequence once.
|
||||
|
||||
[heading Exception Safety]
|
||||
|
||||
All of the variants of `hex` and `unhex` take their parameters by value or const reference, and do not depend upon any global state. Therefore, all the routines in this file provide the strong exception guarantee. However, when working on input iterators, if an exception is thrown, the input iterators will not be reset to their original values (i.e, the characters read from the iterator cannot be un-read)
|
||||
|
||||
[heading Notes]
|
||||
|
||||
* `hex` and `unhex` both do nothing when passed empty ranges.
|
||||
|
||||
[endsect]
|
||||
|
||||
[/ File hex.qbk
|
||||
Copyright 2011 Marshall Clow
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt).
|
||||
]
|
||||
|
||||
@@ -1,69 +0,0 @@
|
||||
[/ File is_partitioned.qbk]
|
||||
|
||||
[section:is_partitioned is_partitioned ]
|
||||
|
||||
[/license
|
||||
Copyright (c) 2010-2012 Marshall Clow
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
]
|
||||
|
||||
The header file 'is_partitioned.hpp' contains two variants of a single algorithm, `is_partitioned`. The algorithm tests to see if a sequence is partitioned according to a predicate; in other words, all the items in the sequence that satisfy the predicate are at the beginning of the sequence.
|
||||
|
||||
The routine `is_partitioned` takes a sequence and a predicate. It returns true if the sequence is partitioned according to the predicate.
|
||||
|
||||
`is_partitioned` come in two forms; the first one takes two iterators to define the range. The second form takes a single range parameter, and uses Boost.Range to traverse it.
|
||||
|
||||
|
||||
[heading interface]
|
||||
|
||||
The function `is_partitioned` returns true the items in the sequence are separated according to their ability to satisfy the predicate. There are two versions; one takes two iterators, and the other takes a range.
|
||||
|
||||
``
|
||||
template<typename InputIterator, typename Predicate>
|
||||
bool is_partitioned ( InputIterator first, InputIterator last, Predicate p );
|
||||
template<typename Range, typename Predicate>
|
||||
bool is_partitioned ( const Range &r, Predicate p );
|
||||
``
|
||||
|
||||
[heading Examples]
|
||||
|
||||
Given the container `c` containing `{ 0, 1, 2, 3, 14, 15 }`, then
|
||||
``
|
||||
bool isOdd ( int i ) { return i % 2 == 1; }
|
||||
bool lessThan10 ( int i ) { return i < 10; }
|
||||
|
||||
is_partitioned ( c, isOdd ) --> false
|
||||
is_partitioned ( c, lessThan10 ) --> true
|
||||
is_partitioned ( c.begin (), c.end (), lessThan10 ) --> true
|
||||
is_partitioned ( c.begin (), c.begin () + 3, lessThan10 ) --> true
|
||||
is_partitioned ( c.end (), c.end (), isOdd ) --> true // empty range
|
||||
``
|
||||
|
||||
[heading Iterator Requirements]
|
||||
|
||||
`is_partitioned` works on all iterators except output iterators.
|
||||
|
||||
[heading Complexity]
|
||||
|
||||
Both of the variants of `is_partitioned` run in ['O(N)] (linear) time; that is, they compare against each element in the list once. If the sequence is found to be not partitioned at any point, the routine will terminate immediately, without examining the rest of the elements.
|
||||
|
||||
[heading Exception Safety]
|
||||
|
||||
Both of the variants of `is_partitioned` take their parameters by value or const reference, and do not depend upon any global state. Therefore, all the routines in this file provide the strong exception guarantee.
|
||||
|
||||
[heading Notes]
|
||||
|
||||
* The iterator-based version of the routine `is_partitioned` is part of the C++11 standard. When compiled using a C++11 implementation, the implementation from the standard library will be used.
|
||||
|
||||
* `is_partitioned` returns true for empty ranges, no matter what predicate is passed to test against.
|
||||
|
||||
[endsect]
|
||||
|
||||
[/ File is_partitioned.qbk
|
||||
Copyright 2011 Marshall Clow
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt).
|
||||
]
|
||||
|
||||
@@ -1,27 +0,0 @@
|
||||
[/ QuickBook Document version 1.5 ]
|
||||
|
||||
[section:KnuthMorrisPratt Knuth-Morris-Pratt Search]
|
||||
|
||||
[/license
|
||||
|
||||
Copyright (c) 2010-2012 Marshall Clow
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at
|
||||
http://www.boost.org/LICENSE_1_0.txt)
|
||||
]
|
||||
|
||||
|
||||
[heading Overview]
|
||||
|
||||
The header file 'knuth_morris_pratt.hpp' contains an an implementation of the Knuth-Morris-Pratt algorithm for searching sequences of values.
|
||||
|
||||
|
||||
[endsect]
|
||||
|
||||
[/ File knuth_morris_pratt.qbk
|
||||
Copyright 2011 Marshall Clow
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt).
|
||||
]
|
||||
|
||||
@@ -1,90 +0,0 @@
|
||||
[/ File none_of.qbk]
|
||||
|
||||
[section:none_of none_of]
|
||||
|
||||
[/license
|
||||
Copyright (c) 2010-2012 Marshall Clow
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
]
|
||||
|
||||
The header file 'boost/algorithm/cxx11/none_of.hpp' contains four variants of a single algorithm, `none_of`. The algorithm tests all the elements of a sequence and returns true if they none of them share a property.
|
||||
|
||||
The routine `none_of` takes a sequence and a predicate. It will return true if the predicate returns false when applied to every element in the sequence.
|
||||
|
||||
The routine `none_of_equal` takes a sequence and a value. It will return true if none of the elements in the sequence compare equal to the passed in value.
|
||||
|
||||
Both routines come in two forms; the first one takes two iterators to define the range. The second form takes a single range parameter, and uses Boost.Range to traverse it.
|
||||
|
||||
|
||||
[heading interface]
|
||||
|
||||
The function `none_of` returns true if the predicate returns false for every item in the sequence. There are two versions; one takes two iterators, and the other takes a range.
|
||||
|
||||
``
|
||||
namespace boost { namespace algorithm {
|
||||
template<typename InputIterator, typename Predicate>
|
||||
bool none_of ( InputIterator first, InputIterator last, Predicate p );
|
||||
template<typename Range, typename Predicate>
|
||||
bool none_of ( const Range &r, Predicate p );
|
||||
}}
|
||||
``
|
||||
|
||||
The function `none_of_equal` is similar to `none_of`, but instead of taking a predicate to test the elements of the sequence, it takes a value to compare against.
|
||||
|
||||
``
|
||||
namespace boost { namespace algorithm {
|
||||
template<typename InputIterator, typename V>
|
||||
bool none_of_equal ( InputIterator first, InputIterator last, V const &val );
|
||||
template<typename Range, typename V>
|
||||
bool none_of_equal ( const Range &r, V const &val );
|
||||
}}
|
||||
``
|
||||
|
||||
[heading Examples]
|
||||
|
||||
Given the container `c` containing `{ 0, 1, 2, 3, 14, 15 }`, then
|
||||
``
|
||||
bool isOdd ( int i ) { return i % 2 == 1; }
|
||||
bool lessThan10 ( int i ) { return i < 10; }
|
||||
|
||||
using boost::algorithm;
|
||||
|
||||
none_of ( c, isOdd ) --> false
|
||||
none_of ( c.begin (), c.end (), lessThan10 ) --> false
|
||||
none_of ( c.begin () + 4, c.end (), lessThan10 ) --> true
|
||||
none_of ( c.end (), c.end (), isOdd ) --> true // empty range
|
||||
none_of_equal ( c, 3 ) --> false
|
||||
none_of_equal ( c.begin (), c.begin () + 3, 3 ) --> true
|
||||
none_of_equal ( c.begin (), c.begin (), 99 ) --> true // empty range
|
||||
``
|
||||
|
||||
[heading Iterator Requirements]
|
||||
|
||||
`none_of` and `none_of_equal` work on all iterators except output iterators.
|
||||
|
||||
[heading Complexity]
|
||||
|
||||
All of the variants of `none_of` and `none_of_equal` run in ['O(N)] (linear) time; that is, they compare against each element in the list once. If any of the comparisons succeed, the algorithm will terminate immediately, without examining the remaining members of the sequence.
|
||||
|
||||
[heading Exception Safety]
|
||||
|
||||
All of the variants of `none_of` and `none_of_equal` take their parameters by value or const reference, and do not depend upon any global state. Therefore, all the routines in this file provide the strong exception guarantee.
|
||||
|
||||
[heading Notes]
|
||||
|
||||
* The routine `none_of` is part of the C++11 standard. When compiled using a C++11 implementation, the implementation from the standard library will be used.
|
||||
|
||||
* `none_of` and `none_of_equal` both return true for empty ranges, no matter what is passed to test against.
|
||||
|
||||
* The second parameter to `none_of_value` is a template parameter, rather than deduced from the first parameter (`std::iterator_traits<InputIterator>::value_type`) because that allows more flexibility for callers, and takes advantage of built-in comparisons for the type that is pointed to by the iterator. The function is defined to return true if, for all elements in the sequence, the expression `*iter == val` evaluates to false (where `iter` is an iterator to each element in the sequence)
|
||||
|
||||
[endsect]
|
||||
|
||||
[/ File none_of.qbk
|
||||
Copyright 2011 Marshall Clow
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt).
|
||||
]
|
||||
|
||||
@@ -1,87 +0,0 @@
|
||||
[/ File one_of.qbk]
|
||||
|
||||
[section:one_of one_of]
|
||||
|
||||
[/license
|
||||
Copyright (c) 2010-2012 Marshall Clow
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
]
|
||||
|
||||
The header file 'boost/algorithm/cxx11/one_of.hpp' contains four variants of a single algorithm, `one_of`. The algorithm tests the elements of a sequence and returns true if exactly one of the elements in the sequence has a particular property.
|
||||
|
||||
The routine `one_of` takes a sequence and a predicate. It will return true if the predicate returns true for one element in the sequence.
|
||||
|
||||
The routine `one_of_equal` takes a sequence and a value. It will return true if one element in the sequence compares equal to the passed in value.
|
||||
|
||||
Both routines come in two forms; the first one takes two iterators to define the range. The second form takes a single range parameter, and uses Boost.Range to traverse it.
|
||||
|
||||
|
||||
[heading interface]
|
||||
|
||||
The function `one_of` returns true if the predicate returns true for one item in the sequence. There are two versions; one takes two iterators, and the other takes a range.
|
||||
|
||||
``
|
||||
namespace boost { namespace algorithm {
|
||||
template<typename InputIterator, typename Predicate>
|
||||
bool one_of ( InputIterator first, InputIterator last, Predicate p );
|
||||
template<typename Range, typename Predicate>
|
||||
bool one_of ( const Range &r, Predicate p );
|
||||
}}
|
||||
``
|
||||
|
||||
The function `one_of_equal` is similar to `one_of`, but instead of taking a predicate to test the elements of the sequence, it takes a value to compare against.
|
||||
|
||||
``
|
||||
namespace boost { namespace algorithm {
|
||||
template<typename InputIterator, typename V>
|
||||
bool one_of_equal ( InputIterator first, InputIterator last, V const &val );
|
||||
template<typename Range, typename V>
|
||||
bool one_of_equal ( const Range &r, V const &val );
|
||||
}}
|
||||
``
|
||||
|
||||
[heading Examples]
|
||||
|
||||
Given the container `c` containing `{ 0, 1, 2, 3, 14, 15 }`, then
|
||||
``
|
||||
bool isOdd ( int i ) { return i % 2 == 1; }
|
||||
bool lessThan10 ( int i ) { return i < 10; }
|
||||
|
||||
using boost::algorithm;
|
||||
one_of ( c, isOdd ) --> false
|
||||
one_of ( c.begin (), c.end (), lessThan10 ) --> false
|
||||
one_of ( c.begin () + 3, c.end (), lessThan10 ) --> true
|
||||
one_of ( c.end (), c.end (), isOdd ) --> false // empty range
|
||||
one_of_equal ( c, 3 ) --> true
|
||||
one_of_equal ( c.begin (), c.begin () + 3, 3 ) --> false
|
||||
one_of_equal ( c.begin (), c.begin (), 99 ) --> false // empty range
|
||||
``
|
||||
|
||||
[heading Iterator Requirements]
|
||||
|
||||
`one_of` and `one_of_equal` work on all iterators except output iterators.
|
||||
|
||||
[heading Complexity]
|
||||
|
||||
All of the variants of `one_of` and `one_of_equal` run in ['O(N)] (linear) time; that is, they compare against each element in the list once. If more than one of the elements in the sequence satisfy the condition, then algorithm will return false immediately, without examining the remaining members of the sequence.
|
||||
|
||||
[heading Exception Safety]
|
||||
|
||||
All of the variants of `one_of` and `one_of_equal` take their parameters by value or const reference, and do not depend upon any global state. Therefore, all the routines in this file provide the strong exception guarantee.
|
||||
|
||||
[heading Notes]
|
||||
|
||||
* `one_of` and `one_of_equal` both return false for empty ranges, no matter what is passed to test against.
|
||||
|
||||
* The second parameter to `one_of_value` is a template parameter, rather than deduced from the first parameter (`std::iterator_traits<InputIterator>::value_type`) because that allows more flexibility for callers, and takes advantage of built-in comparisons for the type that is pointed to by the iterator. The function is defined to return true if, for one element in the sequence, the expression `*iter == val` evaluates to true (where `iter` is an iterator to each element in the sequence)
|
||||
|
||||
[endsect]
|
||||
|
||||
[/ File one_of.qbk
|
||||
Copyright 2011 Marshall Clow
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt).
|
||||
]
|
||||
|
||||
@@ -1,128 +0,0 @@
|
||||
[/ QuickBook Document version 1.5 ]
|
||||
[section:is_sorted is_sorted ]
|
||||
|
||||
[/license
|
||||
|
||||
Copyright (c) 2010-2012 Marshall Clow
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at
|
||||
http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
]
|
||||
|
||||
|
||||
The header file `<boost/algorithm/cxx11/is_sorted.hpp>` contains functions for determining if a sequence is ordered.
|
||||
|
||||
[heading is_sorted]
|
||||
The function `is_sorted(sequence)` determines whether or not a sequence is completely sorted according so some criteria. If no comparison predicate is specified, then std::less_equal is used (i.e, the test is to see if the sequence is non-decreasing)
|
||||
|
||||
``
|
||||
namespace boost { namespace algorithm {
|
||||
template <typename Iterator, typename Pred>
|
||||
bool is_sorted ( Iterator first, Iterator last, Pred p );
|
||||
|
||||
template <typename Iterator>
|
||||
bool is_sorted ( Iterator first, Iterator last );
|
||||
|
||||
|
||||
template <typename Range, typename Pred>
|
||||
bool is_sorted ( const Range &r, Pred p );
|
||||
|
||||
template <typename Range>
|
||||
bool is_sorted ( const Range &r );
|
||||
}}
|
||||
``
|
||||
|
||||
Iterator requirements: The `is_sorted` functions will work on all kinds of iterators (except output iterators).
|
||||
|
||||
[heading is_sorted_until]
|
||||
|
||||
The function `is_sorted_until(sequence, predicate)` compares each sequential pair of elements in the sequence, checking if they satisfy the predicate. it returns the first element of the sequence that does not satisfy the predicate with its' predecessor. In short, it returns the element in the sequence that is "out of order". If all adjacent pairs satisfy the predicate, then it will return one past the last element of the sequence.
|
||||
|
||||
``
|
||||
namespace boost { namespace algorithm {
|
||||
template <typename ForwardIterator, typename Pred>
|
||||
FI is_sorted_until ( ForwardIterator first, ForwardIterator last, Pred p );
|
||||
|
||||
template <typename ForwardIterator>
|
||||
ForwardIterator is_sorted_until ( ForwardIterator first, ForwardIterator last );
|
||||
|
||||
|
||||
template <typename Range, typename Pred>
|
||||
typename boost::range_iterator<const R>::type is_sorted_until ( const Range &r, Pred p );
|
||||
|
||||
template <typename Range>
|
||||
typename boost::range_iterator<const R>::type is_sorted_until ( const Range &r );
|
||||
}}
|
||||
``
|
||||
|
||||
Iterator requirements: The `is_sorted_until` functions will work on forward iterators or better. Since they have to return a place in the input sequence, input iterators will not suffice.
|
||||
|
||||
Complexity:
|
||||
`is_sorted_until` will make at most ['N-1] calls to the predicate (given a sequence of length ['N]).
|
||||
|
||||
Examples:
|
||||
|
||||
Given the sequence `{ 1, 2, 3, 4, 5, 3 }`, `is_sorted_until ( beg, end, std::less<int>())` would return an iterator pointing at the second `3`.
|
||||
|
||||
Given the sequence `{ 1, 2, 3, 4, 5, 9 }`, `is_sorted_until ( beg, end, std::less<int>())` would return `end`.
|
||||
|
||||
|
||||
There are also a set of "wrapper functions" for is_ordered which make it easy to see if an entire sequence is ordered. These functions return a boolean indicating success or failure rather than an iterator to where the out of order items were found.
|
||||
|
||||
To test if a sequence is increasing (each element at least as large as the preceeding one):
|
||||
``
|
||||
namespace boost { namespace algorithm {
|
||||
template <typename Iterator>
|
||||
bool is_increasing ( Iterator first, Iterator last );
|
||||
|
||||
template <typename R>
|
||||
bool is_increasing ( const R &range );
|
||||
}}
|
||||
``
|
||||
|
||||
To test if a sequence is decreasing (each element no larger than the preceeding one):
|
||||
|
||||
``
|
||||
namespace boost { namespace algorithm {
|
||||
template <typename Iterator>
|
||||
bool is_decreasing ( Iterator first, Iterator last );
|
||||
|
||||
template <typename R>
|
||||
bool is_decreasing ( const R &range );
|
||||
}}
|
||||
``
|
||||
|
||||
To test if a sequence is strictly increasing (each element larger than the preceeding one):
|
||||
``
|
||||
namespace boost { namespace algorithm {
|
||||
template <typename Iterator>
|
||||
bool is_strictly_increasing ( Iterator first, Iterator last );
|
||||
|
||||
template <typename R>
|
||||
bool is_strictly_increasing ( const R &range );
|
||||
}}
|
||||
``
|
||||
|
||||
To test if a sequence is strictly decreasing (each element smaller than the preceeding one):
|
||||
``
|
||||
namespace boost { namespace algorithm {
|
||||
template <typename Iterator>
|
||||
bool is_strictly_decreasing ( Iterator first, Iterator last );
|
||||
|
||||
template <typename R>
|
||||
bool is_strictly_decreasing ( const R &range );
|
||||
}}
|
||||
``
|
||||
|
||||
Complexity:
|
||||
Each of these calls is just a thin wrapper over `is_sorted`, so they have the same complexity as `is_sorted`.
|
||||
|
||||
[heading Notes]
|
||||
|
||||
* The routines `is_sorted` and `is_sorted_until` are part of the C++11 standard. When compiled using a C++11 implementation, the implementation from the standard library will be used.
|
||||
|
||||
* `is_sorted` and `is_sorted_until` both return true for empty ranges and ranges of length one.
|
||||
|
||||
[endsect]
|
||||
@@ -1,68 +0,0 @@
|
||||
[/ File partition_point.qbk]
|
||||
|
||||
[section:partition_point partition_point ]
|
||||
|
||||
[/license
|
||||
Copyright (c) 2010-2012 Marshall Clow
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
]
|
||||
|
||||
The header file 'partition_point.hpp' contains two variants of a single algorithm, `partition_point`. Given a partitioned sequence and a predicate, the algorithm finds the partition point; i.e, the first element in the sequence that does not satisfy the predicate.
|
||||
|
||||
The routine `partition_point` takes a partitioned sequence and a predicate. It returns an iterator which 'points to' the first element in the sequence that does not satisfy the predicate. If all the items in the sequence satisfy the predicate, then it returns one past the final element in the sequence.
|
||||
|
||||
`partition_point` come in two forms; the first one takes two iterators to define the range. The second form takes a single range parameter, and uses Boost.Range to traverse it.
|
||||
|
||||
|
||||
[heading interface]
|
||||
|
||||
There are two versions; one takes two iterators, and the other takes a range.
|
||||
|
||||
``
|
||||
template<typename ForwardIterator, typename Predicate>
|
||||
ForwardIterator partition_point ( ForwardIterator first, ForwardIterator last, Predicate p );
|
||||
template<typename Range, typename Predicate>
|
||||
boost::range_iterator<Range> partition_point ( const Range &r, Predicate p );
|
||||
``
|
||||
|
||||
[heading Examples]
|
||||
|
||||
Given the container `c` containing `{ 0, 1, 2, 3, 14, 15 }`, then
|
||||
``
|
||||
bool lessThan10 ( int i ) { return i < 10; }
|
||||
bool isOdd ( int i ) { return i % 2 == 1; }
|
||||
|
||||
partition_point ( c, lessThan10 ) --> c.begin () + 4 (pointing at 14)
|
||||
partition_point ( c.begin (), c.end (), lessThan10 ) --> c.begin () + 4 (pointing at 14)
|
||||
partition_point ( c.begin (), c.begin () + 3, lessThan10 ) -> c.begin () + 3 (end)
|
||||
partition_point ( c.end (), c.end (), isOdd ) --> c.end () // empty range
|
||||
``
|
||||
|
||||
[heading Iterator Requirements]
|
||||
|
||||
`partition_point` requires forward iterators or better; it will not work on input iterators or output iterators.
|
||||
|
||||
[heading Complexity]
|
||||
|
||||
Both of the variants of `partition_point` run in ['O( log (N))] (logarithmic) time; that is, the predicate will be will be applied approximately ['log(N)] times. To do this, however, the algorithm needs to know the size of the sequence. For forward and bidirectional iterators, calculating the size of the sequence is an ['O(N)] operation.
|
||||
|
||||
[heading Exception Safety]
|
||||
|
||||
Both of the variants of `partition_point` take their parameters by value or const reference, and do not depend upon any global state. Therefore, all the routines in this file provide the strong exception guarantee.
|
||||
|
||||
[heading Notes]
|
||||
|
||||
* The iterator-based version of the routine `partition_point` is part of the C++11 standard. When compiled using a C++11 implementation, the implementation from the standard library will be used.
|
||||
|
||||
* For empty ranges, the partition point is the end of the range.
|
||||
|
||||
[endsect]
|
||||
|
||||
[/ File partition_point.qbk
|
||||
Copyright 2011 Marshall Clow
|
||||
Distributed under the Boost Software License, Version 1.0.
|
||||
(See accompanying file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt).
|
||||
]
|
||||
|
||||
@@ -1,22 +0,0 @@
|
||||
# Boost algorithm library example programs Jamfile
|
||||
#
|
||||
# Copyright Marshall Clow 2010-2012. Use, modification and
|
||||
# distribution is subject to the Boost Software License, Version
|
||||
# 1.0. (See accompanying file LICENSE_1_0.txt or copy at
|
||||
# http://www.boost.org/LICENSE_1_0.txt)
|
||||
#
|
||||
# See http://www.boost.org for updates, documentation, and revision history.
|
||||
|
||||
|
||||
project /boost/algorithm/example
|
||||
: requirements
|
||||
<include>../../../
|
||||
<optimization>speed
|
||||
<toolset>msvc:<define>_SCL_SECURE_NO_WARNINGS
|
||||
<toolset>msvc:<define>NOMINMAX
|
||||
<link>static
|
||||
:
|
||||
;
|
||||
|
||||
exe clamp_example : clamp_example.cpp ;
|
||||
exe search_example : search_example.cpp ;
|
||||
@@ -1,54 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <string>
|
||||
#include <iostream> // for cout, etc
|
||||
|
||||
#include <boost/algorithm/clamp.hpp>
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
|
||||
bool compare_string_lengths ( const std::string &one, const std::string &two )
|
||||
{
|
||||
return one.length () < two.length ();
|
||||
}
|
||||
|
||||
int main ( int /*argc*/, char * /*argv*/ [] ) {
|
||||
// Clamp takes a value and two "fenceposts", and brings the value "between" the fenceposts.
|
||||
|
||||
// If the input value is "between" the fenceposts, then it is returned unchanged.
|
||||
std::cout << "Clamping 5 to between [1, 10] -> " << ba::clamp ( 5, 1, 10 ) << std::endl;
|
||||
|
||||
// If the input value is out side the range of the fenceposts, it "brought into" range.
|
||||
std::cout << "Clamping 15 to between [1, 10] -> " << ba::clamp ( 15, 1, 10 ) << std::endl;
|
||||
std::cout << "Clamping -15 to between [1, 10] -> " << ba::clamp ( -15, 1, 10 ) << std::endl;
|
||||
|
||||
// It doesn't just work for ints
|
||||
std::cout << "Clamping 5.1 to between [1, 10] -> " << ba::clamp ( 5.1, 1.0, 10.0 ) << std::endl;
|
||||
|
||||
{
|
||||
std::string one ( "Lower Bound" ), two ( "upper bound!" ), test1 ( "test#" ), test2 ( "#test" );
|
||||
std::cout << "Clamping '" << test1 << "' between ['" << one << "' and '" << two << "'] -> '" <<
|
||||
ba::clamp ( test1, one, two ) << "'" << std::endl;
|
||||
std::cout << "Clamping '" << test2 << "' between ['" << one << "' and '" << two << "'] -> '" <<
|
||||
ba::clamp ( test2, one, two ) << "'" << std::endl;
|
||||
// There is also a predicate based version, if you want to compare objects in your own way
|
||||
std::cout << "Clamping '" << test1 << "' between ['" << one << "' and '" << two << "'] (comparing lengths) -> '" <<
|
||||
ba::clamp ( test1, one, two, compare_string_lengths ) << "'" << std::endl;
|
||||
std::cout << "Clamping '" << test2 << "' between ['" << one << "' and '" << two << "'] (comparing lengths) -> '" <<
|
||||
ba::clamp ( test2, one, two, compare_string_lengths ) << "'" << std::endl;
|
||||
|
||||
}
|
||||
|
||||
// Sometimes, though, you don't get quite what you expect
|
||||
// This is because the two double arguments get converted to int
|
||||
std::cout << "Somewhat unexpected: clamp ( 12, 14.7, 15.9 ) --> " << ba::clamp ( 12, 14.7, 15.9 ) << std::endl;
|
||||
std::cout << "Expected: clamp ((double)12, 14.7, 15.9 ) --> " << ba::clamp ((double) 12, 14.7, 15.9 ) << std::endl;
|
||||
return 0;
|
||||
}
|
||||
@@ -1,57 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <string>
|
||||
#include <iostream> // for cout, etc.
|
||||
|
||||
#include <boost/algorithm/searching/boyer_moore.hpp>
|
||||
#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
|
||||
#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
|
||||
const std::string haystack ( "ABACAB is it everywhere!" );
|
||||
const std::string needle1 ( "ACAB" );
|
||||
const std::string needle2 ( "not ABA" );
|
||||
|
||||
|
||||
|
||||
int main ( int /*argc*/, char * /*argv*/ [] ) {
|
||||
// In search.hpp, there are generic implementations of three classic sequence search
|
||||
// algorithms. They all have the same (dual) interface.
|
||||
|
||||
// There is a procedural interface, based on std::search:
|
||||
if ( ba::boyer_moore_search ( haystack.begin (), haystack.end (), needle1.begin (), needle1.end ()) != haystack.end ())
|
||||
std::cout << "Found '" << needle1 << "' in '" << haystack << "' (boyer-moore 1)" << std::endl;
|
||||
else
|
||||
std::cout << "Did NOT find '" << needle1 << "' in '" << haystack << "' (boyer-moore 1)" << std::endl;
|
||||
|
||||
// If you plan on searching for the same pattern in several different data sets,
|
||||
// you can create a search object and use that over and over again - amortizing the setup
|
||||
// costs across several searches
|
||||
ba::boyer_moore<std::string::const_iterator> search1 ( needle1.begin (), needle1.end ());
|
||||
if ( search1 ( haystack.begin (), haystack.end ()) != haystack.end ())
|
||||
std::cout << "Found '" << needle1 << "' in '" << haystack << "' (boyer-moore 2)" << std::endl;
|
||||
else
|
||||
std::cout << "Did NOT find '" << needle1 << "' in '" << haystack << "' (boyer-moore 2)" << std::endl;
|
||||
|
||||
// There is also an implementation of boyer-moore-horspool searching
|
||||
if ( ba::boyer_moore_horspool_search ( haystack.begin (), haystack.end (), needle1.begin (), needle1.end ()) != haystack.end ())
|
||||
std::cout << "Found '" << needle1 << "' in '" << haystack << "' (boyer-moore-horspool)" << std::endl;
|
||||
else
|
||||
std::cout << "Did NOT find '" << needle1 << "' in '" << haystack << "' (boyer-moore-horspool)" << std::endl;
|
||||
|
||||
// And also the knuth-pratt-morris search algorithm
|
||||
if ( ba::knuth_morris_pratt_search ( haystack.begin (), haystack.end (), needle1.begin (), needle1.end ()) != haystack.end ())
|
||||
std::cout << "Found '" << needle1 << "' in '" << haystack << "' (knuth_morris_pratt)" << std::endl;
|
||||
else
|
||||
std::cout << "Did NOT find '" << needle1 << "' in '" << haystack << "' (knuth_morris_pratt)" << std::endl;
|
||||
|
||||
return 0;
|
||||
}
|
||||
@@ -1,175 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2008-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
Revision history:
|
||||
27 June 2009 mtc First version
|
||||
23 Oct 2010 mtc Added predicate version
|
||||
|
||||
*/
|
||||
|
||||
/// \file clamp.hpp
|
||||
/// \brief Clamp algorithm
|
||||
/// \author Marshall Clow
|
||||
///
|
||||
/// Suggested by olafvdspek in https://svn.boost.org/trac/boost/ticket/3215
|
||||
|
||||
#ifndef BOOST_ALGORITHM_CLAMP_HPP
|
||||
#define BOOST_ALGORITHM_CLAMP_HPP
|
||||
|
||||
#include <functional> // For std::less
|
||||
#include <iterator> // For std::iterator_traits
|
||||
#include <cassert>
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
#include <boost/mpl/identity.hpp> // for identity
|
||||
#include <boost/utility/enable_if.hpp> // for boost::disable_if
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
/// \fn clamp ( T const& val,
|
||||
/// typename boost::mpl::identity<T>::type const& lo,
|
||||
/// typename boost::mpl::identity<T>::type const& hi, Pred p )
|
||||
/// \return the value "val" brought into the range [ lo, hi ]
|
||||
/// using the comparison predicate p.
|
||||
/// If p ( val, lo ) return lo.
|
||||
/// If p ( hi, val ) return hi.
|
||||
/// Otherwise, return the original value.
|
||||
///
|
||||
/// \param val The value to be clamped
|
||||
/// \param lo The lower bound of the range to be clamped to
|
||||
/// \param hi The upper bound of the range to be clamped to
|
||||
/// \param p A predicate to use to compare the values.
|
||||
/// p ( a, b ) returns a boolean.
|
||||
///
|
||||
template<typename T, typename Pred>
|
||||
T const & clamp ( T const& val,
|
||||
typename boost::mpl::identity<T>::type const & lo,
|
||||
typename boost::mpl::identity<T>::type const & hi, Pred p )
|
||||
{
|
||||
// assert ( !p ( hi, lo )); // Can't assert p ( lo, hi ) b/c they might be equal
|
||||
return p ( val, lo ) ? lo : p ( hi, val ) ? hi : val;
|
||||
}
|
||||
|
||||
|
||||
/// \fn clamp ( T const& val,
|
||||
/// typename boost::mpl::identity<T>::type const& lo,
|
||||
/// typename boost::mpl::identity<T>::type const& hi )
|
||||
/// \return the value "val" brought into the range [ lo, hi ].
|
||||
/// If the value is less than lo, return lo.
|
||||
/// If the value is greater than "hi", return hi.
|
||||
/// Otherwise, return the original value.
|
||||
///
|
||||
/// \param val The value to be clamped
|
||||
/// \param lo The lower bound of the range to be clamped to
|
||||
/// \param hi The upper bound of the range to be clamped to
|
||||
///
|
||||
template<typename T>
|
||||
T const& clamp ( const T& val,
|
||||
typename boost::mpl::identity<T>::type const & lo,
|
||||
typename boost::mpl::identity<T>::type const & hi )
|
||||
{
|
||||
return (clamp) ( val, lo, hi, std::less<T>());
|
||||
}
|
||||
|
||||
/// \fn clamp_range ( InputIterator first, InputIterator last, OutputIterator out,
|
||||
/// std::iterator_traits<InputIterator>::value_type lo,
|
||||
/// std::iterator_traits<InputIterator>::value_type hi )
|
||||
/// \return clamp the sequence of values [first, last) into [ lo, hi ]
|
||||
///
|
||||
/// \param first The start of the range of values
|
||||
/// \param last One past the end of the range of input values
|
||||
/// \param out An output iterator to write the clamped values into
|
||||
/// \param lo The lower bound of the range to be clamped to
|
||||
/// \param hi The upper bound of the range to be clamped to
|
||||
///
|
||||
template<typename InputIterator, typename OutputIterator>
|
||||
OutputIterator clamp_range ( InputIterator first, InputIterator last, OutputIterator out,
|
||||
typename std::iterator_traits<InputIterator>::value_type lo,
|
||||
typename std::iterator_traits<InputIterator>::value_type hi )
|
||||
{
|
||||
// this could also be written with bind and std::transform
|
||||
while ( first != last )
|
||||
*out++ = clamp ( *first++, lo, hi );
|
||||
return out;
|
||||
}
|
||||
|
||||
/// \fn clamp_range ( const Range &r, OutputIterator out,
|
||||
/// typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type lo,
|
||||
/// typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type hi )
|
||||
/// \return clamp the sequence of values [first, last) into [ lo, hi ]
|
||||
///
|
||||
/// \param r The range of values to be clamped
|
||||
/// \param out An output iterator to write the clamped values into
|
||||
/// \param lo The lower bound of the range to be clamped to
|
||||
/// \param hi The upper bound of the range to be clamped to
|
||||
///
|
||||
template<typename Range, typename OutputIterator>
|
||||
typename boost::disable_if_c<boost::is_same<Range, OutputIterator>::value, OutputIterator>::type
|
||||
clamp_range ( const Range &r, OutputIterator out,
|
||||
typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type lo,
|
||||
typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type hi )
|
||||
{
|
||||
return clamp_range ( boost::begin ( r ), boost::end ( r ), out, lo, hi );
|
||||
}
|
||||
|
||||
|
||||
/// \fn clamp_range ( InputIterator first, InputIterator last, OutputIterator out,
|
||||
/// std::iterator_traits<InputIterator>::value_type lo,
|
||||
/// std::iterator_traits<InputIterator>::value_type hi, Pred p )
|
||||
/// \return clamp the sequence of values [first, last) into [ lo, hi ]
|
||||
/// using the comparison predicate p.
|
||||
///
|
||||
/// \param first The start of the range of values
|
||||
/// \param last One past the end of the range of input values
|
||||
/// \param out An output iterator to write the clamped values into
|
||||
/// \param lo The lower bound of the range to be clamped to
|
||||
/// \param hi The upper bound of the range to be clamped to
|
||||
/// \param p A predicate to use to compare the values.
|
||||
/// p ( a, b ) returns a boolean.
|
||||
|
||||
///
|
||||
template<typename InputIterator, typename OutputIterator, typename Pred>
|
||||
OutputIterator clamp_range ( InputIterator first, InputIterator last, OutputIterator out,
|
||||
typename std::iterator_traits<InputIterator>::value_type lo,
|
||||
typename std::iterator_traits<InputIterator>::value_type hi, Pred p )
|
||||
{
|
||||
// this could also be written with bind and std::transform
|
||||
while ( first != last )
|
||||
*out++ = clamp ( *first++, lo, hi, p );
|
||||
return out;
|
||||
}
|
||||
|
||||
/// \fn clamp_range ( const Range &r, OutputIterator out,
|
||||
/// typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type lo,
|
||||
/// typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type hi,
|
||||
/// Pred p )
|
||||
/// \return clamp the sequence of values [first, last) into [ lo, hi ]
|
||||
/// using the comparison predicate p.
|
||||
///
|
||||
/// \param r The range of values to be clamped
|
||||
/// \param out An output iterator to write the clamped values into
|
||||
/// \param lo The lower bound of the range to be clamped to
|
||||
/// \param hi The upper bound of the range to be clamped to
|
||||
/// \param p A predicate to use to compare the values.
|
||||
/// p ( a, b ) returns a boolean.
|
||||
//
|
||||
// Disable this template if the first two parameters are the same type;
|
||||
// In that case, the user will get the two iterator version.
|
||||
template<typename Range, typename OutputIterator, typename Pred>
|
||||
typename boost::disable_if_c<boost::is_same<Range, OutputIterator>::value, OutputIterator>::type
|
||||
clamp_range ( const Range &r, OutputIterator out,
|
||||
typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type lo,
|
||||
typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type hi,
|
||||
Pred p )
|
||||
{
|
||||
return clamp_range ( boost::begin ( r ), boost::end ( r ), out, lo, hi, p );
|
||||
}
|
||||
|
||||
|
||||
}}
|
||||
|
||||
#endif // BOOST_ALGORITHM_CLAMP_HPP
|
||||
@@ -1,91 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2008-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file all_of.hpp
|
||||
/// \brief Test ranges to see if all elements match a value or predicate.
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_ALL_OF_HPP
|
||||
#define BOOST_ALGORITHM_ALL_OF_HPP
|
||||
|
||||
#include <algorithm> // for std::all_of, if available
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of all_of if it is available
|
||||
using std::all_of; // Section 25.2.1
|
||||
#else
|
||||
/// \fn all_of ( InputIterator first, InputIterator last, Predicate p )
|
||||
/// \return true if all elements in [first, last) satisfy the predicate 'p'
|
||||
/// \note returns true on an empty range
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param p A predicate for testing the elements of the sequence
|
||||
///
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template<typename InputIterator, typename Predicate>
|
||||
bool all_of ( InputIterator first, InputIterator last, Predicate p )
|
||||
{
|
||||
for ( ; first != last; ++first )
|
||||
if ( !p(*first))
|
||||
return false;
|
||||
return true;
|
||||
}
|
||||
#endif
|
||||
|
||||
/// \fn all_of ( const Range &r, Predicate p )
|
||||
/// \return true if all elements in the range satisfy the predicate 'p'
|
||||
/// \note returns true on an empty range
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename Range, typename Predicate>
|
||||
bool all_of ( const Range &r, Predicate p )
|
||||
{
|
||||
return boost::algorithm::all_of ( boost::begin (r), boost::end (r), p );
|
||||
}
|
||||
|
||||
/// \fn all_of_equal ( InputIterator first, InputIterator last, const T &val )
|
||||
/// \return true if all elements in [first, last) are equal to 'val'
|
||||
/// \note returns true on an empty range
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param val A value to compare against
|
||||
///
|
||||
template<typename InputIterator, typename T>
|
||||
bool all_of_equal ( InputIterator first, InputIterator last, const T &val )
|
||||
{
|
||||
for ( ; first != last; ++first )
|
||||
if ( val != *first )
|
||||
return false;
|
||||
return true;
|
||||
}
|
||||
|
||||
/// \fn all_of_equal ( const Range &r, const T &val )
|
||||
/// \return true if all elements in the range are equal to 'val'
|
||||
/// \note returns true on an empty range
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param val A value to compare against
|
||||
///
|
||||
template<typename Range, typename T>
|
||||
bool all_of_equal ( const Range &r, const T &val )
|
||||
{
|
||||
return boost::algorithm::all_of_equal ( boost::begin (r), boost::end (r), val );
|
||||
}
|
||||
|
||||
}} // namespace boost and algorithm
|
||||
|
||||
#endif // BOOST_ALGORITHM_ALL_OF_HPP
|
||||
@@ -1,90 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2008-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
/// \file
|
||||
/// \brief Test ranges to see if any elements match a value or predicate.
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_ANY_OF_HPP
|
||||
#define BOOST_ALGORITHM_ANY_OF_HPP
|
||||
|
||||
#include <algorithm> // for std::any_of, if available
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
// Use the C++11 versions of any_of if it is available
|
||||
#if __cplusplus >= 201103L
|
||||
using std::any_of; // Section 25.2.2
|
||||
#else
|
||||
/// \fn any_of ( InputIterator first, InputIterator last, Predicate p )
|
||||
/// \return true if any of the elements in [first, last) satisfy the predicate
|
||||
/// \note returns false on an empty range
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param p A predicate for testing the elements of the sequence
|
||||
///
|
||||
template<typename InputIterator, typename Predicate>
|
||||
bool any_of ( InputIterator first, InputIterator last, Predicate p )
|
||||
{
|
||||
for ( ; first != last; ++first )
|
||||
if ( p(*first))
|
||||
return true;
|
||||
return false;
|
||||
}
|
||||
#endif
|
||||
|
||||
/// \fn any_of ( const Range &r, Predicate p )
|
||||
/// \return true if any elements in the range satisfy the predicate 'p'
|
||||
/// \note returns false on an empty range
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename Range, typename Predicate>
|
||||
bool any_of ( const Range &r, Predicate p )
|
||||
{
|
||||
return boost::algorithm::any_of (boost::begin (r), boost::end (r), p);
|
||||
}
|
||||
|
||||
/// \fn any_of_equal ( InputIterator first, InputIterator last, const V &val )
|
||||
/// \return true if any of the elements in [first, last) are equal to 'val'
|
||||
/// \note returns false on an empty range
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param val A value to compare against
|
||||
///
|
||||
template<typename InputIterator, typename V>
|
||||
bool any_of_equal ( InputIterator first, InputIterator last, const V &val )
|
||||
{
|
||||
for ( ; first != last; ++first )
|
||||
if ( val == *first )
|
||||
return true;
|
||||
return false;
|
||||
}
|
||||
|
||||
/// \fn any_of_equal ( const Range &r, const V &val )
|
||||
/// \return true if any of the elements in the range are equal to 'val'
|
||||
/// \note returns false on an empty range
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param val A value to compare against
|
||||
///
|
||||
template<typename Range, typename V>
|
||||
bool any_of_equal ( const Range &r, const V &val )
|
||||
{
|
||||
return boost::algorithm::any_of_equal (boost::begin (r), boost::end (r), val);
|
||||
}
|
||||
|
||||
}} // namespace boost and algorithm
|
||||
|
||||
#endif // BOOST_ALGORITHM_ANY_OF_HPP
|
||||
@@ -1,133 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2008-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file copy_if.hpp
|
||||
/// \brief Copy a subset of a sequence to a new sequence
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_COPY_IF_HPP
|
||||
#define BOOST_ALGORITHM_COPY_IF_HPP
|
||||
|
||||
#include <algorithm> // for std::copy_if, if available
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of copy_if if it is available
|
||||
using std::copy_if; // Section 25.3.1
|
||||
#else
|
||||
/// \fn copy_if ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
|
||||
/// \brief Copies all the elements from the input range that satisfy the
|
||||
/// predicate to the output range.
|
||||
/// \return The updated output iterator
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param result An output iterator to write the results into
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template<typename InputIterator, typename OutputIterator, typename Predicate>
|
||||
OutputIterator copy_if ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
|
||||
{
|
||||
for ( ; first != last; ++first )
|
||||
if (p(*first))
|
||||
*result++ = first;
|
||||
return result;
|
||||
}
|
||||
#endif
|
||||
|
||||
/// \fn copy_if ( const Range &r, OutputIterator result, Predicate p )
|
||||
/// \brief Copies all the elements from the input range that satisfy the
|
||||
/// predicate to the output range.
|
||||
/// \return The updated output iterator
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param result An output iterator to write the results into
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename Range, typename OutputIterator, typename Predicate>
|
||||
OutputIterator copy_if ( const Range &r, OutputIterator result, Predicate p )
|
||||
{
|
||||
return boost::algorithm::copy_if (boost::begin (r), boost::end(r), result, p);
|
||||
}
|
||||
|
||||
|
||||
/// \fn copy_while ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
|
||||
/// \brief Copies all the elements at the start of the input range that
|
||||
/// satisfy the predicate to the output range.
|
||||
/// \return The updated output iterator
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param result An output iterator to write the results into
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename InputIterator, typename OutputIterator, typename Predicate>
|
||||
OutputIterator copy_while ( InputIterator first, InputIterator last,
|
||||
OutputIterator result, Predicate p )
|
||||
{
|
||||
for ( ; first != last && p(*first); ++first )
|
||||
*result++ = first;
|
||||
return result;
|
||||
}
|
||||
|
||||
/// \fn copy_while ( const Range &r, OutputIterator result, Predicate p )
|
||||
/// \brief Copies all the elements at the start of the input range that
|
||||
/// satisfy the predicate to the output range.
|
||||
/// \return The updated output iterator
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param result An output iterator to write the results into
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename Range, typename OutputIterator, typename Predicate>
|
||||
OutputIterator copy_while ( const Range &r, OutputIterator result, Predicate p )
|
||||
{
|
||||
return boost::algorithm::copy_while (boost::begin (r), boost::end(r), result, p);
|
||||
}
|
||||
|
||||
|
||||
/// \fn copy_until ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
|
||||
/// \brief Copies all the elements at the start of the input range that do not
|
||||
/// satisfy the predicate to the output range.
|
||||
/// \return The updated output iterator
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param result An output iterator to write the results into
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename InputIterator, typename OutputIterator, typename Predicate>
|
||||
OutputIterator copy_until ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
|
||||
{
|
||||
for ( ; first != last && !p(*first); ++first )
|
||||
*result++ = first;
|
||||
return result;
|
||||
}
|
||||
|
||||
/// \fn copy_until ( const Range &r, OutputIterator result, Predicate p )
|
||||
/// \brief Copies all the elements at the start of the input range that do not
|
||||
/// satisfy the predicate to the output range.
|
||||
/// \return The updated output iterator
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param result An output iterator to write the results into
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename Range, typename OutputIterator, typename Predicate>
|
||||
OutputIterator copy_until ( const Range &r, OutputIterator result, Predicate p )
|
||||
{
|
||||
return boost::algorithm::copy_until (boost::begin (r), boost::end(r), result, p);
|
||||
}
|
||||
|
||||
}} // namespace boost and algorithm
|
||||
|
||||
#endif // BOOST_ALGORITHM_COPY_IF_HPP
|
||||
@@ -1,44 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file copy_n.hpp
|
||||
/// \brief Copy n items from one sequence to another
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_COPY_N_HPP
|
||||
#define BOOST_ALGORITHM_COPY_N_HPP
|
||||
|
||||
#include <algorithm> // for std::copy_n, if available
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of copy_n if it is available
|
||||
using std::copy_n; // Section 25.3.1
|
||||
#else
|
||||
/// \fn copy_n ( InputIterator first, Size n, OutputIterator result )
|
||||
/// \brief Copies exactly n (n > 0) elements from the range starting at first to
|
||||
/// the range starting at result.
|
||||
/// \return The updated output iterator
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param n The number of elements to copy
|
||||
/// \param result An output iterator to write the results into
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template <typename InputIterator, typename Size, typename OutputIterator>
|
||||
OutputIterator copy_n ( InputIterator first, Size n, OutputIterator result )
|
||||
{
|
||||
for ( ; n > 0; --n, ++first, ++result )
|
||||
*result = *first;
|
||||
return result;
|
||||
}
|
||||
#endif
|
||||
}} // namespace boost and algorithm
|
||||
|
||||
#endif // BOOST_ALGORITHM_COPY_IF_HPP
|
||||
@@ -1,60 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file find_if_not.hpp
|
||||
/// \brief Find the first element in a sequence that does not satisfy a predicate.
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_FIND_IF_NOT_HPP
|
||||
#define BOOST_ALGORITHM_FIND_IF_NOT_HPP
|
||||
|
||||
#include <algorithm> // for std::find_if_not, if it exists
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of find_if_not if it is available
|
||||
using std::find_if_not; // Section 25.2.5
|
||||
#else
|
||||
/// \fn find_if_not(InputIterator first, InputIterator last, Predicate p)
|
||||
/// \brief Finds the first element in the sequence that does not satisfy the predicate.
|
||||
/// \return The iterator pointing to the desired element.
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template<typename InputIterator, typename Predicate>
|
||||
InputIterator find_if_not ( InputIterator first, InputIterator last, Predicate p )
|
||||
{
|
||||
for ( ; first != last; ++first )
|
||||
if ( !p(*first))
|
||||
break;
|
||||
return first;
|
||||
}
|
||||
#endif
|
||||
|
||||
/// \fn find_if_not ( const Range &r, Predicate p )
|
||||
/// \brief Finds the first element in the sequence that does not satisfy the predicate.
|
||||
/// \return The iterator pointing to the desired element.
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename Range, typename Predicate>
|
||||
typename boost::range_iterator<const Range>::type find_if_not ( const Range &r, Predicate p )
|
||||
{
|
||||
return boost::algorithm::find_if_not (boost::begin (r), boost::end(r), p);
|
||||
}
|
||||
|
||||
}}
|
||||
#endif // BOOST_ALGORITHM_FIND_IF_NOT_HPP
|
||||
@@ -1,74 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2008-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file iota.hpp
|
||||
/// \brief Generate an increasing series
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_IOTA_HPP
|
||||
#define BOOST_ALGORITHM_IOTA_HPP
|
||||
|
||||
#include <numeric>
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of iota if it is available
|
||||
using std::iota; // Section 26.7.6
|
||||
#else
|
||||
/// \fn iota ( ForwardIterator first, ForwardIterator last, T value )
|
||||
/// \brief Generates an increasing sequence of values, and stores them in [first, last)
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param value The initial value of the sequence to be generated
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template <typename ForwardIterator, typename T>
|
||||
void iota ( ForwardIterator first, ForwardIterator last, T value )
|
||||
{
|
||||
for ( ; first != last; ++first, ++value )
|
||||
*first = value;
|
||||
}
|
||||
#endif
|
||||
|
||||
/// \fn iota ( Range &r, T value )
|
||||
/// \brief Generates an increasing sequence of values, and stores them in the input Range.
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param value The initial value of the sequence to be generated
|
||||
///
|
||||
template <typename Range, typename T>
|
||||
void iota ( Range &r, T value )
|
||||
{
|
||||
boost::algorithm::iota (boost::begin(r), boost::end(r), value);
|
||||
}
|
||||
|
||||
|
||||
/// \fn iota_n ( OutputIterator out, T value, std::size_t n )
|
||||
/// \brief Generates an increasing sequence of values, and stores them in the input Range.
|
||||
///
|
||||
/// \param out An output iterator to write the results into
|
||||
/// \param value The initial value of the sequence to be generated
|
||||
/// \param n The number of items to write
|
||||
///
|
||||
template <typename OutputIterator, typename T>
|
||||
OutputIterator iota_n ( OutputIterator out, T value, std::size_t n )
|
||||
{
|
||||
while ( n-- > 0 )
|
||||
*out++ = value++;
|
||||
|
||||
return out;
|
||||
}
|
||||
|
||||
}}
|
||||
|
||||
#endif // BOOST_ALGORITHM_IOTA_HPP
|
||||
@@ -1,65 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file is_partitioned.hpp
|
||||
/// \brief Tell if a sequence is partitioned
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_IS_PARTITIONED_HPP
|
||||
#define BOOST_ALGORITHM_IS_PARTITIONED_HPP
|
||||
|
||||
#include <algorithm> // for std::is_partitioned, if available
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of iota if it is available
|
||||
using std::is_partitioned; // Section 25.3.13
|
||||
#else
|
||||
/// \fn is_partitioned ( InputIterator first, InputIterator last, UnaryPredicate p )
|
||||
/// \brief Tests to see if a sequence is partititioned according to a predicate
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param p The predicicate to test the values with
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template <typename InputIterator, typename UnaryPredicate>
|
||||
bool is_partitioned ( InputIterator first, InputIterator last, UnaryPredicate p )
|
||||
{
|
||||
// Run through the part that satisfy the predicate
|
||||
for ( ; first != last; ++first )
|
||||
if ( !p (*first))
|
||||
break;
|
||||
// Now the part that does not satisfy the predicate
|
||||
for ( ; first != last; ++first )
|
||||
if ( p (*first))
|
||||
return false;
|
||||
return true;
|
||||
}
|
||||
#endif
|
||||
|
||||
/// \fn is_partitioned ( const Range &r, UnaryPredicate p )
|
||||
/// \brief Generates an increasing sequence of values, and stores them in the input Range.
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param p The predicicate to test the values with
|
||||
///
|
||||
template <typename Range, typename UnaryPredicate>
|
||||
bool is_partitioned ( const Range &r, UnaryPredicate p )
|
||||
{
|
||||
return boost::algorithm::is_partitioned (boost::begin(r), boost::end(r), p);
|
||||
}
|
||||
|
||||
|
||||
}}
|
||||
|
||||
#endif // BOOST_ALGORITHM_IS_PARTITIONED_HPP
|
||||
@@ -1,139 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file is_permutation.hpp
|
||||
/// \brief Is a sequence a permutation of another sequence
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_IS_PERMUTATION_HPP
|
||||
#define BOOST_ALGORITHM_IS_PERMUTATION_HPP
|
||||
|
||||
#include <algorithm> // for std::less, tie, mismatch and is_permutation (if available)
|
||||
#include <utility> // for std::make_pair
|
||||
#include <functional> // for std::equal_to
|
||||
#include <iterator>
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
#include <boost/utility/enable_if.hpp>
|
||||
#include <boost/type_traits/is_same.hpp>
|
||||
#include <boost/tr1/tr1/tuple> // for tie
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of is_permutation if it is available
|
||||
using std::is_permutation; // Section 25.2.12
|
||||
#else
|
||||
/// \cond DOXYGEN_HIDE
|
||||
namespace detail {
|
||||
template <typename Predicate, typename Iterator>
|
||||
struct value_predicate {
|
||||
value_predicate ( Predicate p, Iterator it ) : p_ ( p ), it_ ( it ) {}
|
||||
|
||||
template <typename T1>
|
||||
bool operator () ( const T1 &t1 ) const { return p_ ( *it_, t1 ); }
|
||||
private:
|
||||
Predicate &p_;
|
||||
Iterator it_;
|
||||
};
|
||||
}
|
||||
/// \endcond
|
||||
|
||||
|
||||
/// \fn is_permutation ( ForwardIterator1 first, ForwardIterator1 last, ForwardIterator2 first2, BinaryPredicate p )
|
||||
/// \brief Tests to see if a the sequence [first,last) is a permutation of the sequence starting at first2
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param first2 The start of the second sequence
|
||||
/// \param p The predicate to compare elements with
|
||||
///
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template< class ForwardIterator1, class ForwardIterator2, class BinaryPredicate >
|
||||
bool is_permutation ( ForwardIterator1 first1, ForwardIterator1 last1,
|
||||
ForwardIterator2 first2, BinaryPredicate p )
|
||||
{
|
||||
// Skip the common prefix (if any)
|
||||
// std::tie (first1, first2) = std::mismatch (first1, last1, first2, p);
|
||||
std::pair<ForwardIterator1, ForwardIterator2> eq = std::mismatch (first1, last1, first2, p);
|
||||
first1 = eq.first;
|
||||
first2 = eq.second;
|
||||
if ( first1 != last1 ) {
|
||||
// Create last2
|
||||
ForwardIterator2 last2 = first2;
|
||||
std::advance ( last2, std::distance (first1, last1));
|
||||
|
||||
// for each unique value in the sequence [first1,last1), count how many times
|
||||
// it occurs, and make sure it occurs the same number of times in [first2, last2)
|
||||
for ( ForwardIterator1 iter = first1; iter != last1; ++iter ) {
|
||||
detail::value_predicate<BinaryPredicate, ForwardIterator1> pred ( p, iter );
|
||||
|
||||
/* For each value we haven't seen yet... */
|
||||
if ( std::find_if ( first1, iter, pred ) == iter ) {
|
||||
std::size_t dest_count = std::count_if ( first2, last2, pred );
|
||||
if ( dest_count == 0 || dest_count != (std::size_t) std::count_if ( iter, last1, pred ))
|
||||
return false;
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
return true;
|
||||
}
|
||||
|
||||
/// \fn is_permutation ( ForwardIterator1 first, ForwardIterator1 last, ForwardIterator2 first2 )
|
||||
/// \brief Tests to see if a the sequence [first,last) is a permutation of the sequence starting at first2
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param first2 The start of the second sequence
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template< class ForwardIterator1, class ForwardIterator2 >
|
||||
bool is_permutation ( ForwardIterator1 first, ForwardIterator1 last, ForwardIterator2 first2 )
|
||||
{
|
||||
// How should I deal with the idea that ForwardIterator1::value_type
|
||||
// and ForwardIterator2::value_type could be different? Define my own comparison predicate?
|
||||
return boost::algorithm::is_permutation ( first, last, first2,
|
||||
std::equal_to<typename std::iterator_traits<ForwardIterator1>::value_type> ());
|
||||
}
|
||||
|
||||
#endif
|
||||
|
||||
/// \fn is_permutation ( const Range &r, ForwardIterator first2 )
|
||||
/// \brief Tests to see if a the sequence [first,last) is a permutation of the sequence starting at first2
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param first2 The start of the second sequence
|
||||
template <typename Range, typename ForwardIterator>
|
||||
bool is_permutation ( const Range &r, ForwardIterator first2 )
|
||||
{
|
||||
return boost::algorithm::is_permutation (boost::begin (r), boost::end (r), first2 );
|
||||
}
|
||||
|
||||
/// \fn is_permutation ( const Range &r, ForwardIterator first2, BinaryPredicate pred )
|
||||
/// \brief Tests to see if a the sequence [first,last) is a permutation of the sequence starting at first2
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param first2 The start of the second sequence
|
||||
/// \param pred The predicate to compare elements with
|
||||
///
|
||||
// Disable this template when the first two parameters are the same type
|
||||
// That way the non-range version will be chosen.
|
||||
template <typename Range, typename ForwardIterator, typename BinaryPredicate>
|
||||
typename boost::disable_if_c<boost::is_same<Range, ForwardIterator>::value, bool>::type
|
||||
is_permutation ( const Range &r, ForwardIterator first2, BinaryPredicate pred )
|
||||
{
|
||||
return boost::algorithm::is_permutation (boost::begin (r), boost::end (r), first2, pred );
|
||||
}
|
||||
|
||||
}}
|
||||
|
||||
#endif // BOOST_ALGORITHM_IS_PERMUTATION_HPP
|
||||
@@ -1,291 +0,0 @@
|
||||
// Copyright (c) 2010 Nuovation System Designs, LLC
|
||||
// Grant Erickson <gerickson@nuovations.com>
|
||||
//
|
||||
// Reworked somewhat by Marshall Clow; August 2010
|
||||
//
|
||||
// Distributed under the Boost Software License, Version 1.0. (See
|
||||
// accompanying file LICENSE_1_0.txt or copy at
|
||||
// http://www.boost.org/LICENSE_1_0.txt)
|
||||
//
|
||||
// See http://www.boost.org/ for latest version.
|
||||
//
|
||||
|
||||
#ifndef BOOST_ALGORITHM_ORDERED_HPP
|
||||
#define BOOST_ALGORITHM_ORDERED_HPP
|
||||
|
||||
#include <algorithm>
|
||||
#include <functional>
|
||||
#include <iterator>
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
#include <boost/utility/enable_if.hpp>
|
||||
#include <boost/type_traits/is_same.hpp>
|
||||
#include <boost/mpl/identity.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of iota if it is available
|
||||
using std::is_sorted_until; // Section 25.4.1.5
|
||||
using std::is_sorted; // Section 25.4.1.5
|
||||
#else
|
||||
/// \fn is_sorted_until ( ForwardIterator first, ForwardIterator last, Pred p )
|
||||
/// \return the point in the sequence [first, last) where the elements are unordered
|
||||
/// (according to the comparison predicate 'p').
|
||||
///
|
||||
/// \param first The start of the sequence to be tested.
|
||||
/// \param last One past the end of the sequence
|
||||
/// \param p A binary predicate that returns true if two elements are ordered.
|
||||
///
|
||||
template <typename ForwardIterator, typename Pred>
|
||||
ForwardIterator is_sorted_until ( ForwardIterator first, ForwardIterator last, Pred p )
|
||||
{
|
||||
if ( first == last ) return last; // the empty sequence is ordered
|
||||
ForwardIterator next = first;
|
||||
while ( ++next != last )
|
||||
{
|
||||
if ( !p ( *first, *next ))
|
||||
return next;
|
||||
first = next;
|
||||
}
|
||||
return last;
|
||||
}
|
||||
|
||||
/// \fn is_sorted_until ( ForwardIterator first, ForwardIterator last )
|
||||
/// \return the point in the sequence [first, last) where the elements are unordered
|
||||
///
|
||||
/// \param first The start of the sequence to be tested.
|
||||
/// \param last One past the end of the sequence
|
||||
///
|
||||
template <typename ForwardIterator>
|
||||
ForwardIterator is_sorted_until ( ForwardIterator first, ForwardIterator last )
|
||||
{
|
||||
typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
|
||||
return boost::algorithm::is_sorted_until ( first, last, std::less_equal<value_type>());
|
||||
}
|
||||
|
||||
|
||||
/// \fn is_sorted ( ForwardIterator first, ForwardIterator last, Pred p )
|
||||
/// \return whether or not the entire sequence is sorted
|
||||
///
|
||||
/// \param first The start of the sequence to be tested.
|
||||
/// \param last One past the end of the sequence
|
||||
/// \param p A binary predicate that returns true if two elements are ordered.
|
||||
///
|
||||
template <typename ForwardIterator, typename Pred>
|
||||
bool is_sorted ( ForwardIterator first, ForwardIterator last, Pred p )
|
||||
{
|
||||
return boost::algorithm::is_sorted_until (first, last, p) == last;
|
||||
}
|
||||
|
||||
/// \fn is_sorted ( ForwardIterator first, ForwardIterator last )
|
||||
/// \return whether or not the entire sequence is sorted
|
||||
///
|
||||
/// \param first The start of the sequence to be tested.
|
||||
/// \param last One past the end of the sequence
|
||||
///
|
||||
template <typename ForwardIterator>
|
||||
bool is_sorted ( ForwardIterator first, ForwardIterator last )
|
||||
{
|
||||
return boost::algorithm::is_sorted_until (first, last) == last;
|
||||
}
|
||||
#endif
|
||||
|
||||
///
|
||||
/// -- Range based versions of the C++11 functions
|
||||
///
|
||||
|
||||
/// \fn is_sorted_until ( const R &range, Pred p )
|
||||
/// \return the point in the range R where the elements are unordered
|
||||
/// (according to the comparison predicate 'p').
|
||||
///
|
||||
/// \param range The range to be tested.
|
||||
/// \param p A binary predicate that returns true if two elements are ordered.
|
||||
///
|
||||
template <typename R, typename Pred>
|
||||
typename boost::lazy_disable_if_c<
|
||||
boost::is_same<R, Pred>::value,
|
||||
typename boost::range_iterator<const R>
|
||||
>::type is_sorted_until ( const R &range, Pred p )
|
||||
{
|
||||
return boost::algorithm::is_sorted_until ( boost::begin ( range ), boost::end ( range ), p );
|
||||
}
|
||||
|
||||
|
||||
/// \fn is_sorted_until ( const R &range )
|
||||
/// \return the point in the range R where the elements are unordered
|
||||
///
|
||||
/// \param range The range to be tested.
|
||||
///
|
||||
template <typename R>
|
||||
typename boost::range_iterator<const R>::type is_sorted_until ( const R &range )
|
||||
{
|
||||
return boost::algorithm::is_sorted_until ( boost::begin ( range ), boost::end ( range ));
|
||||
}
|
||||
|
||||
namespace detail {
|
||||
typedef struct { typedef bool type; } bool_;
|
||||
};
|
||||
|
||||
/// \fn is_sorted ( const R &range, Pred p )
|
||||
/// \return whether or not the entire range R is sorted
|
||||
/// (according to the comparison predicate 'p').
|
||||
///
|
||||
/// \param range The range to be tested.
|
||||
/// \param p A binary predicate that returns true if two elements are ordered.
|
||||
///
|
||||
template <typename R, typename Pred>
|
||||
typename boost::lazy_disable_if_c< boost::is_same<R, Pred>::value, boost::mpl::identity<bool> >::type
|
||||
is_sorted ( const R &range, Pred p )
|
||||
{
|
||||
return boost::algorithm::is_sorted ( boost::begin ( range ), boost::end ( range ), p );
|
||||
}
|
||||
|
||||
|
||||
/// \fn is_sorted ( const R &range )
|
||||
/// \return whether or not the entire range R is sorted
|
||||
///
|
||||
/// \param range The range to be tested.
|
||||
///
|
||||
template <typename R>
|
||||
bool is_sorted ( const R &range )
|
||||
{
|
||||
return boost::algorithm::is_sorted ( boost::begin ( range ), boost::end ( range ));
|
||||
}
|
||||
|
||||
|
||||
///
|
||||
/// -- Range based versions of the C++11 functions
|
||||
///
|
||||
|
||||
/// \fn is_increasing ( ForwardIterator first, ForwardIterator last )
|
||||
/// \return true if the entire sequence is increasing; i.e, each item is greater than or
|
||||
/// equal to the previous one.
|
||||
///
|
||||
/// \param first The start of the sequence to be tested.
|
||||
/// \param last One past the end of the sequence
|
||||
///
|
||||
/// \note This function will return true for sequences that contain items that compare
|
||||
/// equal. If that is not what you intended, you should use is_strictly_increasing instead.
|
||||
template <typename ForwardIterator>
|
||||
bool is_increasing ( ForwardIterator first, ForwardIterator last )
|
||||
{
|
||||
typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
|
||||
return boost::algorithm::is_sorted (first, last, std::less_equal<value_type>());
|
||||
}
|
||||
|
||||
|
||||
/// \fn is_increasing ( const R &range )
|
||||
/// \return true if the entire sequence is increasing; i.e, each item is greater than or
|
||||
/// equal to the previous one.
|
||||
///
|
||||
/// \param range The range to be tested.
|
||||
///
|
||||
/// \note This function will return true for sequences that contain items that compare
|
||||
/// equal. If that is not what you intended, you should use is_strictly_increasing instead.
|
||||
template <typename R>
|
||||
bool is_increasing ( const R &range )
|
||||
{
|
||||
return is_increasing ( boost::begin ( range ), boost::end ( range ));
|
||||
}
|
||||
|
||||
|
||||
|
||||
/// \fn is_decreasing ( ForwardIterator first, ForwardIterator last )
|
||||
/// \return true if the entire sequence is decreasing; i.e, each item is less than
|
||||
/// or equal to the previous one.
|
||||
///
|
||||
/// \param first The start of the sequence to be tested.
|
||||
/// \param last One past the end of the sequence
|
||||
///
|
||||
/// \note This function will return true for sequences that contain items that compare
|
||||
/// equal. If that is not what you intended, you should use is_strictly_decreasing instead.
|
||||
template <typename ForwardIterator>
|
||||
bool is_decreasing ( ForwardIterator first, ForwardIterator last )
|
||||
{
|
||||
typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
|
||||
return boost::algorithm::is_sorted (first, last, std::greater_equal<value_type>());
|
||||
}
|
||||
|
||||
/// \fn is_decreasing ( const R &range )
|
||||
/// \return true if the entire sequence is decreasing; i.e, each item is less than
|
||||
/// or equal to the previous one.
|
||||
///
|
||||
/// \param range The range to be tested.
|
||||
///
|
||||
/// \note This function will return true for sequences that contain items that compare
|
||||
/// equal. If that is not what you intended, you should use is_strictly_decreasing instead.
|
||||
template <typename R>
|
||||
bool is_decreasing ( const R &range )
|
||||
{
|
||||
return is_decreasing ( boost::begin ( range ), boost::end ( range ));
|
||||
}
|
||||
|
||||
|
||||
|
||||
/// \fn is_strictly_increasing ( ForwardIterator first, ForwardIterator last )
|
||||
/// \return true if the entire sequence is strictly increasing; i.e, each item is greater
|
||||
/// than the previous one
|
||||
///
|
||||
/// \param first The start of the sequence to be tested.
|
||||
/// \param last One past the end of the sequence
|
||||
///
|
||||
/// \note This function will return false for sequences that contain items that compare
|
||||
/// equal. If that is not what you intended, you should use is_increasing instead.
|
||||
template <typename ForwardIterator>
|
||||
bool is_strictly_increasing ( ForwardIterator first, ForwardIterator last )
|
||||
{
|
||||
typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
|
||||
return boost::algorithm::is_sorted (first, last, std::less<value_type>());
|
||||
}
|
||||
|
||||
/// \fn is_strictly_increasing ( const R &range )
|
||||
/// \return true if the entire sequence is strictly increasing; i.e, each item is greater
|
||||
/// than the previous one
|
||||
///
|
||||
/// \param range The range to be tested.
|
||||
///
|
||||
/// \note This function will return false for sequences that contain items that compare
|
||||
/// equal. If that is not what you intended, you should use is_increasing instead.
|
||||
template <typename R>
|
||||
bool is_strictly_increasing ( const R &range )
|
||||
{
|
||||
return is_strictly_increasing ( boost::begin ( range ), boost::end ( range ));
|
||||
}
|
||||
|
||||
|
||||
/// \fn is_strictly_decreasing ( ForwardIterator first, ForwardIterator last )
|
||||
/// \return true if the entire sequence is strictly decreasing; i.e, each item is less than
|
||||
/// the previous one
|
||||
///
|
||||
/// \param first The start of the sequence to be tested.
|
||||
/// \param last One past the end of the sequence
|
||||
///
|
||||
/// \note This function will return false for sequences that contain items that compare
|
||||
/// equal. If that is not what you intended, you should use is_decreasing instead.
|
||||
template <typename ForwardIterator>
|
||||
bool is_strictly_decreasing ( ForwardIterator first, ForwardIterator last )
|
||||
{
|
||||
typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
|
||||
return boost::algorithm::is_sorted (first, last, std::greater<value_type>());
|
||||
}
|
||||
|
||||
/// \fn is_strictly_decreasing ( const R &range )
|
||||
/// \return true if the entire sequence is strictly decreasing; i.e, each item is less than
|
||||
/// the previous one
|
||||
///
|
||||
/// \param range The range to be tested.
|
||||
///
|
||||
/// \note This function will return false for sequences that contain items that compare
|
||||
/// equal. If that is not what you intended, you should use is_decreasing instead.
|
||||
template <typename R>
|
||||
bool is_strictly_decreasing ( const R &range )
|
||||
{
|
||||
return is_strictly_decreasing ( boost::begin ( range ), boost::end ( range ));
|
||||
}
|
||||
|
||||
}} // namespace boost
|
||||
|
||||
#endif // BOOST_ALGORITHM_ORDERED_HPP
|
||||
@@ -1,88 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2008-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file none_of.hpp
|
||||
/// \brief Test ranges to see if no elements match a value or predicate.
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_NONE_OF_HPP
|
||||
#define BOOST_ALGORITHM_NONE_OF_HPP
|
||||
|
||||
#include <algorithm> // for std::none_of, if available
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
// Use the C++11 versions of the none_of if it is available
|
||||
#if __cplusplus >= 201103L
|
||||
using std::none_of; // Section 25.2.3
|
||||
#else
|
||||
/// \fn none_of ( InputIterator first, InputIterator last, Predicate p )
|
||||
/// \return true if none of the elements in [first, last) satisfy the predicate 'p'
|
||||
/// \note returns true on an empty range
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param p A predicate for testing the elements of the sequence
|
||||
///
|
||||
template<typename InputIterator, typename Predicate>
|
||||
bool none_of ( InputIterator first, InputIterator last, Predicate p )
|
||||
{
|
||||
for ( ; first != last; ++first )
|
||||
if ( p(*first))
|
||||
return false;
|
||||
return true;
|
||||
}
|
||||
#endif
|
||||
|
||||
/// \fn none_of ( const Range &r, Predicate p )
|
||||
/// \return true if none of the elements in the range satisfy the predicate 'p'
|
||||
/// \note returns true on an empty range
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename Range, typename Predicate>
|
||||
bool none_of ( const Range &r, Predicate p )
|
||||
{
|
||||
return boost::algorithm::none_of (boost::begin (r), boost::end (r), p );
|
||||
}
|
||||
|
||||
/// \fn none_of_equal ( InputIterator first, InputIterator last, const V &val )
|
||||
/// \return true if none of the elements in [first, last) are equal to 'val'
|
||||
/// \note returns true on an empty range
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param val A value to compare against
|
||||
///
|
||||
template<typename InputIterator, typename V>
|
||||
bool none_of_equal ( InputIterator first, InputIterator last, const V &val )
|
||||
{
|
||||
for ( ; first != last; ++first )
|
||||
if ( val == *first )
|
||||
return false;
|
||||
return true;
|
||||
}
|
||||
|
||||
/// \fn none_of_equal ( const Range &r, const V &val )
|
||||
/// \return true if none of the elements in the range are equal to 'val'
|
||||
/// \note returns true on an empty range
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param val A value to compare against
|
||||
///
|
||||
template<typename Range, typename V>
|
||||
bool none_of_equal ( const Range &r, const V & val )
|
||||
{
|
||||
return boost::algorithm::none_of_equal (boost::begin (r), boost::end (r), val);
|
||||
}
|
||||
|
||||
}} // namespace boost and algorithm
|
||||
|
||||
#endif // BOOST_ALGORITHM_NONE_OF_HPP
|
||||
@@ -1,82 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2008-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file one_of.hpp
|
||||
/// \brief Test ranges to see if only one element matches a value or predicate.
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_ONE_OF_HPP
|
||||
#define BOOST_ALGORITHM_ONE_OF_HPP
|
||||
|
||||
#include <algorithm> // for std::find and std::find_if
|
||||
#include <boost/algorithm/cxx11/none_of.hpp>
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
/// \fn one_of ( InputIterator first, InputIterator last, Predicate p )
|
||||
/// \return true if the predicate 'p' is true for exactly one item in [first, last).
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param p A predicate for testing the elements of the sequence
|
||||
///
|
||||
template<typename InputIterator, typename Predicate>
|
||||
bool one_of ( InputIterator first, InputIterator last, Predicate p )
|
||||
{
|
||||
InputIterator i = std::find_if (first, last, p);
|
||||
if (i == last)
|
||||
return false; // Didn't occur at all
|
||||
return boost::algorithm::none_of (++i, last, p);
|
||||
}
|
||||
|
||||
/// \fn one_of ( const Range &r, Predicate p )
|
||||
/// \return true if the predicate 'p' is true for exactly one item in the range.
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename Range, typename Predicate>
|
||||
bool one_of ( const Range &r, Predicate p )
|
||||
{
|
||||
return boost::algorithm::one_of ( boost::begin (r), boost::end (r), p );
|
||||
}
|
||||
|
||||
|
||||
/// \fn one_of_equal ( InputIterator first, InputIterator last, const V &val )
|
||||
/// \return true if the value 'val' exists only once in [first, last).
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param val A value to compare against
|
||||
///
|
||||
template<typename InputIterator, typename V>
|
||||
bool one_of_equal ( InputIterator first, InputIterator last, const V &val )
|
||||
{
|
||||
InputIterator i = std::find (first, last, val); // find first occurrence of 'val'
|
||||
if (i == last)
|
||||
return false; // Didn't occur at all
|
||||
return boost::algorithm::none_of_equal (++i, last, val);
|
||||
}
|
||||
|
||||
/// \fn one_of_equal ( const Range &r, const V &val )
|
||||
/// \return true if the value 'val' exists only once in the range.
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param val A value to compare against
|
||||
///
|
||||
template<typename Range, typename V>
|
||||
bool one_of_equal ( const Range &r, const V &val )
|
||||
{
|
||||
return boost::algorithm::one_of_equal ( boost::begin (r), boost::end (r), val );
|
||||
}
|
||||
|
||||
}} // namespace boost and algorithm
|
||||
|
||||
#endif // BOOST_ALGORITHM_ALL_HPP
|
||||
@@ -1,78 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file partition_copy.hpp
|
||||
/// \brief Copy a subset of a sequence to a new sequence
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_PARTITION_COPY_HPP
|
||||
#define BOOST_ALGORITHM_PARTITION_COPY_HPP
|
||||
|
||||
#include <algorithm> // for std::partition_copy, if available
|
||||
#include <utility> // for make_pair
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of partition_copy if it is available
|
||||
using std::partition_copy; // Section 25.3.13
|
||||
#else
|
||||
/// \fn partition_copy ( InputIterator first, InputIterator last,
|
||||
/// OutputIterator1 out_true, OutputIterator2 out_false, UnaryPredicate p )
|
||||
/// \brief Copies the elements that satisfy the predicate p from the range [first, last)
|
||||
/// to the range beginning at d_first_true, and
|
||||
/// copies the elements that do not satisfy p to the range beginning at d_first_false.
|
||||
///
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param out_true An output iterator to write the elements that satisfy the predicate into
|
||||
/// \param out_false An output iterator to write the elements that do not satisfy the predicate into
|
||||
/// \param p A predicate for dividing the elements of the input sequence.
|
||||
///
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template <typename InputIterator,
|
||||
typename OutputIterator1, typename OutputIterator2, typename UnaryPredicate>
|
||||
std::pair<OutputIterator1, OutputIterator2>
|
||||
partition_copy ( InputIterator first, InputIterator last,
|
||||
OutputIterator1 out_true, OutputIterator2 out_false, UnaryPredicate p )
|
||||
{
|
||||
for ( ; first != last; ++first )
|
||||
if ( p (*first))
|
||||
*out_true++ = *first;
|
||||
else
|
||||
*out_false++ = *first;
|
||||
return std::pair<OutputIterator1, OutputIterator2> ( out_true, out_false );
|
||||
}
|
||||
#endif
|
||||
|
||||
/// \fn partition_copy ( const Range &r,
|
||||
/// OutputIterator1 out_true, OutputIterator2 out_false, UnaryPredicate p )
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param out_true An output iterator to write the elements that satisfy the predicate into
|
||||
/// \param out_false An output iterator to write the elements that do not satisfy the predicate into
|
||||
/// \param p A predicate for dividing the elements of the input sequence.
|
||||
///
|
||||
template <typename Range, typename OutputIterator1, typename OutputIterator2,
|
||||
typename UnaryPredicate>
|
||||
std::pair<OutputIterator1, OutputIterator2>
|
||||
partition_copy ( const Range &r, OutputIterator1 out_true, OutputIterator2 out_false,
|
||||
UnaryPredicate p )
|
||||
{
|
||||
return boost::algorithm::partition_copy
|
||||
(boost::begin(r), boost::end(r), out_true, out_false, p );
|
||||
}
|
||||
|
||||
}} // namespace boost and algorithm
|
||||
|
||||
#endif // BOOST_ALGORITHM_PARTITION_COPY_HPP
|
||||
@@ -1,72 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file partition_point.hpp
|
||||
/// \brief Find the partition point in a sequence
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_PARTITION_POINT_HPP
|
||||
#define BOOST_ALGORITHM_PARTITION_POINT_HPP
|
||||
|
||||
#include <algorithm> // for std::partition_point, if available
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of partition_point if it is available
|
||||
using std::partition_point; // Section 25.3.13
|
||||
#else
|
||||
/// \fn partition_point ( ForwardIterator first, ForwardIterator last, Predicate p )
|
||||
/// \brief Given a partitioned range, returns the partition point, i.e, the first element
|
||||
/// that does not satisfy p
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param p The predicate to test the values with
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template <typename ForwardIterator, typename Predicate>
|
||||
ForwardIterator partition_point ( ForwardIterator first, ForwardIterator last, Predicate p )
|
||||
{
|
||||
std::size_t dist = std::distance ( first, last );
|
||||
while ( first != last ) {
|
||||
std::size_t d2 = dist / 2;
|
||||
ForwardIterator ret_val = first;
|
||||
std::advance (ret_val, d2);
|
||||
if (p (*ret_val)) {
|
||||
first = ++ret_val;
|
||||
dist -= d2 + 1;
|
||||
}
|
||||
else {
|
||||
last = ret_val;
|
||||
dist = d2;
|
||||
}
|
||||
}
|
||||
return first;
|
||||
}
|
||||
#endif
|
||||
|
||||
/// \fn partition_point ( Range &r, Predicate p )
|
||||
/// \brief Given a partitioned range, returns the partition point
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param p The predicate to test the values with
|
||||
///
|
||||
template <typename Range, typename Predicate>
|
||||
typename boost::range_iterator<Range> partition_point ( Range &r, Predicate p )
|
||||
{
|
||||
return boost::algorithm::partition_point (boost::begin(r), boost::end(r), p);
|
||||
}
|
||||
|
||||
|
||||
}}
|
||||
|
||||
#endif // BOOST_ALGORITHM_PARTITION_POINT_HPP
|
||||
@@ -1,279 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
Thanks to Nevin for his comments/help.
|
||||
*/
|
||||
|
||||
/*
|
||||
General problem - turn a sequence of integral types into a sequence of hexadecimal characters.
|
||||
- and back.
|
||||
|
||||
TO DO:
|
||||
1. these should really only work on integral types. (see the >> and << operations)
|
||||
-- this is done, I think.
|
||||
2. The 'value_type_or_char' struct is really a hack.
|
||||
-- but it's a better hack now that it works with back_insert_iterators
|
||||
*/
|
||||
|
||||
/// \file hex.hpp
|
||||
/// \brief Convert sequence of integral types into a sequence of hexadecimal
|
||||
/// characters and back. Based on the MySQL functions HEX and UNHEX
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_HEXHPP
|
||||
#define BOOST_ALGORITHM_HEXHPP
|
||||
|
||||
#include <iterator> // for std::iterator_traits
|
||||
#include <stdexcept>
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
#include <boost/exception/all.hpp>
|
||||
|
||||
#include <boost/utility/enable_if.hpp>
|
||||
#include <boost/type_traits/is_integral.hpp>
|
||||
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
/*!
|
||||
\struct hex_decode_error
|
||||
\brief Base exception class for all hex decoding errors
|
||||
|
||||
\struct non_hex_input
|
||||
\brief Thrown when a non-hex value (0-9, A-F) encountered when decoding.
|
||||
Contains the offending character
|
||||
|
||||
\struct not_enough_input
|
||||
\brief Thrown when the input sequence unexpectedly ends
|
||||
|
||||
*/
|
||||
struct hex_decode_error: virtual boost::exception, virtual std::exception {};
|
||||
struct not_enough_input : public hex_decode_error {};
|
||||
struct non_hex_input : public hex_decode_error {
|
||||
non_hex_input ( char ch ) : bad_char ( ch ) {}
|
||||
char bad_char;
|
||||
private:
|
||||
non_hex_input (); // don't allow creation w/o a char
|
||||
};
|
||||
|
||||
namespace detail {
|
||||
/// \cond DOXYGEN_HIDE
|
||||
|
||||
template <typename T, typename OutputIterator>
|
||||
OutputIterator encode_one ( T val, OutputIterator out ) {
|
||||
const std::size_t num_hex_digits = 2 * sizeof ( T );
|
||||
char res [ num_hex_digits ];
|
||||
char *p = res + num_hex_digits;
|
||||
for ( std::size_t i = 0; i < num_hex_digits; ++i, val >>= 4 )
|
||||
*--p = "0123456789ABCDEF" [ val & 0x0F ];
|
||||
return std::copy ( res, res + num_hex_digits, out );
|
||||
}
|
||||
|
||||
unsigned hex_char_to_int ( char c ) {
|
||||
if ( c >= '0' && c <= '9' ) return c - '0';
|
||||
if ( c >= 'A' && c <= 'F' ) return c - 'A' + 10;
|
||||
if ( c >= 'a' && c <= 'f' ) return c - 'a' + 10;
|
||||
BOOST_THROW_EXCEPTION (non_hex_input (c));
|
||||
return 0; // keep dumb compilers happy
|
||||
}
|
||||
|
||||
|
||||
// My own iterator_traits class.
|
||||
// It is here so that I can "reach inside" some kinds of output iterators
|
||||
// and get the type to write.
|
||||
template <typename Iterator>
|
||||
struct hex_iterator_traits {
|
||||
typedef typename std::iterator_traits<Iterator>::value_type value_type;
|
||||
};
|
||||
|
||||
template<typename Container>
|
||||
struct hex_iterator_traits< std::back_insert_iterator<Container> > {
|
||||
typedef typename Container::value_type value_type;
|
||||
};
|
||||
|
||||
template<typename Container>
|
||||
struct hex_iterator_traits< std::front_insert_iterator<Container> > {
|
||||
typedef typename Container::value_type value_type;
|
||||
};
|
||||
|
||||
template<typename Container>
|
||||
struct hex_iterator_traits< std::insert_iterator<Container> > {
|
||||
typedef typename Container::value_type value_type;
|
||||
};
|
||||
|
||||
// ostream_iterators have three template parameters.
|
||||
// The first one is the output type, the second one is the character type of
|
||||
// the underlying stream, the third is the character traits.
|
||||
// We only care about the first one.
|
||||
template<typename T, typename charType, typename traits>
|
||||
struct hex_iterator_traits< std::ostream_iterator<T, charType, traits> > {
|
||||
typedef T value_type;
|
||||
};
|
||||
|
||||
// Output Iterators have a value type of 'void'. Kinda sucks.
|
||||
// We special case some output iterators, but we can't enumerate them all.
|
||||
// If we can't figure it out, we assume that you want to output chars.
|
||||
// If you don't, pass in an iterator with a real value_type.
|
||||
template <typename T> struct value_type_or_char { typedef T value_type; };
|
||||
template <> struct value_type_or_char<void> { typedef char value_type; };
|
||||
|
||||
// All in one step
|
||||
template <typename Iterator>
|
||||
struct iterator_value_type {
|
||||
// typedef typename value_type_or_char<typename hex_iterator_traits<Iterator>::value_type>::value_type value_type;
|
||||
typedef typename hex_iterator_traits<Iterator>::value_type value_type;
|
||||
};
|
||||
|
||||
// What can we assume here about the inputs?
|
||||
// is std::iterator_traits<InputIterator>::value_type always 'char' ?
|
||||
// Could it be wchar_t, say? Does it matter?
|
||||
// We are assuming ASCII for the values - but what about the storage?
|
||||
template <typename InputIterator, typename OutputIterator>
|
||||
typename boost::enable_if<boost::is_integral<typename iterator_value_type<OutputIterator>::value_type>, OutputIterator>::type
|
||||
decode_one ( InputIterator &first, InputIterator last, OutputIterator out ) {
|
||||
typedef typename iterator_value_type<OutputIterator>::value_type T;
|
||||
T res (0);
|
||||
|
||||
// Need to make sure that we get can read that many chars here.
|
||||
for ( std::size_t i = 0; i < 2 * sizeof ( T ); ++i, ++first ) {
|
||||
if ( first == last )
|
||||
BOOST_THROW_EXCEPTION (not_enough_input ());
|
||||
res = ( 16 * res ) + hex_char_to_int (static_cast<char> (*first));
|
||||
}
|
||||
|
||||
*out = res;
|
||||
return ++out;
|
||||
}
|
||||
/// \endcond
|
||||
}
|
||||
|
||||
|
||||
/// \fn hex ( InputIterator first, InputIterator last, OutputIterator out )
|
||||
/// \brief Converts a sequence of integral types into a hexadecimal sequence of characters.
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param out An output iterator to the results into
|
||||
/// \return The updated output iterator
|
||||
/// \note Based on the MySQL function of the same name
|
||||
template <typename InputIterator, typename OutputIterator>
|
||||
typename boost::enable_if<boost::is_integral<typename detail::hex_iterator_traits<InputIterator>::value_type>, OutputIterator>::type
|
||||
hex ( InputIterator first, InputIterator last, OutputIterator out ) {
|
||||
for ( ; first != last; ++first )
|
||||
out = detail::encode_one ( *first, out );
|
||||
return out;
|
||||
}
|
||||
|
||||
|
||||
/// \fn hex ( const T *ptr, OutputIterator out )
|
||||
/// \brief Converts a sequence of integral types into a hexadecimal sequence of characters.
|
||||
///
|
||||
/// \param ptr A pointer to a 0-terminated sequence of data.
|
||||
/// \param out An output iterator to the results into
|
||||
/// \return The updated output iterator
|
||||
/// \note Based on the MySQL function of the same name
|
||||
template <typename T, typename OutputIterator>
|
||||
typename boost::enable_if<boost::is_integral<T>, OutputIterator>::type
|
||||
hex ( const T *ptr, OutputIterator out ) {
|
||||
while ( *ptr )
|
||||
out = detail::encode_one ( *ptr++, out );
|
||||
return out;
|
||||
}
|
||||
|
||||
/// \fn hex ( const Range &r, OutputIterator out )
|
||||
/// \brief Converts a sequence of integral types into a hexadecimal sequence of characters.
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param out An output iterator to the results into
|
||||
/// \return The updated output iterator
|
||||
/// \note Based on the MySQL function of the same name
|
||||
template <typename Range, typename OutputIterator>
|
||||
typename boost::enable_if<boost::is_integral<typename detail::hex_iterator_traits<typename Range::iterator>::value_type>, OutputIterator>::type
|
||||
hex ( const Range &r, OutputIterator out ) {
|
||||
return hex (boost::begin(r), boost::end(r), out);
|
||||
}
|
||||
|
||||
|
||||
/// \fn unhex ( InputIterator first, InputIterator last, OutputIterator out )
|
||||
/// \brief Converts a sequence of hexadecimal characters into a sequence of integers.
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param out An output iterator to the results into
|
||||
/// \return The updated output iterator
|
||||
/// \note Based on the MySQL function of the same name
|
||||
template <typename InputIterator, typename OutputIterator>
|
||||
OutputIterator unhex ( InputIterator first, InputIterator last, OutputIterator out ) {
|
||||
while ( first != last )
|
||||
out = detail::decode_one ( first, last, out );
|
||||
return out;
|
||||
}
|
||||
|
||||
|
||||
/// \fn unhex ( const T *ptr, OutputIterator out )
|
||||
/// \brief Converts a sequence of hexadecimal characters into a sequence of integers.
|
||||
///
|
||||
/// \param ptr A pointer to a null-terminated input sequence.
|
||||
/// \param out An output iterator to the results into
|
||||
/// \return The updated output iterator
|
||||
/// \note Based on the MySQL function of the same name
|
||||
template <typename T, typename OutputIterator>
|
||||
OutputIterator unhex ( const T *ptr, OutputIterator out ) {
|
||||
typedef typename detail::iterator_value_type<OutputIterator>::value_type OutputType;
|
||||
// If we run into the terminator while decoding, we will throw a
|
||||
// malformed input exception. It would be nicer to throw a 'Not enough input'
|
||||
// exception - but how much extra work would that require?
|
||||
// I just make up an "end iterator" which we will never get to -
|
||||
// two Ts per byte of the output type.
|
||||
while ( *ptr )
|
||||
out = detail::decode_one ( ptr, ptr + 2 * sizeof(OutputType), out );
|
||||
return out;
|
||||
}
|
||||
|
||||
|
||||
/// \fn OutputIterator unhex ( const Range &r, OutputIterator out )
|
||||
/// \brief Converts a sequence of hexadecimal characters into a sequence of integers.
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param out An output iterator to the results into
|
||||
/// \return The updated output iterator
|
||||
/// \note Based on the MySQL function of the same name
|
||||
template <typename Range, typename OutputIterator>
|
||||
OutputIterator unhex ( const Range &r, OutputIterator out ) {
|
||||
return unhex (boost::begin(r), boost::end(r), out);
|
||||
}
|
||||
|
||||
|
||||
/// \fn String hex ( const String &input )
|
||||
/// \brief Converts a sequence of integral types into a hexadecimal sequence of characters.
|
||||
///
|
||||
/// \param input A container to be converted
|
||||
/// \return A container with the encoded text
|
||||
template<typename String>
|
||||
String hex ( const String &input ) {
|
||||
String output;
|
||||
output.reserve (input.size () * (2 * sizeof (typename String::value_type)));
|
||||
(void) hex (input, std::back_inserter (output));
|
||||
return output;
|
||||
}
|
||||
|
||||
/// \fn String unhex ( const String &input )
|
||||
/// \brief Converts a sequence of hexadecimal characters into a sequence of characters.
|
||||
///
|
||||
/// \param input A container to be converted
|
||||
/// \return A container with the decoded text
|
||||
template<typename String>
|
||||
String unhex ( const String &input ) {
|
||||
String output;
|
||||
output.reserve (input.size () / (2 * sizeof (typename String::value_type)));
|
||||
(void) unhex (input, std::back_inserter (output));
|
||||
return output;
|
||||
}
|
||||
|
||||
}}
|
||||
|
||||
#endif // BOOST_ALGORITHM_HEXHPP
|
||||
@@ -1,268 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#ifndef BOOST_ALGORITHM_BOYER_MOORE_SEARCH_HPP
|
||||
#define BOOST_ALGORITHM_BOYER_MOORE_SEARCH_HPP
|
||||
|
||||
#include <iterator> // for std::iterator_traits
|
||||
|
||||
#include <boost/assert.hpp>
|
||||
#include <boost/static_assert.hpp>
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
#include <boost/utility/enable_if.hpp>
|
||||
#include <boost/type_traits/is_same.hpp>
|
||||
|
||||
#include <boost/algorithm/searching/detail/bm_traits.hpp>
|
||||
#include <boost/algorithm/searching/detail/debugging.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
/*
|
||||
A templated version of the boyer-moore searching algorithm.
|
||||
|
||||
References:
|
||||
http://www.cs.utexas.edu/users/moore/best-ideas/string-searching/
|
||||
http://www.cs.utexas.edu/~moore/publications/fstrpos.pdf
|
||||
|
||||
Explanations: boostinspect:noascii (test tool complains)
|
||||
http://en.wikipedia.org/wiki/Boyer–Moore_string_search_algorithm
|
||||
http://www.movsd.com/bm.htm
|
||||
http://www.cs.ucdavis.edu/~gusfield/cs224f09/bnotes.pdf
|
||||
|
||||
The Boyer-Moore search algorithm uses two tables, a "bad character" table
|
||||
to tell how far to skip ahead when it hits a character that is not in the pattern,
|
||||
and a "good character" table to tell how far to skip ahead when it hits a
|
||||
mismatch on a character that _is_ in the pattern.
|
||||
|
||||
Requirements:
|
||||
* Random access iterators
|
||||
* The two iterator types (patIter and corpusIter) must
|
||||
"point to" the same underlying type and be comparable.
|
||||
* Additional requirements may be imposed but the skip table, such as:
|
||||
** Numeric type (array-based skip table)
|
||||
** Hashable type (map-based skip table)
|
||||
*/
|
||||
|
||||
template <typename patIter, typename traits = detail::BM_traits<patIter> >
|
||||
class boyer_moore {
|
||||
typedef typename std::iterator_traits<patIter>::difference_type difference_type;
|
||||
public:
|
||||
boyer_moore ( patIter first, patIter last )
|
||||
: pat_first ( first ), pat_last ( last ),
|
||||
k_pattern_length ( std::distance ( pat_first, pat_last )),
|
||||
skip_ ( k_pattern_length, -1 ),
|
||||
suffix_ ( k_pattern_length + 1 )
|
||||
{
|
||||
this->build_skip_table ( first, last );
|
||||
this->build_suffix_table ( first, last );
|
||||
}
|
||||
|
||||
~boyer_moore () {}
|
||||
|
||||
/// \fn operator ( corpusIter corpus_first, corpusIter corpus_last )
|
||||
/// \brief Searches the corpus for the pattern that was passed into the constructor
|
||||
///
|
||||
/// \param corpus_first The start of the data to search (Random Access Iterator)
|
||||
/// \param corpus_last One past the end of the data to search
|
||||
///
|
||||
template <typename corpusIter>
|
||||
corpusIter operator () ( corpusIter corpus_first, corpusIter corpus_last ) const {
|
||||
BOOST_STATIC_ASSERT (( boost::is_same<
|
||||
typename std::iterator_traits<patIter>::value_type,
|
||||
typename std::iterator_traits<corpusIter>::value_type>::value ));
|
||||
|
||||
if ( corpus_first == corpus_last ) return corpus_last; // if nothing to search, we didn't find it!
|
||||
if ( pat_first == pat_last ) return corpus_first; // empty pattern matches at start
|
||||
|
||||
const difference_type k_corpus_length = std::distance ( corpus_first, corpus_last );
|
||||
// If the pattern is larger than the corpus, we can't find it!
|
||||
if ( k_corpus_length < k_pattern_length )
|
||||
return corpus_last;
|
||||
|
||||
// Do the search
|
||||
return this->do_search ( corpus_first, corpus_last );
|
||||
}
|
||||
|
||||
template <typename Range>
|
||||
typename boost::range_iterator<Range>::type operator () ( Range &r ) const {
|
||||
return (*this) (boost::begin(r), boost::end(r));
|
||||
}
|
||||
|
||||
private:
|
||||
/// \cond DOXYGEN_HIDE
|
||||
patIter pat_first, pat_last;
|
||||
const difference_type k_pattern_length;
|
||||
typename traits::skip_table_t skip_;
|
||||
std::vector <difference_type> suffix_;
|
||||
|
||||
/// \fn operator ( corpusIter corpus_first, corpusIter corpus_last, Pred p )
|
||||
/// \brief Searches the corpus for the pattern that was passed into the constructor
|
||||
///
|
||||
/// \param corpus_first The start of the data to search (Random Access Iterator)
|
||||
/// \param corpus_last One past the end of the data to search
|
||||
/// \param p A predicate used for the search comparisons.
|
||||
///
|
||||
template <typename corpusIter>
|
||||
corpusIter do_search ( corpusIter corpus_first, corpusIter corpus_last ) const {
|
||||
/* ---- Do the matching ---- */
|
||||
corpusIter curPos = corpus_first;
|
||||
const corpusIter lastPos = corpus_last - k_pattern_length;
|
||||
difference_type j, k, m;
|
||||
|
||||
while ( curPos <= lastPos ) {
|
||||
/* while ( std::distance ( curPos, corpus_last ) >= k_pattern_length ) { */
|
||||
// Do we match right where we are?
|
||||
j = k_pattern_length;
|
||||
while ( pat_first [j-1] == curPos [j-1] ) {
|
||||
j--;
|
||||
// We matched - we're done!
|
||||
if ( j == 0 )
|
||||
return curPos;
|
||||
}
|
||||
|
||||
// Since we didn't match, figure out how far to skip forward
|
||||
k = skip_ [ curPos [ j - 1 ]];
|
||||
m = j - k - 1;
|
||||
if ( k < j && m > suffix_ [ j ] )
|
||||
curPos += m;
|
||||
else
|
||||
curPos += suffix_ [ j ];
|
||||
}
|
||||
|
||||
return corpus_last; // We didn't find anything
|
||||
}
|
||||
|
||||
|
||||
void build_skip_table ( patIter first, patIter last ) {
|
||||
for ( std::size_t i = 0; first != last; ++first, ++i )
|
||||
skip_.insert ( *first, i );
|
||||
}
|
||||
|
||||
|
||||
template<typename Iter, typename Container>
|
||||
void compute_bm_prefix ( Iter pat_first, Iter pat_last, Container &prefix ) {
|
||||
const std::size_t count = std::distance ( pat_first, pat_last );
|
||||
BOOST_ASSERT ( count > 0 );
|
||||
BOOST_ASSERT ( prefix.size () == count );
|
||||
|
||||
prefix[0] = 0;
|
||||
std::size_t k = 0;
|
||||
for ( std::size_t i = 1; i < count; ++i ) {
|
||||
BOOST_ASSERT ( k < count );
|
||||
while ( k > 0 && ( pat_first[k] != pat_first[i] )) {
|
||||
BOOST_ASSERT ( k < count );
|
||||
k = prefix [ k - 1 ];
|
||||
}
|
||||
|
||||
if ( pat_first[k] == pat_first[i] )
|
||||
k++;
|
||||
prefix [ i ] = k;
|
||||
}
|
||||
}
|
||||
|
||||
void build_suffix_table ( patIter pat_first, patIter pat_last ) {
|
||||
const std::size_t count = (std::size_t) std::distance ( pat_first, pat_last );
|
||||
|
||||
if ( count > 0 ) { // empty pattern
|
||||
std::vector<typename std::iterator_traits<patIter>::value_type> reversed(count);
|
||||
(void) std::reverse_copy ( pat_first, pat_last, reversed.begin ());
|
||||
|
||||
std::vector<difference_type> prefix (count);
|
||||
compute_bm_prefix ( pat_first, pat_last, prefix );
|
||||
|
||||
std::vector<difference_type> prefix_reversed (count);
|
||||
compute_bm_prefix ( reversed.begin (), reversed.end (), prefix_reversed );
|
||||
|
||||
for ( std::size_t i = 0; i <= count; i++ )
|
||||
suffix_[i] = count - prefix [count-1];
|
||||
|
||||
for ( std::size_t i = 0; i < count; i++ ) {
|
||||
const std::size_t j = count - prefix_reversed[i];
|
||||
const difference_type k = i - prefix_reversed[i] + 1;
|
||||
|
||||
if (suffix_[j] > k)
|
||||
suffix_[j] = k;
|
||||
}
|
||||
}
|
||||
}
|
||||
/// \endcond
|
||||
};
|
||||
|
||||
|
||||
/* Two ranges as inputs gives us four possibilities; with 2,3,3,4 parameters
|
||||
Use a bit of TMP to disambiguate the 3-argument templates */
|
||||
|
||||
/// \fn boyer_moore_search ( corpusIter corpus_first, corpusIter corpus_last,
|
||||
/// patIter pat_first, patIter pat_last )
|
||||
/// \brief Searches the corpus for the pattern.
|
||||
///
|
||||
/// \param corpus_first The start of the data to search (Random Access Iterator)
|
||||
/// \param corpus_last One past the end of the data to search
|
||||
/// \param pat_first The start of the pattern to search for (Random Access Iterator)
|
||||
/// \param pat_last One past the end of the data to search for
|
||||
///
|
||||
template <typename patIter, typename corpusIter>
|
||||
corpusIter boyer_moore_search (
|
||||
corpusIter corpus_first, corpusIter corpus_last,
|
||||
patIter pat_first, patIter pat_last )
|
||||
{
|
||||
boyer_moore<patIter> bm ( pat_first, pat_last );
|
||||
return bm ( corpus_first, corpus_last );
|
||||
}
|
||||
|
||||
template <typename PatternRange, typename corpusIter>
|
||||
corpusIter boyer_moore_search (
|
||||
corpusIter corpus_first, corpusIter corpus_last, const PatternRange &pattern )
|
||||
{
|
||||
typedef typename boost::range_iterator<PatternRange> pattern_iterator;
|
||||
boyer_moore<pattern_iterator> bm ( boost::begin(pattern), boost::end (pattern));
|
||||
return bm ( corpus_first, corpus_last );
|
||||
}
|
||||
|
||||
template <typename patIter, typename CorpusRange>
|
||||
typename boost::lazy_disable_if_c<
|
||||
boost::is_same<CorpusRange, patIter>::value, typename boost::range_iterator<CorpusRange> >
|
||||
::type
|
||||
boyer_moore_search ( CorpusRange &corpus, patIter pat_first, patIter pat_last )
|
||||
{
|
||||
boyer_moore<patIter> bm ( pat_first, pat_last );
|
||||
return bm (boost::begin (corpus), boost::end (corpus));
|
||||
}
|
||||
|
||||
template <typename PatternRange, typename CorpusRange>
|
||||
typename boost::range_iterator<CorpusRange>::type
|
||||
boyer_moore_search ( CorpusRange &corpus, const PatternRange &pattern )
|
||||
{
|
||||
typedef typename boost::range_iterator<PatternRange> pattern_iterator;
|
||||
boyer_moore<pattern_iterator> bm ( boost::begin(pattern), boost::end (pattern));
|
||||
return bm (boost::begin (corpus), boost::end (corpus));
|
||||
}
|
||||
|
||||
|
||||
// Creator functions -- take a pattern range, return an object
|
||||
template <typename Range>
|
||||
boost::algorithm::boyer_moore<typename boost::range_iterator<const Range>::type>
|
||||
make_boyer_moore ( const Range &r ) {
|
||||
return boost::algorithm::boyer_moore
|
||||
<typename boost::range_iterator<const Range>::type> (boost::begin(r), boost::end(r));
|
||||
}
|
||||
|
||||
template <typename Range>
|
||||
boost::algorithm::boyer_moore<typename boost::range_iterator<Range>::type>
|
||||
make_boyer_moore ( Range &r ) {
|
||||
return boost::algorithm::boyer_moore
|
||||
<typename boost::range_iterator<Range>::type> (boost::begin(r), boost::end(r));
|
||||
}
|
||||
|
||||
}}
|
||||
|
||||
#endif // BOOST_ALGORITHM_BOYER_MOORE_SEARCH_HPP
|
||||
@@ -1,141 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#ifndef BOOST_ALGORITHM_BOYER_MOORE_HORSPOOOL_SEARCH_HPP
|
||||
#define BOOST_ALGORITHM_BOYER_MOORE_HORSPOOOL_SEARCH_HPP
|
||||
|
||||
#include <iterator> // for std::iterator_traits
|
||||
|
||||
#include <boost/assert.hpp>
|
||||
#include <boost/static_assert.hpp>
|
||||
#include <boost/type_traits/is_same.hpp>
|
||||
|
||||
#include <boost/algorithm/searching/detail/bm_traits.hpp>
|
||||
#include <boost/algorithm/searching/detail/debugging.hpp>
|
||||
|
||||
// #define BOOST_ALGORITHM_BOYER_MOORE_HORSPOOL_DEBUG_HPP
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
/*
|
||||
A templated version of the boyer-moore-horspool searching algorithm.
|
||||
|
||||
Requirements:
|
||||
* Random access iterators
|
||||
* The two iterator types (patIter and corpusIter) must
|
||||
"point to" the same underlying type.
|
||||
* Additional requirements may be imposed buy the skip table, such as:
|
||||
** Numeric type (array-based skip table)
|
||||
** Hashable type (map-based skip table)
|
||||
|
||||
http://www-igm.univ-mlv.fr/%7Elecroq/string/node18.html
|
||||
|
||||
*/
|
||||
|
||||
template <typename patIter, typename traits = detail::BM_traits<patIter> >
|
||||
class boyer_moore_horspool {
|
||||
typedef typename std::iterator_traits<patIter>::difference_type difference_type;
|
||||
public:
|
||||
boyer_moore_horspool ( patIter first, patIter last )
|
||||
: pat_first ( first ), pat_last ( last ),
|
||||
k_pattern_length ( std::distance ( pat_first, pat_last )),
|
||||
skip_ ( k_pattern_length, k_pattern_length ) {
|
||||
|
||||
// Build the skip table
|
||||
std::size_t i = 0;
|
||||
if ( first != last ) // empty pattern?
|
||||
for ( patIter iter = first; iter != last-1; ++iter, ++i )
|
||||
skip_.insert ( *iter, k_pattern_length - 1 - i );
|
||||
#ifdef BOOST_ALGORITHM_BOYER_MOORE_HORSPOOL_DEBUG_HPP
|
||||
skip_.PrintSkipTable ();
|
||||
#endif
|
||||
}
|
||||
|
||||
~boyer_moore_horspool () {}
|
||||
|
||||
/// \fn operator ( corpusIter corpus_first, corpusIter corpus_last, Pred p )
|
||||
/// \brief Searches the corpus for the pattern that was passed into the constructor
|
||||
///
|
||||
/// \param corpus_first The start of the data to search (Random Access Iterator)
|
||||
/// \param corpus_last One past the end of the data to search
|
||||
/// \param p A predicate used for the search comparisons.
|
||||
///
|
||||
template <typename corpusIter>
|
||||
corpusIter operator () ( corpusIter corpus_first, corpusIter corpus_last ) const {
|
||||
BOOST_STATIC_ASSERT (( boost::is_same<
|
||||
typename std::iterator_traits<patIter>::value_type,
|
||||
typename std::iterator_traits<corpusIter>::value_type>::value ));
|
||||
|
||||
if ( corpus_first == corpus_last ) return corpus_last; // if nothing to search, we didn't find it!
|
||||
if ( pat_first == pat_last ) return corpus_first; // empty pattern matches at start
|
||||
|
||||
const difference_type k_corpus_length = std::distance ( corpus_first, corpus_last );
|
||||
// If the pattern is larger than the corpus, we can't find it!
|
||||
if ( k_corpus_length < k_pattern_length )
|
||||
return corpus_last;
|
||||
|
||||
// Do the search
|
||||
return this->do_search ( corpus_first, corpus_last );
|
||||
}
|
||||
|
||||
private:
|
||||
/// \cond DOXYGEN_HIDE
|
||||
patIter pat_first, pat_last;
|
||||
const difference_type k_pattern_length;
|
||||
typename traits::skip_table_t skip_;
|
||||
|
||||
/// \fn do_search ( corpusIter corpus_first, corpusIter corpus_last )
|
||||
/// \brief Searches the corpus for the pattern that was passed into the constructor
|
||||
///
|
||||
/// \param corpus_first The start of the data to search (Random Access Iterator)
|
||||
/// \param corpus_last One past the end of the data to search
|
||||
/// \param k_corpus_length The length of the corpus to search
|
||||
///
|
||||
template <typename corpusIter>
|
||||
corpusIter do_search ( corpusIter corpus_first, corpusIter corpus_last ) const {
|
||||
corpusIter curPos = corpus_first;
|
||||
const corpusIter lastPos = corpus_last - k_pattern_length;
|
||||
while ( curPos <= lastPos ) {
|
||||
// Do we match right where we are?
|
||||
std::size_t j = k_pattern_length - 1;
|
||||
while ( pat_first [j] == curPos [j] ) {
|
||||
// We matched - we're done!
|
||||
if ( j == 0 )
|
||||
return curPos;
|
||||
j--;
|
||||
}
|
||||
|
||||
curPos += skip_ [ curPos [ k_pattern_length - 1 ]];
|
||||
}
|
||||
|
||||
return corpus_last;
|
||||
}
|
||||
// \endcond
|
||||
};
|
||||
|
||||
/// \fn boyer_moore_horspool_search ( corpusIter corpus_first, corpusIter corpus_last,
|
||||
/// patIter pat_first, patIter pat_last )
|
||||
/// \brief Searches the corpus for the pattern.
|
||||
///
|
||||
/// \param corpus_first The start of the data to search (Random Access Iterator)
|
||||
/// \param corpus_last One past the end of the data to search
|
||||
/// \param pat_first The start of the pattern to search for (Random Access Iterator)
|
||||
/// \param pat_last One past the end of the data to search for
|
||||
///
|
||||
template <typename patIter, typename corpusIter>
|
||||
corpusIter boyer_moore_horspool_search (
|
||||
corpusIter corpus_first, corpusIter corpus_last,
|
||||
patIter pat_first, patIter pat_last ) {
|
||||
boyer_moore_horspool<patIter> bmh ( pat_first, pat_last );
|
||||
return bmh ( corpus_first, corpus_last );
|
||||
}
|
||||
|
||||
}}
|
||||
|
||||
#endif // BOOST_ALGORITHM_BOYER_MOORE_HORSPOOOL_SEARCH_HPP
|
||||
@@ -1,105 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#ifndef BOOST_ALGORITHM_SEARCH_DETAIL_BM_TRAITS_HPP
|
||||
#define BOOST_ALGORITHM_SEARCH_DETAIL_BM_TRAITS_HPP
|
||||
|
||||
#include <climits> // for CHAR_BIT
|
||||
#include <vector>
|
||||
#include <iterator> // for std::iterator_traits
|
||||
|
||||
#include <boost/type_traits/make_unsigned.hpp>
|
||||
#include <boost/type_traits/is_integral.hpp>
|
||||
#include <boost/type_traits/remove_pointer.hpp>
|
||||
#include <boost/type_traits/remove_const.hpp>
|
||||
|
||||
#include <boost/array.hpp>
|
||||
#include <boost/tr1/tr1/unordered_map>
|
||||
|
||||
#include <boost/algorithm/searching/detail/debugging.hpp>
|
||||
|
||||
namespace boost { namespace algorithm { namespace detail {
|
||||
|
||||
//
|
||||
// Default implementations of the skip tables for B-M and B-M-H
|
||||
//
|
||||
template<typename key_type, typename value_type, bool /*useArray*/> class skip_table;
|
||||
|
||||
// General case for data searching other than bytes; use a map
|
||||
template<typename key_type, typename value_type>
|
||||
class skip_table<key_type, value_type, false> {
|
||||
private:
|
||||
typedef std::tr1::unordered_map<key_type, value_type> skip_map;
|
||||
const value_type k_default_value;
|
||||
skip_map skip_;
|
||||
|
||||
public:
|
||||
skip_table ( std::size_t patSize, value_type default_value )
|
||||
: k_default_value ( default_value ), skip_ ( patSize ) {}
|
||||
|
||||
void insert ( key_type key, value_type val ) {
|
||||
skip_ [ key ] = val; // Would skip_.insert (val) be better here?
|
||||
}
|
||||
|
||||
value_type operator [] ( key_type key ) const {
|
||||
typename skip_map::const_iterator it = skip_.find ( key );
|
||||
return it == skip_.end () ? k_default_value : it->second;
|
||||
}
|
||||
|
||||
void PrintSkipTable () const {
|
||||
std::cout << "BM(H) Skip Table <unordered_map>:" << std::endl;
|
||||
for ( typename skip_map::const_iterator it = skip_.begin (); it != skip_.end (); ++it )
|
||||
if ( it->second != k_default_value )
|
||||
std::cout << " " << it->first << ": " << it->second << std::endl;
|
||||
std::cout << std::endl;
|
||||
}
|
||||
};
|
||||
|
||||
|
||||
// Special case small numeric values; use an array
|
||||
template<typename key_type, typename value_type>
|
||||
class skip_table<key_type, value_type, true> {
|
||||
private:
|
||||
typedef typename boost::make_unsigned<key_type>::type unsigned_key_type;
|
||||
typedef boost::array<value_type, 1U << (CHAR_BIT * sizeof(key_type))> skip_map;
|
||||
skip_map skip_;
|
||||
const value_type k_default_value;
|
||||
public:
|
||||
skip_table ( std::size_t patSize, value_type default_value ) : k_default_value ( default_value ) {
|
||||
std::fill_n ( skip_.begin(), skip_.size(), default_value );
|
||||
}
|
||||
|
||||
void insert ( key_type key, value_type val ) {
|
||||
skip_ [ static_cast<unsigned_key_type> ( key ) ] = val;
|
||||
}
|
||||
|
||||
value_type operator [] ( key_type key ) const {
|
||||
return skip_ [ static_cast<unsigned_key_type> ( key ) ];
|
||||
}
|
||||
|
||||
void PrintSkipTable () const {
|
||||
std::cout << "BM(H) Skip Table <boost:array>:" << std::endl;
|
||||
for ( typename skip_map::const_iterator it = skip_.begin (); it != skip_.end (); ++it )
|
||||
if ( *it != k_default_value )
|
||||
std::cout << " " << std::distance (skip_.begin (), it) << ": " << *it << std::endl;
|
||||
std::cout << std::endl;
|
||||
}
|
||||
};
|
||||
|
||||
template<typename Iterator>
|
||||
struct BM_traits {
|
||||
typedef typename std::iterator_traits<Iterator>::difference_type value_type;
|
||||
typedef typename std::iterator_traits<Iterator>::value_type key_type;
|
||||
typedef boost::algorithm::detail::skip_table<key_type, value_type,
|
||||
boost::is_integral<key_type>::value && (sizeof(key_type)==1)> skip_table_t;
|
||||
};
|
||||
|
||||
}}} // namespaces
|
||||
|
||||
#endif // BOOST_ALGORITHM_SEARCH_DETAIL_BM_TRAITS_HPP
|
||||
@@ -1,30 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#ifndef BOOST_ALGORITHM_SEARCH_DETAIL_DEBUG_HPP
|
||||
#define BOOST_ALGORITHM_SEARCH_DETAIL_DEBUG_HPP
|
||||
|
||||
#include <iostream>
|
||||
/// \cond DOXYGEN_HIDE
|
||||
|
||||
namespace boost { namespace algorithm { namespace detail {
|
||||
|
||||
// Debugging support
|
||||
template <typename Iter>
|
||||
void PrintTable ( Iter first, Iter last ) {
|
||||
std::cout << std::distance ( first, last ) << ": { ";
|
||||
for ( Iter iter = first; iter != last; ++iter )
|
||||
std::cout << *iter << " ";
|
||||
std::cout << "}" << std::endl;
|
||||
}
|
||||
|
||||
}}}
|
||||
/// \endcond
|
||||
|
||||
#endif // BOOST_ALGORITHM_SEARCH_DETAIL_DEBUG_HPP
|
||||
@@ -1,200 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#ifndef BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_SEARCH_HPP
|
||||
#define BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_SEARCH_HPP
|
||||
|
||||
#include <vector>
|
||||
#include <iterator> // for std::iterator_traits
|
||||
|
||||
#include <boost/assert.hpp>
|
||||
#include <boost/static_assert.hpp>
|
||||
#include <boost/type_traits/is_same.hpp>
|
||||
|
||||
#include <boost/algorithm/searching/detail/debugging.hpp>
|
||||
|
||||
// #define BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_DEBUG
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
// #define NEW_KMP
|
||||
|
||||
/*
|
||||
A templated version of the Knuth-Morris-Pratt searching algorithm.
|
||||
|
||||
Requirements:
|
||||
* Random-access iterators
|
||||
* The two iterator types (I1 and I2) must "point to" the same underlying type.
|
||||
|
||||
http://en.wikipedia.org/wiki/Knuth-Morris-Pratt_algorithm
|
||||
http://www.inf.fh-flensburg.de/lang/algorithmen/pattern/kmpen.htm
|
||||
*/
|
||||
|
||||
template <typename patIter>
|
||||
class knuth_morris_pratt {
|
||||
typedef typename std::iterator_traits<patIter>::difference_type difference_type;
|
||||
public:
|
||||
knuth_morris_pratt ( patIter first, patIter last )
|
||||
: pat_first ( first ), pat_last ( last ),
|
||||
k_pattern_length ( std::distance ( pat_first, pat_last )),
|
||||
skip_ ( k_pattern_length + 1 ) {
|
||||
#ifdef NEW_KMP
|
||||
preKmp ( pat_first, pat_last );
|
||||
#else
|
||||
init_skip_table ( pat_first, pat_last );
|
||||
#endif
|
||||
#ifdef BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_DEBUG
|
||||
detail::PrintTable ( skip_.begin (), skip_.end ());
|
||||
#endif
|
||||
}
|
||||
|
||||
~knuth_morris_pratt () {}
|
||||
|
||||
/// \fn operator ( corpusIter corpus_first, corpusIter corpus_last, Pred p )
|
||||
/// \brief Searches the corpus for the pattern that was passed into the constructor
|
||||
///
|
||||
/// \param corpus_first The start of the data to search (Random Access Iterator)
|
||||
/// \param corpus_last One past the end of the data to search
|
||||
/// \param p A predicate used for the search comparisons.
|
||||
///
|
||||
template <typename corpusIter>
|
||||
corpusIter operator () ( corpusIter corpus_first, corpusIter corpus_last ) const {
|
||||
BOOST_STATIC_ASSERT (( boost::is_same<
|
||||
typename std::iterator_traits<patIter>::value_type,
|
||||
typename std::iterator_traits<corpusIter>::value_type>::value ));
|
||||
if ( corpus_first == corpus_last ) return corpus_last; // if nothing to search, we didn't find it!
|
||||
if ( pat_first == pat_last ) return corpus_first; // empty pattern matches at start
|
||||
|
||||
const difference_type k_corpus_length = std::distance ( corpus_first, corpus_last );
|
||||
// If the pattern is larger than the corpus, we can't find it!
|
||||
if ( k_corpus_length < k_pattern_length )
|
||||
return corpus_last;
|
||||
|
||||
return do_search ( corpus_first, corpus_last, k_corpus_length );
|
||||
}
|
||||
|
||||
private:
|
||||
/// \cond DOXYGEN_HIDE
|
||||
patIter pat_first, pat_last;
|
||||
const difference_type k_pattern_length;
|
||||
std::vector <difference_type> skip_;
|
||||
|
||||
/// \fn operator ( corpusIter corpus_first, corpusIter corpus_last, Pred p )
|
||||
/// \brief Searches the corpus for the pattern that was passed into the constructor
|
||||
///
|
||||
/// \param corpus_first The start of the data to search (Random Access Iterator)
|
||||
/// \param corpus_last One past the end of the data to search
|
||||
/// \param p A predicate used for the search comparisons.
|
||||
///
|
||||
template <typename corpusIter>
|
||||
corpusIter do_search ( corpusIter corpus_first, corpusIter corpus_last,
|
||||
difference_type k_corpus_length ) const {
|
||||
difference_type match_start = 0; // position in the corpus that we're matching
|
||||
|
||||
#ifdef NEW_KMP
|
||||
int patternIdx = 0;
|
||||
while ( match_start < k_corpus_length ) {
|
||||
while ( patternIdx > -1 && pat_first[patternIdx] != corpus_first [match_start] )
|
||||
patternIdx = skip_ [patternIdx]; //<--- Shifting the pattern on mismatch
|
||||
|
||||
patternIdx++;
|
||||
match_start++; //<--- corpus is always increased by 1
|
||||
|
||||
if ( patternIdx >= (int) k_pattern_length )
|
||||
return corpus_first + match_start - patternIdx;
|
||||
}
|
||||
|
||||
#else
|
||||
// At this point, we know:
|
||||
// k_pattern_length <= k_corpus_length
|
||||
// for all elements of skip, it holds -1 .. k_pattern_length
|
||||
//
|
||||
// In the loop, we have the following invariants
|
||||
// idx is in the range 0 .. k_pattern_length
|
||||
// match_start is in the range 0 .. k_corpus_length - k_pattern_length + 1
|
||||
|
||||
const difference_type last_match = k_corpus_length - k_pattern_length;
|
||||
difference_type idx = 0; // position in the pattern we're comparing
|
||||
|
||||
while ( match_start <= last_match ) {
|
||||
while ( pat_first [ idx ] == corpus_first [ match_start + idx ] ) {
|
||||
if ( ++idx == k_pattern_length )
|
||||
return corpus_first + match_start;
|
||||
}
|
||||
// Figure out where to start searching again
|
||||
// assert ( idx - skip_ [ idx ] > 0 ); // we're always moving forward
|
||||
match_start += idx - skip_ [ idx ];
|
||||
idx = skip_ [ idx ] >= 0 ? skip_ [ idx ] : 0;
|
||||
// assert ( idx >= 0 && idx < k_pattern_length );
|
||||
}
|
||||
#endif
|
||||
|
||||
// We didn't find anything
|
||||
return corpus_last;
|
||||
}
|
||||
|
||||
|
||||
void preKmp ( patIter first, patIter last ) {
|
||||
const /*std::size_t*/ int count = std::distance ( first, last );
|
||||
|
||||
int i, j;
|
||||
|
||||
i = 0;
|
||||
j = skip_[0] = -1;
|
||||
while (i < count) {
|
||||
while (j > -1 && first[i] != first[j])
|
||||
j = skip_[j];
|
||||
i++;
|
||||
j++;
|
||||
if (first[i] == first[j])
|
||||
skip_[i] = skip_[j];
|
||||
else
|
||||
skip_[i] = j;
|
||||
}
|
||||
}
|
||||
|
||||
|
||||
void init_skip_table ( patIter first, patIter last ) {
|
||||
const difference_type count = std::distance ( first, last );
|
||||
|
||||
int j;
|
||||
skip_ [ 0 ] = -1;
|
||||
for ( int i = 1; i <= count; ++i ) {
|
||||
j = skip_ [ i - 1 ];
|
||||
while ( j >= 0 ) {
|
||||
if ( first [ j ] == first [ i - 1 ] )
|
||||
break;
|
||||
j = skip_ [ j ];
|
||||
}
|
||||
skip_ [ i ] = j + 1;
|
||||
}
|
||||
}
|
||||
// \endcond
|
||||
};
|
||||
|
||||
|
||||
/// \fn knuth_morris_pratt_search ( corpusIter corpus_first, corpusIter corpus_last,
|
||||
/// patIter pat_first, patIter pat_last )
|
||||
/// \brief Searches the corpus for the pattern.
|
||||
///
|
||||
/// \param corpus_first The start of the data to search (Random Access Iterator)
|
||||
/// \param corpus_last One past the end of the data to search
|
||||
/// \param pat_first The start of the pattern to search for (Random Access Iterator)
|
||||
/// \param pat_last One past the end of the data to search for
|
||||
///
|
||||
template <typename patIter, typename corpusIter>
|
||||
corpusIter knuth_morris_pratt_search (
|
||||
corpusIter corpus_first, corpusIter corpus_last,
|
||||
patIter pat_first, patIter pat_last ) {
|
||||
knuth_morris_pratt<patIter> kmp ( pat_first, pat_last );
|
||||
return kmp ( corpus_first, corpus_last );
|
||||
}
|
||||
}}
|
||||
|
||||
#endif // BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_SEARCH_HPP
|
||||
@@ -15,8 +15,6 @@
|
||||
#include <locale>
|
||||
#include <functional>
|
||||
|
||||
#include <boost/type_traits/make_unsigned.hpp>
|
||||
|
||||
namespace boost {
|
||||
namespace algorithm {
|
||||
namespace detail {
|
||||
@@ -39,7 +37,7 @@ namespace boost {
|
||||
CharT operator ()( CharT Ch ) const
|
||||
{
|
||||
#if defined(__BORLANDC__) && (__BORLANDC__ >= 0x560) && (__BORLANDC__ <= 0x564) && !defined(_USE_OLD_RW_STL)
|
||||
return std::tolower( static_cast<typename boost::make_unsigned <CharT>::type> ( Ch ));
|
||||
return std::tolower( Ch);
|
||||
#else
|
||||
return std::tolower<CharT>( Ch, *m_Loc );
|
||||
#endif
|
||||
@@ -59,7 +57,7 @@ namespace boost {
|
||||
CharT operator ()( CharT Ch ) const
|
||||
{
|
||||
#if defined(__BORLANDC__) && (__BORLANDC__ >= 0x560) && (__BORLANDC__ <= 0x564) && !defined(_USE_OLD_RW_STL)
|
||||
return std::toupper( static_cast<typename boost::make_unsigned <CharT>::type> ( Ch ));
|
||||
return std::toupper( Ch);
|
||||
#else
|
||||
return std::toupper<CharT>( Ch, *m_Loc );
|
||||
#endif
|
||||
|
||||
@@ -126,7 +126,7 @@ namespace boost {
|
||||
}
|
||||
|
||||
// Use fixed storage
|
||||
::std::memcpy(DestStorage, SrcStorage, sizeof(set_value_type)*m_Size);
|
||||
::memcpy(DestStorage, SrcStorage, sizeof(set_value_type)*m_Size);
|
||||
}
|
||||
|
||||
// Destructor
|
||||
@@ -206,7 +206,7 @@ namespace boost {
|
||||
}
|
||||
|
||||
// Copy the data
|
||||
::std::memcpy(DestStorage, SrcStorage, sizeof(set_value_type)*m_Size);
|
||||
::memcpy(DestStorage, SrcStorage, sizeof(set_value_type)*m_Size);
|
||||
|
||||
return *this;
|
||||
}
|
||||
|
||||
@@ -228,13 +228,13 @@ namespace boost {
|
||||
//! Find head algorithm
|
||||
/*!
|
||||
Get the head of the input. Head is a prefix of the string of the
|
||||
given size. If the input is shorter then required, whole input is considered
|
||||
given size. If the input is shorter then required, whole input if considered
|
||||
to be the head.
|
||||
|
||||
\param Input An input string
|
||||
\param N Length of the head
|
||||
For N>=0, at most N characters are extracted.
|
||||
For N<0, at most size(Input)-|N| characters are extracted.
|
||||
For N<0, size(Input)-|N| characters are extracted.
|
||||
\return
|
||||
An \c iterator_range delimiting the match.
|
||||
Returned iterator is either \c Range1T::iterator or
|
||||
@@ -258,13 +258,13 @@ namespace boost {
|
||||
//! Find tail algorithm
|
||||
/*!
|
||||
Get the tail of the input. Tail is a suffix of the string of the
|
||||
given size. If the input is shorter then required, whole input is considered
|
||||
given size. If the input is shorter then required, whole input if considered
|
||||
to be the tail.
|
||||
|
||||
\param Input An input string
|
||||
\param N Length of the tail.
|
||||
For N>=0, at most N characters are extracted.
|
||||
For N<0, at most size(Input)-|N| characters are extracted.
|
||||
For N<0, size(Input)-|N| characters are extracted.
|
||||
\return
|
||||
An \c iterator_range delimiting the match.
|
||||
Returned iterator is either \c RangeT::iterator or
|
||||
|
||||
@@ -27,9 +27,6 @@
|
||||
sequence (string). In addition, spaces in the middle of the sequence are truncated
|
||||
to just one character. Space is recognized using given locales.
|
||||
|
||||
\c trim_fill acts as trim_all, but the spaces in the middle are replaces with
|
||||
a user-define sequence of character.
|
||||
|
||||
Parametric (\c _if) variants use a predicate (functor) to select which characters
|
||||
are to be trimmed..
|
||||
Functions take a selection predicate as a parameter, which is used to determine
|
||||
@@ -45,7 +42,7 @@ namespace boost {
|
||||
//! Trim All - parametric
|
||||
/*!
|
||||
Remove all leading and trailing spaces from the input and
|
||||
compress all other spaces to a single character.
|
||||
compress all other spaces to a single space.
|
||||
The result is a trimmed copy of the input
|
||||
|
||||
\param Input An input sequence
|
||||
@@ -66,7 +63,7 @@ namespace boost {
|
||||
//! Trim All
|
||||
/*!
|
||||
Remove all leading and trailing spaces from the input and
|
||||
compress all other spaces to a single character.
|
||||
compress all other spaces to a single space.
|
||||
The input sequence is modified in-place.
|
||||
|
||||
\param Input An input sequence
|
||||
@@ -86,7 +83,7 @@ namespace boost {
|
||||
//! Trim All
|
||||
/*!
|
||||
Remove all leading and trailing spaces from the input and
|
||||
compress all other spaces to a single character.
|
||||
compress all other spaces to a single space.
|
||||
The result is a trimmed copy of the input
|
||||
|
||||
\param Input An input sequence
|
||||
@@ -103,7 +100,7 @@ namespace boost {
|
||||
//! Trim All
|
||||
/*!
|
||||
Remove all leading and trailing spaces from the input and
|
||||
compress all other spaces to a single character.
|
||||
compress all other spaces to a single space.
|
||||
The input sequence is modified in-place.
|
||||
|
||||
\param Input An input sequence
|
||||
@@ -117,89 +114,6 @@ namespace boost {
|
||||
}
|
||||
|
||||
|
||||
//! Trim Fill - parametric
|
||||
/*!
|
||||
Remove all leading and trailing spaces from the input and
|
||||
replace all every block of consecutive spaces with a fill string
|
||||
defined by user.
|
||||
The result is a trimmed copy of the input
|
||||
|
||||
\param Input An input sequence
|
||||
\param Fill A string used to fill the inner spaces
|
||||
\param IsSpace An unary predicate identifying spaces
|
||||
\return A trimmed copy of the input
|
||||
*/
|
||||
template<typename SequenceT, typename RangeT, typename PredicateT>
|
||||
inline SequenceT trim_fill_copy_if(const SequenceT& Input, const RangeT& Fill, PredicateT IsSpace)
|
||||
{
|
||||
return
|
||||
::boost::find_format_all_copy(
|
||||
::boost::trim_copy_if(Input, IsSpace),
|
||||
::boost::token_finder(IsSpace, ::boost::token_compress_on),
|
||||
::boost::const_formatter(::boost::as_literal(Fill)));
|
||||
}
|
||||
|
||||
|
||||
//! Trim Fill
|
||||
/*!
|
||||
Remove all leading and trailing spaces from the input and
|
||||
replace all every block of consecutive spaces with a fill string
|
||||
defined by user.
|
||||
The input sequence is modified in-place.
|
||||
|
||||
\param Input An input sequence
|
||||
\param Fill A string used to fill the inner spaces
|
||||
\param IsSpace An unary predicate identifying spaces
|
||||
*/
|
||||
template<typename SequenceT, typename RangeT, typename PredicateT>
|
||||
inline void trim_fill_if(SequenceT& Input, const RangeT& Fill, PredicateT IsSpace)
|
||||
{
|
||||
::boost::trim_if(Input, IsSpace);
|
||||
::boost::find_format_all(
|
||||
Input,
|
||||
::boost::token_finder(IsSpace, ::boost::token_compress_on),
|
||||
::boost::const_formatter(::boost::as_literal(Fill)));
|
||||
}
|
||||
|
||||
|
||||
//! Trim Fill
|
||||
/*!
|
||||
Remove all leading and trailing spaces from the input and
|
||||
replace all every block of consecutive spaces with a fill string
|
||||
defined by user.
|
||||
The result is a trimmed copy of the input
|
||||
|
||||
\param Input An input sequence
|
||||
\param Fill A string used to fill the inner spaces
|
||||
\param Loc A locale used for 'space' classification
|
||||
\return A trimmed copy of the input
|
||||
*/
|
||||
template<typename SequenceT, typename RangeT>
|
||||
inline SequenceT trim_fill_copy(const SequenceT& Input, const RangeT& Fill, const std::locale& Loc =std::locale())
|
||||
{
|
||||
return trim_fill_copy_if(Input, Fill, ::boost::is_space(Loc));
|
||||
}
|
||||
|
||||
|
||||
//! Trim Fill
|
||||
/*!
|
||||
Remove all leading and trailing spaces from the input and
|
||||
replace all every block of consecutive spaces with a fill string
|
||||
defined by user.
|
||||
The input sequence is modified in-place.
|
||||
|
||||
\param Input An input sequence
|
||||
\param Fill A string used to fill the inner spaces
|
||||
\param Loc A locale used for 'space' classification
|
||||
\return A trimmed copy of the input
|
||||
*/
|
||||
template<typename SequenceT, typename RangeT>
|
||||
inline void trim_fill(SequenceT& Input, const RangeT& Fill, const std::locale& Loc =std::locale())
|
||||
{
|
||||
trim_fill_if(Input, Fill, ::boost::is_space(Loc));
|
||||
}
|
||||
|
||||
|
||||
} // namespace algorithm
|
||||
|
||||
// pull names to the boost namespace
|
||||
@@ -207,10 +121,6 @@ namespace boost {
|
||||
using algorithm::trim_all_if;
|
||||
using algorithm::trim_all_copy;
|
||||
using algorithm::trim_all_copy_if;
|
||||
using algorithm::trim_fill;
|
||||
using algorithm::trim_fill_if;
|
||||
using algorithm::trim_fill_copy;
|
||||
using algorithm::trim_fill_copy_if;
|
||||
|
||||
} // namespace boost
|
||||
|
||||
|
||||
-13
@@ -1,13 +0,0 @@
|
||||
<html>
|
||||
<head>
|
||||
<meta http-equiv="refresh" content="0; URL=doc/html/index.html">
|
||||
</head>
|
||||
<body>
|
||||
Automatic redirection failed, please go to
|
||||
<a href="doc/html/index.html">doc/html/index.html</a> <hr>
|
||||
<p>© Copyright Marshall Clow, 2012</p>
|
||||
<p>Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file <a href="../../LICENSE_1_0.txt">LICENSE_1_0.txt</a> or copy
|
||||
at <a href="http://www.boost.org/LICENSE_1_0.txt">www.boost.org/LICENSE_1_0.txt</a>)</p>
|
||||
</body>
|
||||
</html>
|
||||
@@ -737,20 +737,6 @@
|
||||
<functionname>is_xdigit()</functionname>
|
||||
</entry>
|
||||
</row>
|
||||
<row>
|
||||
<entry>is_any_of</entry>
|
||||
<entry>Recognize any of a sequence of characters</entry>
|
||||
<entry>
|
||||
<functionname>is_any_of()</functionname>
|
||||
</entry>
|
||||
</row>
|
||||
<row>
|
||||
<entry>is_from_range</entry>
|
||||
<entry>Recognize characters inside a min..max range</entry>
|
||||
<entry>
|
||||
<functionname>is_from_range()</functionname>
|
||||
</entry>
|
||||
</row>
|
||||
</tbody>
|
||||
</tgroup>
|
||||
</table>
|
||||
|
||||
@@ -135,12 +135,12 @@
|
||||
<< endl; // prints "command.com is an executable"
|
||||
|
||||
//..
|
||||
char text1[]="hello";
|
||||
char text1[]="hello world!";
|
||||
cout
|
||||
<< text1
|
||||
<< (all( text1, is_lower() )? " is": " is not")
|
||||
<< (all( text1, is_lower() )? "is": "is not")
|
||||
<< " written in the lower case"
|
||||
<< endl; // prints "hello is written in the lower case"
|
||||
<< endl; // prints "hello world! is written in the lower case"
|
||||
</programlisting>
|
||||
<para>
|
||||
The predicates determine whether if a substring is contained in the input string
|
||||
@@ -149,11 +149,6 @@
|
||||
simply contains the substring or if both strings are equal. See the reference for
|
||||
<headername>boost/algorithm/string/predicate.hpp</headername> for more details.
|
||||
</para>
|
||||
<para>
|
||||
Note that if we had used "hello world" as the input to the test, it would have
|
||||
output "hello world is not written in the lower case" because the space in the
|
||||
input string is not a lower case letter.
|
||||
</para>
|
||||
<para>
|
||||
In addition the algorithm <functionname>all()</functionname> checks
|
||||
all elements of a container to satisfy a condition specified by a predicate.
|
||||
@@ -168,7 +163,7 @@
|
||||
<title>Trimming</title>
|
||||
|
||||
<para>
|
||||
When parsing the input from a user, strings often have unwanted leading or trailing
|
||||
When parsing the input from a user, strings usually have unwanted leading or trailing
|
||||
characters. To get rid of them, we need trim functions:
|
||||
</para>
|
||||
<programlisting>
|
||||
|
||||
@@ -151,54 +151,11 @@ void trim_all_test()
|
||||
BOOST_CHECK( trim_all_copy_if( string("<>abc<>def<>"), is_any_of( "<<>>" ) )=="abc<def" );
|
||||
}
|
||||
|
||||
void trim_fill_test()
|
||||
{
|
||||
string str1(" 1x x x x1 ");
|
||||
string str2("+---...2x+--x--+x-+-x2...---+");
|
||||
string str3(" ");
|
||||
|
||||
// *** value passing tests *** //
|
||||
|
||||
// general string test
|
||||
BOOST_CHECK( trim_fill_copy( str1, "-" )=="1x-x-x-x1" ) ;
|
||||
BOOST_CHECK( trim_fill_copy_if( str2, " ", is_punct() )=="2x x x x2" ) ;
|
||||
|
||||
// spaces-only string test
|
||||
BOOST_CHECK( trim_fill_copy( str3, " " )=="" );
|
||||
|
||||
// empty string check
|
||||
BOOST_CHECK( trim_fill_copy( string(""), " " )=="" );
|
||||
|
||||
// general string test
|
||||
trim_fill( str1, "-" );
|
||||
BOOST_CHECK( str1=="1x-x-x-x1" ) ;
|
||||
trim_fill_if( str2, "", is_punct() );
|
||||
BOOST_CHECK( str2=="2xxxx2" ) ;
|
||||
|
||||
// spaces-only string test
|
||||
str3 = " "; trim_fill( str3, "" );
|
||||
BOOST_CHECK( str3=="" );
|
||||
|
||||
// empty string check
|
||||
str3 = ""; trim_fill( str3, "" );
|
||||
BOOST_CHECK( str3=="" );
|
||||
BOOST_CHECK( str3=="" );
|
||||
|
||||
// *** non-standard predicate tests *** //
|
||||
BOOST_CHECK(
|
||||
trim_fill_copy_if(
|
||||
string("123abc127deb456"),
|
||||
"+",
|
||||
is_classified(std::ctype_base::digit) )=="abc+deb" );
|
||||
BOOST_CHECK( trim_fill_copy_if( string("<>abc<>def<>"), "-", is_any_of( "<<>>" ) )=="abc-def" );
|
||||
}
|
||||
|
||||
// test main
|
||||
int test_main( int, char*[] )
|
||||
{
|
||||
trim_test();
|
||||
trim_all_test();
|
||||
trim_fill_test();
|
||||
|
||||
|
||||
return 0;
|
||||
}
|
||||
|
||||
@@ -1,49 +0,0 @@
|
||||
# Boost algorithm library test suite Jamfile ----------------------------
|
||||
#
|
||||
# Copyright Marshall Clow 2010-2012. Use, modification and
|
||||
# distribution is subject to the Boost Software License, Version
|
||||
# 1.0. (See accompanying file LICENSE_1_0.txt or copy at
|
||||
# http://www.boost.org/LICENSE_1_0.txt)
|
||||
#
|
||||
# See http://www.boost.org for updates, documentation, and revision history.
|
||||
|
||||
import testing ;
|
||||
|
||||
{
|
||||
test-suite algorithm:
|
||||
# Search tests
|
||||
: [ run empty_search_test.cpp : : : : empty_search_test ]
|
||||
[ run search_test1.cpp : : : : search_test1 ]
|
||||
[ run search_test2.cpp : : : : search_test2 ]
|
||||
[ run search_test3.cpp : : : : search_test3 ]
|
||||
[ compile-fail search_fail1.cpp : : : : ]
|
||||
[ compile-fail search_fail2.cpp : : : : ]
|
||||
[ compile-fail search_fail3.cpp : : : : ]
|
||||
|
||||
# Clamp tests
|
||||
[ run clamp_test.cpp : : : : clamp_test ]
|
||||
|
||||
# Cxx11 tests
|
||||
[ run all_of_test.cpp : : : : all_of_test ]
|
||||
[ run any_of_test.cpp : : : : any_of_test ]
|
||||
[ run none_of_test.cpp : : : : none_of_test ]
|
||||
[ run one_of_test.cpp : : : : one_of_test ]
|
||||
|
||||
[ run ordered_test.cpp : : : : ordered_test ]
|
||||
[ run find_if_not_test1.cpp : : : : find_if_not_test1 ]
|
||||
[ run copy_n_test1.cpp : : : : copy_n_test1 ]
|
||||
[ run iota_test1.cpp : : : : iota_test1 ]
|
||||
|
||||
[ run is_permutation_test1.cpp : : : : is_permutation_test1 ]
|
||||
[ run partition_point_test1.cpp : : : : partition_point_test1 ]
|
||||
[ run is_partitioned_test1.cpp : : : : is_partitioned_test1 ]
|
||||
[ run partition_copy_test1.cpp : : : : partition_copy_test1 ]
|
||||
|
||||
# Hex tests
|
||||
[ run hex_test1.cpp : : : : hex_test1 ]
|
||||
[ run hex_test2.cpp : : : : hex_test2 ]
|
||||
[ run hex_test3.cpp : : : : hex_test3 ]
|
||||
[ compile-fail hex_fail1.cpp ]
|
||||
;
|
||||
}
|
||||
|
||||
@@ -1,86 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/all_of.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <functional>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
template<typename T>
|
||||
struct is_ : public std::unary_function<T, bool> {
|
||||
is_ ( T v ) : val_ ( v ) {}
|
||||
~is_ () {}
|
||||
bool operator () ( T comp ) const { return val_ == comp; }
|
||||
private:
|
||||
is_ (); // need a value
|
||||
|
||||
T val_;
|
||||
};
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
|
||||
void test_all ()
|
||||
{
|
||||
// Note: The literal values here are tested against directly, careful if you change them:
|
||||
int some_numbers[] = { 1, 1, 1, 18, 10 };
|
||||
std::vector<int> vi(some_numbers, some_numbers + 5);
|
||||
std::list<int> li(vi.begin(), vi.end ());
|
||||
|
||||
int some_letters[] = { 'a', 'q', 'n', 'y', 'n' };
|
||||
std::vector<char> vc(some_letters, some_letters + 5);
|
||||
|
||||
|
||||
BOOST_CHECK (!ba::all_of_equal ( vi, 1 ));
|
||||
BOOST_CHECK (!ba::all_of ( vi, is_<int> ( 1 )));
|
||||
BOOST_CHECK (!ba::all_of_equal ( vi.begin(), vi.end(), 1 ));
|
||||
BOOST_CHECK (!ba::all_of ( vi.begin(), vi.end(), is_<int> ( 1 )));
|
||||
|
||||
BOOST_CHECK (!ba::all_of_equal ( vi, 0 ));
|
||||
BOOST_CHECK (!ba::all_of ( vi, is_<int> ( 0 )));
|
||||
BOOST_CHECK (!ba::all_of_equal ( vi.begin(), vi.end(), 0 ));
|
||||
BOOST_CHECK (!ba::all_of ( vi.begin(), vi.end(), is_<int> ( 0 )));
|
||||
|
||||
BOOST_CHECK ( ba::all_of_equal ( vi.end(), vi.end(), 0 ));
|
||||
BOOST_CHECK ( ba::all_of ( vi.end(), vi.end(), is_<int> ( 0 )));
|
||||
|
||||
BOOST_CHECK ( ba::all_of_equal ( vi.begin(), vi.begin () + 3, 1 ));
|
||||
BOOST_CHECK ( ba::all_of ( vi.begin(), vi.begin () + 3, is_<int> ( 1 )));
|
||||
|
||||
BOOST_CHECK ( ba::all_of_equal ( vc.begin() + 1, vc.begin() + 2, 'q' ));
|
||||
BOOST_CHECK ( ba::all_of ( vc.begin() + 1, vc.begin() + 2, is_<char> ( 'q' )));
|
||||
|
||||
BOOST_CHECK (!ba::all_of_equal ( vc, '!' ));
|
||||
BOOST_CHECK (!ba::all_of ( vc, is_<char> ( '!' )));
|
||||
|
||||
BOOST_CHECK ( ba::all_of_equal ( vi.begin(), vi.begin(), 1 ));
|
||||
BOOST_CHECK ( ba::all_of_equal ( vc.begin(), vc.begin(), 'a' ));
|
||||
BOOST_CHECK ( ba::all_of ( vi.begin(), vi.begin(), is_<int> ( 1 )));
|
||||
BOOST_CHECK ( ba::all_of ( vc.begin(), vc.begin(), is_<char> ( 'a' )));
|
||||
|
||||
BOOST_CHECK (!ba::all_of_equal ( li, 1 ));
|
||||
BOOST_CHECK (!ba::all_of ( li, is_<int> ( 1 )));
|
||||
BOOST_CHECK (!ba::all_of_equal ( li.begin(), li.end(), 1 ));
|
||||
BOOST_CHECK (!ba::all_of ( li.begin(), li.end(), is_<int> ( 1 )));
|
||||
|
||||
std::list<int>::iterator l_iter = li.begin ();
|
||||
l_iter++; l_iter++; l_iter++;
|
||||
BOOST_CHECK ( ba::all_of_equal ( li.begin(), l_iter, 1 ));
|
||||
BOOST_CHECK ( ba::all_of ( li.begin(), l_iter, is_<int> ( 1 )));
|
||||
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_all ();
|
||||
return 0;
|
||||
}
|
||||
@@ -1,105 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/any_of.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <functional>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
template<typename T>
|
||||
struct is_ : public std::unary_function<T, bool> {
|
||||
is_ ( T v ) : val_ ( v ) {}
|
||||
~is_ () {}
|
||||
bool operator () ( T comp ) const { return val_ == comp; }
|
||||
private:
|
||||
is_ (); // need a value
|
||||
|
||||
T val_;
|
||||
};
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
|
||||
void test_any ()
|
||||
{
|
||||
// Note: The literal values here are tested against directly, careful if you change them:
|
||||
int some_numbers[] = { 1, 5, 0, 18, 10 };
|
||||
std::vector<int> vi(some_numbers, some_numbers + 5);
|
||||
std::list<int> li(vi.begin(), vi.end ());
|
||||
|
||||
int some_letters[] = { 'a', 'q', 'n', 'y', 'n' };
|
||||
std::vector<char> vc(some_letters, some_letters + 5);
|
||||
|
||||
BOOST_CHECK ( ba::any_of_equal ( vi, 1 ));
|
||||
BOOST_CHECK ( ba::any_of ( vi, is_<int> ( 1 )));
|
||||
BOOST_CHECK ( ba::any_of_equal ( vi.begin(), vi.end(), 1 ));
|
||||
BOOST_CHECK ( ba::any_of ( vi.begin(), vi.end(), is_<int> ( 1 )));
|
||||
|
||||
BOOST_CHECK (!ba::any_of_equal ( vi, 9 ));
|
||||
BOOST_CHECK (!ba::any_of ( vi, is_<int> ( 9 )));
|
||||
BOOST_CHECK (!ba::any_of_equal ( vi.begin(), vi.end(), 9 ));
|
||||
BOOST_CHECK (!ba::any_of ( vi.begin(), vi.end(), is_<int> ( 9 )));
|
||||
|
||||
BOOST_CHECK ( ba::any_of_equal ( vi, 10 ));
|
||||
BOOST_CHECK ( ba::any_of ( vi, is_<int> ( 10 )));
|
||||
BOOST_CHECK (!ba::any_of_equal ( vi, 4 ));
|
||||
BOOST_CHECK (!ba::any_of ( vi, is_<int> ( 4 )));
|
||||
|
||||
BOOST_CHECK (!ba::any_of_equal ( vi.end(), vi.end(), 0 ));
|
||||
BOOST_CHECK (!ba::any_of ( vi.end(), vi.end(), is_<int> ( 0 )));
|
||||
|
||||
// 5 is not in { 0, 18, 10 }, but 10 is
|
||||
BOOST_CHECK ( ba::any_of_equal ( vi.begin() + 2, vi.end(), 10 ));
|
||||
BOOST_CHECK ( ba::any_of ( vi.begin() + 2, vi.end(), is_<int> ( 10 )));
|
||||
|
||||
BOOST_CHECK (!ba::any_of_equal ( vi.begin() + 2, vi.end(), 5 ));
|
||||
BOOST_CHECK (!ba::any_of ( vi.begin() + 2, vi.end(), is_<int> ( 5 )));
|
||||
|
||||
// 18 is not in { 1, 5, 0 }, but 5 is
|
||||
BOOST_CHECK ( ba::any_of_equal ( vi.begin(), vi.begin() + 3, 5 ));
|
||||
BOOST_CHECK ( ba::any_of ( vi.begin(), vi.begin() + 3, is_<int> ( 5 )));
|
||||
|
||||
BOOST_CHECK (!ba::any_of_equal ( vi.begin(), vi.begin() + 3, 18 ));
|
||||
BOOST_CHECK (!ba::any_of ( vi.begin(), vi.begin() + 3, is_<int> ( 18 )));
|
||||
|
||||
BOOST_CHECK ( ba::any_of_equal ( vc, 'q' ));
|
||||
BOOST_CHECK ( ba::any_of ( vc, is_<char> ( 'q' )));
|
||||
|
||||
BOOST_CHECK (!ba::any_of_equal ( vc, '!' ));
|
||||
BOOST_CHECK (!ba::any_of ( vc, is_<char> ( '!' )));
|
||||
|
||||
BOOST_CHECK ( ba::any_of_equal ( vc, 'n' ));
|
||||
BOOST_CHECK ( ba::any_of ( vc, is_<char> ( 'n' )));
|
||||
|
||||
BOOST_CHECK (!ba::any_of_equal ( vi.begin(), vi.begin(), 1 ));
|
||||
BOOST_CHECK (!ba::any_of_equal ( vc.begin(), vc.begin(), 'a' ));
|
||||
BOOST_CHECK (!ba::any_of ( vi.begin(), vi.begin(), is_<int> ( 1 )));
|
||||
BOOST_CHECK (!ba::any_of ( vc.begin(), vc.begin(), is_<char> ( 'a' )));
|
||||
|
||||
BOOST_CHECK ( ba::any_of_equal ( li, 1 ));
|
||||
BOOST_CHECK ( ba::any_of ( li, is_<int> ( 1 )));
|
||||
BOOST_CHECK ( ba::any_of_equal ( li.begin(), li.end(), 1 ));
|
||||
BOOST_CHECK ( ba::any_of ( li.begin(), li.end(), is_<int> ( 1 )));
|
||||
|
||||
std::list<int>::iterator l_iter = li.begin ();
|
||||
l_iter++; l_iter++; l_iter++;
|
||||
BOOST_CHECK ( ba::any_of_equal ( li.begin(), l_iter, 5 ));
|
||||
BOOST_CHECK ( ba::any_of ( li.begin(), l_iter, is_<int> ( 5 )));
|
||||
BOOST_CHECK (!ba::any_of_equal ( li.begin(), l_iter, 18 ));
|
||||
BOOST_CHECK (!ba::any_of ( li.begin(), l_iter, is_<int> ( 18 )));
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_any ();
|
||||
return 0;
|
||||
}
|
||||
@@ -1,218 +0,0 @@
|
||||
// (C) Copyright Jesse Williamson 2009
|
||||
// Use, modification and distribution are subject to the
|
||||
// Boost Software License, Version 1.0. (See accompanying file
|
||||
// LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
#include <iostream>
|
||||
#include <vector>
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/clamp.hpp>
|
||||
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
|
||||
bool intGreater ( int lhs, int rhs ) { return lhs > rhs; }
|
||||
bool doubleGreater ( double lhs, double rhs ) { return lhs > rhs; }
|
||||
|
||||
class custom {
|
||||
public:
|
||||
custom ( int x ) : v(x) {}
|
||||
custom ( const custom &rhs ) : v(rhs.v) {}
|
||||
~custom () {}
|
||||
custom & operator = ( const custom &rhs ) { v = rhs.v; return *this; }
|
||||
|
||||
bool operator < ( const custom &rhs ) const { return v < rhs.v; }
|
||||
bool operator == ( const custom &rhs ) const { return v == rhs.v; } // need this for the test
|
||||
|
||||
std::ostream & print ( std::ostream &os ) const { return os << v; }
|
||||
|
||||
int v;
|
||||
};
|
||||
|
||||
std::ostream & operator << ( std::ostream & os, const custom &x ) { return x.print ( os ); }
|
||||
|
||||
bool customLess ( const custom &lhs, const custom &rhs ) { return lhs.v < rhs.v; }
|
||||
|
||||
void test_ints()
|
||||
{
|
||||
|
||||
// Inside the range, equal to the endpoints, and outside the endpoints.
|
||||
BOOST_CHECK_EQUAL ( 3, ba::clamp ( 3, 1, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 1, ba::clamp ( 1, 1, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 1, ba::clamp ( 0, 1, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 10, ba::clamp ( 10, 1, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 10, ba::clamp ( 11, 1, 10 ));
|
||||
|
||||
BOOST_CHECK_EQUAL ( 3, ba::clamp ( 3, 10, 1, intGreater ));
|
||||
BOOST_CHECK_EQUAL ( 1, ba::clamp ( 1, 10, 1, intGreater ));
|
||||
BOOST_CHECK_EQUAL ( 1, ba::clamp ( 0, 10, 1, intGreater ));
|
||||
BOOST_CHECK_EQUAL ( 10, ba::clamp ( 10, 10, 1, intGreater ));
|
||||
BOOST_CHECK_EQUAL ( 10, ba::clamp ( 11, 10, 1, intGreater ));
|
||||
|
||||
// Negative numbers
|
||||
BOOST_CHECK_EQUAL ( -3, ba::clamp ( -3, -10, -1 ));
|
||||
BOOST_CHECK_EQUAL ( -1, ba::clamp ( -1, -10, -1 ));
|
||||
BOOST_CHECK_EQUAL ( -1, ba::clamp ( 0, -10, -1 ));
|
||||
BOOST_CHECK_EQUAL ( -10, ba::clamp ( -10, -10, -1 ));
|
||||
BOOST_CHECK_EQUAL ( -10, ba::clamp ( -11, -10, -1 ));
|
||||
|
||||
// Mixed positive and negative numbers
|
||||
BOOST_CHECK_EQUAL ( 5, ba::clamp ( 5, -10, 10 ));
|
||||
BOOST_CHECK_EQUAL ( -10, ba::clamp ( -10, -10, 10 ));
|
||||
BOOST_CHECK_EQUAL ( -10, ba::clamp ( -15, -10, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 10, ba::clamp ( 10, -10, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 10, ba::clamp ( 15, -10, 10 ));
|
||||
|
||||
// Unsigned
|
||||
BOOST_CHECK_EQUAL ( 5U, ba::clamp ( 5U, 1U, 10U ));
|
||||
BOOST_CHECK_EQUAL ( 1U, ba::clamp ( 1U, 1U, 10U ));
|
||||
BOOST_CHECK_EQUAL ( 1U, ba::clamp ( 0U, 1U, 10U ));
|
||||
BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 10U, 1U, 10U ));
|
||||
BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 15U, 1U, 10U ));
|
||||
|
||||
// Mixed (1)
|
||||
BOOST_CHECK_EQUAL ( 5U, ba::clamp ( 5U, 1, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 1U, ba::clamp ( 1U, 1, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 1U, ba::clamp ( 0U, 1, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 10U, 1, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 15U, 1, 10 ));
|
||||
|
||||
// Mixed (3)
|
||||
BOOST_CHECK_EQUAL ( 5U, ba::clamp ( 5U, 1, 10. ));
|
||||
BOOST_CHECK_EQUAL ( 1U, ba::clamp ( 1U, 1, 10. ));
|
||||
BOOST_CHECK_EQUAL ( 1U, ba::clamp ( 0U, 1, 10. ));
|
||||
BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 10U, 1, 10. ));
|
||||
BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 15U, 1, 10. ));
|
||||
|
||||
short foo = 50;
|
||||
BOOST_CHECK_EQUAL ( 56, ba::clamp ( foo, 56.9, 129 ));
|
||||
BOOST_CHECK_EQUAL ( 24910, ba::clamp ( foo, 12345678, 123456999 ));
|
||||
}
|
||||
|
||||
|
||||
void test_floats()
|
||||
{
|
||||
|
||||
// Inside the range, equal to the endpoints, and outside the endpoints.
|
||||
BOOST_CHECK_EQUAL ( 3.0, ba::clamp ( 3.0, 1.0, 10.0 ));
|
||||
BOOST_CHECK_EQUAL ( 1.0, ba::clamp ( 1.0, 1.0, 10.0 ));
|
||||
BOOST_CHECK_EQUAL ( 1.0, ba::clamp ( 0.0, 1.0, 10.0 ));
|
||||
BOOST_CHECK_EQUAL ( 10.0, ba::clamp ( 10.0, 1.0, 10.0 ));
|
||||
BOOST_CHECK_EQUAL ( 10.0, ba::clamp ( 11.0, 1.0, 10.0 ));
|
||||
|
||||
BOOST_CHECK_EQUAL ( 3.0, ba::clamp ( 3.0, 10.0, 1.0, doubleGreater ));
|
||||
BOOST_CHECK_EQUAL ( 1.0, ba::clamp ( 1.0, 10.0, 1.0, doubleGreater ));
|
||||
BOOST_CHECK_EQUAL ( 1.0, ba::clamp ( 0.0, 10.0, 1.0, doubleGreater ));
|
||||
BOOST_CHECK_EQUAL ( 10.0, ba::clamp ( 10.0, 10.0, 1.0, doubleGreater ));
|
||||
BOOST_CHECK_EQUAL ( 10.0, ba::clamp ( 11.0, 10.0, 1.0, doubleGreater ));
|
||||
|
||||
// Negative numbers
|
||||
BOOST_CHECK_EQUAL ( -3.f, ba::clamp ( -3.f, -10.f, -1.f ));
|
||||
BOOST_CHECK_EQUAL ( -1.f, ba::clamp ( -1.f, -10.f, -1.f ));
|
||||
BOOST_CHECK_EQUAL ( -1.f, ba::clamp ( 0.f, -10.f, -1.f ));
|
||||
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -10.f, -10.f, -1.f ));
|
||||
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -11.f, -10.f, -1.f ));
|
||||
|
||||
// Mixed positive and negative numbers
|
||||
BOOST_CHECK_EQUAL ( 5.f, ba::clamp ( 5.f, -10.f, 10.f ));
|
||||
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -10.f, -10.f, 10.f ));
|
||||
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -15.f, -10.f, 10.f ));
|
||||
BOOST_CHECK_EQUAL ( 10.f, ba::clamp ( 10.f, -10.f, 10.f ));
|
||||
BOOST_CHECK_EQUAL ( 10.f, ba::clamp ( 15.f, -10.f, 10.f ));
|
||||
|
||||
// Mixed (1)
|
||||
BOOST_CHECK_EQUAL ( 5.f, ba::clamp ( 5.f, -10., 10. ));
|
||||
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -10.f, -10., 10. ));
|
||||
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -15.f, -10., 10. ));
|
||||
BOOST_CHECK_EQUAL ( 10.f, ba::clamp ( 10.f, -10., 10. ));
|
||||
BOOST_CHECK_EQUAL ( 10.f, ba::clamp ( 15.f, -10., 10. ));
|
||||
|
||||
// Mixed (2)
|
||||
BOOST_CHECK_EQUAL ( 5.f, ba::clamp ( 5.f, -10, 10 ));
|
||||
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -10.f, -10, 10 ));
|
||||
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -15.f, -10, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 10.f, ba::clamp ( 10.f, -10, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 10.f, ba::clamp ( 15.f, -10, 10 ));
|
||||
}
|
||||
|
||||
void test_custom()
|
||||
{
|
||||
|
||||
// Inside the range, equal to the endpoints, and outside the endpoints.
|
||||
BOOST_CHECK_EQUAL ( custom( 3), ba::clamp ( custom( 3), custom(1), custom(10)));
|
||||
BOOST_CHECK_EQUAL ( custom( 1), ba::clamp ( custom( 1), custom(1), custom(10)));
|
||||
BOOST_CHECK_EQUAL ( custom( 1), ba::clamp ( custom( 0), custom(1), custom(10)));
|
||||
BOOST_CHECK_EQUAL ( custom(10), ba::clamp ( custom(10), custom(1), custom(10)));
|
||||
BOOST_CHECK_EQUAL ( custom(10), ba::clamp ( custom(11), custom(1), custom(10)));
|
||||
|
||||
BOOST_CHECK_EQUAL ( custom( 3), ba::clamp ( custom( 3), custom(1), custom(10), customLess ));
|
||||
BOOST_CHECK_EQUAL ( custom( 1), ba::clamp ( custom( 1), custom(1), custom(10), customLess ));
|
||||
BOOST_CHECK_EQUAL ( custom( 1), ba::clamp ( custom( 0), custom(1), custom(10), customLess ));
|
||||
BOOST_CHECK_EQUAL ( custom(10), ba::clamp ( custom(10), custom(1), custom(10), customLess ));
|
||||
BOOST_CHECK_EQUAL ( custom(10), ba::clamp ( custom(11), custom(1), custom(10), customLess ));
|
||||
|
||||
// Fail!!
|
||||
// BOOST_CHECK_EQUAL ( custom(1), ba::clamp ( custom(11), custom(1), custom(10)));
|
||||
}
|
||||
|
||||
#define elementsof(v) (sizeof (v) / sizeof (v[0]))
|
||||
#define a_begin(v) (&v[0])
|
||||
#define a_end(v) (v + elementsof (v))
|
||||
#define a_range(v) v
|
||||
#define b_e(v) a_begin(v),a_end(v)
|
||||
|
||||
void test_int_range ()
|
||||
{
|
||||
int inputs [] = { 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 19, 99, 999, -1, -3, -99, 234234 };
|
||||
int outputs [] = { 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10, 10, -1, -1, -1, 10 };
|
||||
std::vector<int> results;
|
||||
std::vector<int> in_v;
|
||||
|
||||
std::copy ( a_begin(inputs), a_end(inputs), std::back_inserter ( in_v ));
|
||||
|
||||
ba::clamp_range ( a_begin(inputs), a_end(inputs), std::back_inserter ( results ), -1, 10 );
|
||||
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
|
||||
results.clear ();
|
||||
ba::clamp_range ( in_v.begin (), in_v.end (), std::back_inserter ( results ), -1, 10 );
|
||||
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
|
||||
results.clear ();
|
||||
|
||||
ba::clamp_range ( a_begin(inputs), a_end(inputs), std::back_inserter ( results ), 10, -1, intGreater );
|
||||
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
|
||||
results.clear ();
|
||||
ba::clamp_range ( in_v.begin (), in_v.end (), std::back_inserter ( results ), 10, -1, intGreater );
|
||||
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
|
||||
results.clear ();
|
||||
|
||||
ba::clamp_range ( a_range(inputs), std::back_inserter ( results ), -1, 10 );
|
||||
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
|
||||
results.clear ();
|
||||
ba::clamp_range ( in_v, std::back_inserter ( results ), -1, 10 );
|
||||
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
|
||||
results.clear ();
|
||||
|
||||
ba::clamp_range ( a_range(inputs), std::back_inserter ( results ), 10, -1, intGreater );
|
||||
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
|
||||
results.clear ();
|
||||
ba::clamp_range ( in_v, std::back_inserter ( results ), 10, -1, intGreater );
|
||||
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
|
||||
results.clear ();
|
||||
|
||||
int junk[elementsof(inputs)];
|
||||
ba::clamp_range ( inputs, junk, 10, -1, intGreater );
|
||||
BOOST_CHECK ( std::equal ( b_e(junk), outputs ));
|
||||
}
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_ints ();
|
||||
test_floats ();
|
||||
test_custom ();
|
||||
|
||||
test_int_range ();
|
||||
// test_float_range ();
|
||||
// test_custom_range ();
|
||||
return 0;
|
||||
}
|
||||
@@ -1,85 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/copy_n.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <string>
|
||||
#include <iostream>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
// namespace ba = boost;
|
||||
|
||||
template <typename Container>
|
||||
void test_sequence ( Container const &c ) {
|
||||
|
||||
typedef typename Container::value_type value_type;
|
||||
std::vector<value_type> v;
|
||||
|
||||
// Copy zero elements
|
||||
v.clear ();
|
||||
ba::copy_n ( c.begin (), 0, back_inserter ( v ));
|
||||
BOOST_CHECK ( v.size () == 0 );
|
||||
ba::copy_n ( c.begin (), 0U, back_inserter ( v ));
|
||||
BOOST_CHECK ( v.size () == 0 );
|
||||
|
||||
if ( c.size () > 0 ) {
|
||||
// Just one element
|
||||
v.clear ();
|
||||
ba::copy_n ( c.begin (), 1, back_inserter ( v ));
|
||||
BOOST_CHECK ( v.size () == 1 );
|
||||
BOOST_CHECK ( v[0] == *c.begin ());
|
||||
|
||||
v.clear ();
|
||||
ba::copy_n ( c.begin (), 1U, back_inserter ( v ));
|
||||
BOOST_CHECK ( v.size () == 1 );
|
||||
BOOST_CHECK ( v[0] == *c.begin ());
|
||||
|
||||
// Half the elements
|
||||
v.clear ();
|
||||
ba::copy_n ( c.begin (), c.size () / 2, back_inserter ( v ));
|
||||
BOOST_CHECK ( v.size () == c.size () / 2);
|
||||
BOOST_CHECK ( std::equal ( v.begin (), v.end (), c.begin ()));
|
||||
|
||||
// Half the elements + 1
|
||||
v.clear ();
|
||||
ba::copy_n ( c.begin (), c.size () / 2 + 1, back_inserter ( v ));
|
||||
BOOST_CHECK ( v.size () == c.size () / 2 + 1 );
|
||||
BOOST_CHECK ( std::equal ( v.begin (), v.end (), c.begin ()));
|
||||
|
||||
// All the elements
|
||||
v.clear ();
|
||||
ba::copy_n ( c.begin (), c.size (), back_inserter ( v ));
|
||||
BOOST_CHECK ( v.size () == c.size ());
|
||||
BOOST_CHECK ( std::equal ( v.begin (), v.end (), c.begin ()));
|
||||
}
|
||||
}
|
||||
|
||||
|
||||
void test_sequence1 () {
|
||||
std::vector<int> v;
|
||||
for ( int i = 5; i < 15; ++i )
|
||||
v.push_back ( i );
|
||||
test_sequence ( v );
|
||||
|
||||
std::list<int> l;
|
||||
for ( int i = 25; i > 15; --i )
|
||||
l.push_back ( i );
|
||||
test_sequence ( l );
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_sequence1 ();
|
||||
return 0;
|
||||
}
|
||||
@@ -1,83 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <string>
|
||||
|
||||
#include <boost/algorithm/searching/boyer_moore.hpp>
|
||||
#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
|
||||
#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
|
||||
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
int test_main( int argc, char *argv [] )
|
||||
{
|
||||
const std::string cs;
|
||||
std::string estr;
|
||||
std::string str ( "abc" );
|
||||
|
||||
// empty corpus, empty pattern
|
||||
BOOST_CHECK (
|
||||
boost::algorithm::boyer_moore_search (
|
||||
cs.begin (), cs.end (), estr.begin (), estr.end ())
|
||||
== cs.begin ()
|
||||
);
|
||||
|
||||
BOOST_CHECK (
|
||||
boost::algorithm::boyer_moore_horspool_search (
|
||||
cs.begin (), cs.end (), estr.begin (), estr.end ())
|
||||
== cs.begin ()
|
||||
);
|
||||
|
||||
BOOST_CHECK (
|
||||
boost::algorithm::knuth_morris_pratt_search (
|
||||
cs.begin (), cs.end (), estr.begin (), estr.end ())
|
||||
== cs.begin ()
|
||||
);
|
||||
|
||||
// empty corpus, non-empty pattern
|
||||
BOOST_CHECK (
|
||||
boost::algorithm::boyer_moore_search (
|
||||
estr.begin (), estr.end (), str.begin (), str.end ())
|
||||
== estr.end ()
|
||||
);
|
||||
|
||||
BOOST_CHECK (
|
||||
boost::algorithm::boyer_moore_horspool_search (
|
||||
estr.begin (), estr.end (), str.begin (), str.end ())
|
||||
== estr.end ()
|
||||
);
|
||||
|
||||
BOOST_CHECK (
|
||||
boost::algorithm::knuth_morris_pratt_search (
|
||||
estr.begin (), estr.end (), str.begin (), str.end ())
|
||||
== estr.end ()
|
||||
);
|
||||
|
||||
// non-empty corpus, empty pattern
|
||||
BOOST_CHECK (
|
||||
boost::algorithm::boyer_moore_search (
|
||||
str.begin (), str.end (), estr.begin (), estr.end ())
|
||||
== str.begin ()
|
||||
);
|
||||
|
||||
BOOST_CHECK (
|
||||
boost::algorithm::boyer_moore_horspool_search (
|
||||
str.begin (), str.end (), estr.begin (), estr.end ())
|
||||
== str.begin ()
|
||||
);
|
||||
|
||||
BOOST_CHECK (
|
||||
boost::algorithm::knuth_morris_pratt_search (
|
||||
str.begin (), str.end (), estr.begin (), estr.end ())
|
||||
== str.begin ()
|
||||
);
|
||||
|
||||
(void) argv; (void) argc;
|
||||
return 0;
|
||||
}
|
||||
@@ -1,90 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <iostream>
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/find_if_not.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <string>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
// namespace ba = boost;
|
||||
|
||||
template <typename Container>
|
||||
typename Container::iterator offset_to_iter ( Container &v, int offset ) {
|
||||
typename Container::iterator retval;
|
||||
|
||||
if ( offset >= 0 ) {
|
||||
retval = v.begin ();
|
||||
std::advance ( retval, offset );
|
||||
}
|
||||
else {
|
||||
retval = v.end ();
|
||||
std::advance ( retval, offset + 1 );
|
||||
}
|
||||
return retval;
|
||||
}
|
||||
|
||||
template <typename Container, typename Predicate>
|
||||
void test_sequence ( Container &v, Predicate comp, int expected ) {
|
||||
typename Container::iterator res, exp;
|
||||
|
||||
res = ba::find_if_not ( v.begin (), v.end (), comp );
|
||||
exp = offset_to_iter ( v, expected );
|
||||
std::cout << "Expected(1): " << std::distance ( v.begin (), exp )
|
||||
<< ", got: " << std::distance ( v.begin (), res ) << std::endl;
|
||||
BOOST_CHECK ( exp == res );
|
||||
}
|
||||
|
||||
template <typename T>
|
||||
struct less_than {
|
||||
public:
|
||||
less_than ( T foo ) : val ( foo ) {}
|
||||
less_than ( const less_than &rhs ) : val ( rhs.val ) {}
|
||||
|
||||
bool operator () ( const T &v ) const { return v < val; }
|
||||
private:
|
||||
less_than ();
|
||||
less_than operator = ( const less_than &rhs );
|
||||
T val;
|
||||
};
|
||||
|
||||
|
||||
void test_sequence1 () {
|
||||
std::vector<int> v;
|
||||
|
||||
v.clear ();
|
||||
for ( int i = 5; i < 15; ++i )
|
||||
v.push_back ( i );
|
||||
test_sequence ( v, less_than<int>(3), 0 ); // no elements
|
||||
test_sequence ( v, less_than<int>(6), 1 ); // only the first element
|
||||
test_sequence ( v, less_than<int>(10), 5 );
|
||||
test_sequence ( v, less_than<int>(99), -1 ); // all elements satisfy
|
||||
|
||||
// With bidirectional iterators.
|
||||
std::list<int> l;
|
||||
for ( int i = 5; i < 15; ++i )
|
||||
l.push_back ( i );
|
||||
test_sequence ( l, less_than<int>(3), 0 ); // no elements
|
||||
test_sequence ( l, less_than<int>(6), 1 ); // only the first element
|
||||
test_sequence ( l, less_than<int>(10), 5 );
|
||||
test_sequence ( l, less_than<int>(99), -1 ); // all elements satisfy
|
||||
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_sequence1 ();
|
||||
return 0;
|
||||
}
|
||||
@@ -1,25 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/hex.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <string>
|
||||
#include <iostream>
|
||||
#include <vector>
|
||||
|
||||
// should not compile: vector is not an integral type
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
std::vector<float> v;
|
||||
std::string out;
|
||||
boost::algorithm::unhex ( out, std::back_inserter(v));
|
||||
return 0;
|
||||
}
|
||||
@@ -1,154 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/hex.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <string>
|
||||
#include <iostream>
|
||||
|
||||
|
||||
template<typename String>
|
||||
void test_to_hex ( const typename String::value_type ** tests ) {
|
||||
for ( const typename String::value_type **p = tests; *p; p++ ) {
|
||||
String arg, argh, one, two, three, four;
|
||||
arg.assign ( *p );
|
||||
boost::algorithm::hex ( *p, std::back_inserter ( one ));
|
||||
boost::algorithm::hex ( arg, std::back_inserter ( two ));
|
||||
boost::algorithm::hex ( arg.begin (), arg.end (), std::back_inserter ( three ));
|
||||
four = boost::algorithm::hex ( arg );
|
||||
BOOST_CHECK ( one == two );
|
||||
BOOST_CHECK ( one == three );
|
||||
BOOST_CHECK ( one == four );
|
||||
argh = one;
|
||||
one.clear (); two.clear (); three.clear (); four.clear ();
|
||||
boost::algorithm::unhex ( argh.c_str (), std::back_inserter ( one ));
|
||||
boost::algorithm::unhex ( argh, std::back_inserter ( two ));
|
||||
boost::algorithm::unhex ( argh.begin (), argh.end (), std::back_inserter ( three ));
|
||||
four = boost::algorithm::unhex ( argh );
|
||||
BOOST_CHECK ( one == two );
|
||||
BOOST_CHECK ( one == three );
|
||||
BOOST_CHECK ( one == four );
|
||||
BOOST_CHECK ( one == arg );
|
||||
}
|
||||
}
|
||||
|
||||
|
||||
template<typename String>
|
||||
void test_from_hex_success ( const typename String::value_type ** tests ) {
|
||||
for ( const typename String::value_type **p = tests; *p; p++ ) {
|
||||
String arg, argh, one, two, three, four;
|
||||
arg.assign ( *p );
|
||||
boost::algorithm::unhex ( *p, std::back_inserter ( one ));
|
||||
boost::algorithm::unhex ( arg, std::back_inserter ( two ));
|
||||
boost::algorithm::unhex ( arg.begin (), arg.end (), std::back_inserter ( three ));
|
||||
four = boost::algorithm::unhex ( arg );
|
||||
BOOST_CHECK ( one == two );
|
||||
BOOST_CHECK ( one == three );
|
||||
BOOST_CHECK ( one == four );
|
||||
argh = one;
|
||||
one.clear (); two.clear (); three.clear (); four.clear ();
|
||||
boost::algorithm::hex ( argh.c_str (), std::back_inserter ( one ));
|
||||
boost::algorithm::hex ( argh, std::back_inserter ( two ));
|
||||
boost::algorithm::hex ( argh.begin (), argh.end (), std::back_inserter ( three ));
|
||||
four = boost::algorithm::hex ( argh );
|
||||
BOOST_CHECK ( one == two );
|
||||
BOOST_CHECK ( one == three );
|
||||
BOOST_CHECK ( one == four );
|
||||
BOOST_CHECK ( one == arg );
|
||||
}
|
||||
}
|
||||
|
||||
template<typename String>
|
||||
void test_from_hex_failure ( const typename String::value_type ** tests ) {
|
||||
int num_catches;
|
||||
for ( const typename String::value_type **p = tests; *p; p++ ) {
|
||||
String arg, one;
|
||||
arg.assign ( *p );
|
||||
num_catches = 0;
|
||||
|
||||
try { boost::algorithm::unhex ( *p, std::back_inserter ( one )); }
|
||||
catch ( const boost::algorithm::hex_decode_error & /*ex*/ ) { num_catches++; }
|
||||
try { boost::algorithm::unhex ( arg, std::back_inserter ( one )); }
|
||||
catch ( const boost::algorithm::hex_decode_error & /*ex*/ ) { num_catches++; }
|
||||
try { boost::algorithm::unhex ( arg.begin (), arg.end (), std::back_inserter ( one )); }
|
||||
catch ( const boost::algorithm::hex_decode_error & /*ex*/ ) { num_catches++; }
|
||||
BOOST_CHECK ( num_catches == 3 );
|
||||
}
|
||||
}
|
||||
|
||||
|
||||
|
||||
const char *tohex [] = {
|
||||
"",
|
||||
"a",
|
||||
"\001",
|
||||
"12",
|
||||
"asdfadsfsad",
|
||||
"01234567890ABCDEF",
|
||||
NULL // End of the list
|
||||
};
|
||||
|
||||
|
||||
const wchar_t *tohex_w [] = {
|
||||
L"",
|
||||
L"a",
|
||||
L"\001",
|
||||
L"12",
|
||||
L"asdfadsfsad",
|
||||
L"01234567890ABCDEF",
|
||||
NULL // End of the list
|
||||
};
|
||||
|
||||
|
||||
const char *fromhex [] = {
|
||||
"20",
|
||||
"2122234556FF",
|
||||
NULL // End of the list
|
||||
};
|
||||
|
||||
|
||||
const wchar_t *fromhex_w [] = {
|
||||
L"00101020",
|
||||
L"2122234556FF3456",
|
||||
NULL // End of the list
|
||||
};
|
||||
|
||||
|
||||
const char *fromhex_fail [] = {
|
||||
"2",
|
||||
"H",
|
||||
"234",
|
||||
"21222G4556FF",
|
||||
NULL // End of the list
|
||||
};
|
||||
|
||||
|
||||
const wchar_t *fromhex_fail_w [] = {
|
||||
L"2",
|
||||
L"12",
|
||||
L"H",
|
||||
L"234",
|
||||
L"21222G4556FF",
|
||||
NULL // End of the list
|
||||
};
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_to_hex<std::string> ( tohex );
|
||||
test_from_hex_success<std::string> ( fromhex );
|
||||
test_from_hex_failure<std::string> ( fromhex_fail );
|
||||
|
||||
test_to_hex<std::wstring> ( tohex_w );
|
||||
test_from_hex_success<std::wstring> ( fromhex_w );
|
||||
test_from_hex_failure<std::wstring> ( fromhex_fail_w );
|
||||
return 0;
|
||||
}
|
||||
@@ -1,137 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
|
||||
Test non-string cases; vector and list
|
||||
*/
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/hex.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <string>
|
||||
#include <iostream>
|
||||
#include <deque>
|
||||
#include <list>
|
||||
|
||||
|
||||
const char *tohex [] = {
|
||||
"",
|
||||
"a",
|
||||
"\001",
|
||||
"12",
|
||||
"asdfadsfsad",
|
||||
"01234567890ABCDEF",
|
||||
NULL // End of the list
|
||||
};
|
||||
|
||||
void test_to_hex () {
|
||||
for ( const char **p = tohex; *p; p++ ) {
|
||||
std::deque<char> arg, argh;
|
||||
std::list<char> one, two, three;
|
||||
arg.assign ( *p, *p + strlen (*p));
|
||||
boost::algorithm::hex ( *p, std::back_inserter ( one ));
|
||||
boost::algorithm::hex ( arg, std::back_inserter ( two ));
|
||||
boost::algorithm::hex ( arg.begin (), arg.end (), std::back_inserter ( three ));
|
||||
BOOST_CHECK ( std::equal ( one.begin (), one.end (), two.begin ()));
|
||||
BOOST_CHECK ( std::equal ( two.begin (), two.end (), three.begin ()));
|
||||
|
||||
std::copy ( one.begin (), one.end (), std::back_inserter ( argh ));
|
||||
one.clear (); two.clear (); three.clear ();
|
||||
|
||||
// boost::algorithm::unhex ( argh.c_str (), std::back_inserter ( one ));
|
||||
boost::algorithm::unhex ( argh, std::back_inserter ( two ));
|
||||
boost::algorithm::unhex ( argh.begin (), argh.end (), std::back_inserter ( three ));
|
||||
// BOOST_CHECK ( std::equal ( one.begin (), one.end (), two.begin ()));
|
||||
BOOST_CHECK ( std::equal ( two.begin (), two.end (), three.begin ()));
|
||||
BOOST_CHECK ( std::equal ( two.begin (), two.end (), arg.begin ()));
|
||||
}
|
||||
|
||||
// Again, with a front_inserter
|
||||
for ( const char **p = tohex; *p; p++ ) {
|
||||
std::deque<char> arg, argh;
|
||||
std::list<char> one, two, three;
|
||||
arg.assign ( *p, *p + strlen (*p));
|
||||
boost::algorithm::hex ( *p, std::front_inserter ( one ));
|
||||
boost::algorithm::hex ( arg, std::front_inserter ( two ));
|
||||
boost::algorithm::hex ( arg.begin (), arg.end (), std::front_inserter ( three ));
|
||||
BOOST_CHECK ( std::equal ( one.begin (), one.end (), two.begin ()));
|
||||
BOOST_CHECK ( std::equal ( two.begin (), two.end (), three.begin ()));
|
||||
|
||||
// Copy, reversing
|
||||
std::copy ( one.begin (), one.end (), std::front_inserter ( argh ));
|
||||
one.clear (); two.clear (); three.clear ();
|
||||
|
||||
// boost::algorithm::unhex ( argh.c_str (), std::front_inserter ( one ));
|
||||
boost::algorithm::unhex ( argh, std::front_inserter ( two ));
|
||||
boost::algorithm::unhex ( argh.begin (), argh.end (), std::front_inserter ( three ));
|
||||
// BOOST_CHECK ( std::equal ( one.begin (), one.end (), two.begin ()));
|
||||
BOOST_CHECK ( std::equal ( two.begin (), two.end (), three.begin ()));
|
||||
BOOST_CHECK ( std::equal ( two.begin (), two.end (), arg.rbegin ())); // reverse
|
||||
}
|
||||
}
|
||||
|
||||
const char *fromhex [] = {
|
||||
"20",
|
||||
"2122234556FF",
|
||||
NULL // End of the list
|
||||
};
|
||||
|
||||
|
||||
void test_from_hex_success () {
|
||||
for ( const char **p = fromhex; *p; p++ ) {
|
||||
std::deque<char> arg, argh;
|
||||
std::list<char> one, two, three;
|
||||
arg.assign ( *p, *p + strlen (*p));
|
||||
boost::algorithm::unhex ( *p, std::back_inserter ( one ));
|
||||
boost::algorithm::unhex ( arg, std::back_inserter ( two ));
|
||||
boost::algorithm::unhex ( arg.begin (), arg.end (), std::back_inserter ( three ));
|
||||
BOOST_CHECK ( std::equal ( one.begin (), one.end (), two.begin ()));
|
||||
BOOST_CHECK ( std::equal ( two.begin (), two.end (), three.begin ()));
|
||||
|
||||
std::copy ( one.begin (), one.end (), std::back_inserter ( argh ));
|
||||
one.clear (); two.clear (); three.clear ();
|
||||
|
||||
// boost::algorithm::hex ( argh.c_str (), std::back_inserter ( one ));
|
||||
boost::algorithm::hex ( argh, std::back_inserter ( two ));
|
||||
boost::algorithm::hex ( argh.begin (), argh.end (), std::back_inserter ( three ));
|
||||
// BOOST_CHECK ( std::equal ( one.begin (), one.end (), two.begin ()));
|
||||
BOOST_CHECK ( std::equal ( two.begin (), two.end (), three.begin ()));
|
||||
BOOST_CHECK ( std::equal ( two.begin (), two.end (), arg.begin ()));
|
||||
}
|
||||
|
||||
// Again, with a front_inserter
|
||||
for ( const char **p = fromhex; *p; p++ ) {
|
||||
std::deque<char> arg, argh;
|
||||
std::list<char> one, two, three;
|
||||
arg.assign ( *p, *p + strlen (*p));
|
||||
boost::algorithm::unhex ( *p, std::front_inserter ( one ));
|
||||
boost::algorithm::unhex ( arg, std::front_inserter ( two ));
|
||||
boost::algorithm::unhex ( arg.begin (), arg.end (), std::front_inserter ( three ));
|
||||
BOOST_CHECK ( std::equal ( one.begin (), one.end (), two.begin ()));
|
||||
BOOST_CHECK ( std::equal ( two.begin (), two.end (), three.begin ()));
|
||||
|
||||
// Copy, reversing
|
||||
std::copy ( one.begin (), one.end (), std::front_inserter ( argh ));
|
||||
one.clear (); two.clear (); three.clear ();
|
||||
|
||||
// boost::algorithm::hex ( argh.c_str (), std::front_inserter ( one ));
|
||||
boost::algorithm::hex ( argh, std::front_inserter ( two ));
|
||||
boost::algorithm::hex ( argh.begin (), argh.end (), std::front_inserter ( three ));
|
||||
// BOOST_CHECK ( std::equal ( one.begin (), one.end (), two.begin ()));
|
||||
BOOST_CHECK ( std::equal ( two.begin (), two.end (), three.begin ()));
|
||||
BOOST_CHECK ( std::equal ( two.begin (), two.end (), arg.rbegin ())); // reversed
|
||||
}
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_to_hex ();
|
||||
test_from_hex_success ();
|
||||
return 0;
|
||||
}
|
||||
@@ -1,123 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
|
||||
Try ostream_iterators
|
||||
*/
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/hex.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <string>
|
||||
#include <iostream>
|
||||
#include <deque>
|
||||
#include <list>
|
||||
|
||||
|
||||
template <typename char_type>
|
||||
void test_to_hex ( const char_type ** tests ) {
|
||||
typedef std::basic_string<char_type> String;
|
||||
typedef std::basic_ostringstream<char_type> Stream;
|
||||
typedef std::ostream_iterator<char_type, char_type> Iter;
|
||||
|
||||
for ( const char_type **p = tests; *p; p++ ) {
|
||||
String arg, argh;
|
||||
Stream one, two, three;
|
||||
arg.assign ( *p );
|
||||
boost::algorithm::hex ( *p, Iter ( one ));
|
||||
boost::algorithm::hex ( arg, Iter ( two ));
|
||||
boost::algorithm::hex ( arg.begin (), arg.end (), Iter ( three ));
|
||||
boost::algorithm::hex ( arg );
|
||||
BOOST_CHECK ( one.str () == two.str ());
|
||||
BOOST_CHECK ( one.str () == three.str ());
|
||||
argh = one.str ();
|
||||
one.str (String()); two.str (String()); three.str (String());
|
||||
boost::algorithm::unhex ( argh.c_str (), Iter ( one ));
|
||||
boost::algorithm::unhex ( argh, Iter ( two ));
|
||||
boost::algorithm::unhex ( argh.begin (), argh.end (), Iter ( three ));
|
||||
BOOST_CHECK ( one.str () == two.str ());
|
||||
BOOST_CHECK ( one.str () == three.str ());
|
||||
BOOST_CHECK ( one.str () == arg );
|
||||
}
|
||||
}
|
||||
|
||||
|
||||
template <typename char_type>
|
||||
void test_from_hex_success ( const char_type ** tests ) {
|
||||
typedef std::basic_string<char_type> String;
|
||||
typedef std::basic_ostringstream<char_type> Stream;
|
||||
typedef std::ostream_iterator<char_type, char_type> Iter;
|
||||
|
||||
for ( const char_type **p = tests; *p; p++ ) {
|
||||
String arg, argh;
|
||||
Stream one, two, three;
|
||||
arg.assign ( *p );
|
||||
boost::algorithm::unhex ( *p, Iter ( one ));
|
||||
boost::algorithm::unhex ( arg, Iter ( two ));
|
||||
boost::algorithm::unhex ( arg.begin (), arg.end (), Iter ( three ));
|
||||
|
||||
BOOST_CHECK ( one.str () == two.str ());
|
||||
BOOST_CHECK ( one.str () == three.str ());
|
||||
|
||||
argh = one.str ();
|
||||
one.str (String()); two.str (String()); three.str (String());
|
||||
|
||||
boost::algorithm::hex ( argh.c_str (), Iter ( one ));
|
||||
boost::algorithm::hex ( argh, Iter ( two ));
|
||||
boost::algorithm::hex ( argh.begin (), argh.end (), Iter ( three ));
|
||||
|
||||
BOOST_CHECK ( one.str () == two.str ());
|
||||
BOOST_CHECK ( one.str () == three.str ());
|
||||
BOOST_CHECK ( one.str () == arg );
|
||||
}
|
||||
|
||||
}
|
||||
|
||||
const char *tohex [] = {
|
||||
"",
|
||||
"a",
|
||||
"\001",
|
||||
"12",
|
||||
"asdfadsfsad",
|
||||
"01234567890ABCDEF",
|
||||
NULL // End of the list
|
||||
};
|
||||
|
||||
const wchar_t *tohex_w [] = {
|
||||
L"",
|
||||
L"a",
|
||||
L"\001",
|
||||
L"12",
|
||||
L"asdfadsfsad",
|
||||
L"01234567890ABCDEF",
|
||||
NULL // End of the list
|
||||
};
|
||||
|
||||
|
||||
const char *fromhex [] = {
|
||||
"20",
|
||||
"2122234556FF",
|
||||
NULL // End of the list
|
||||
};
|
||||
|
||||
const wchar_t *fromhex_w [] = {
|
||||
L"11223320",
|
||||
L"21222345010256FF",
|
||||
NULL // End of the list
|
||||
};
|
||||
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_to_hex ( tohex );
|
||||
test_to_hex ( tohex_w );
|
||||
test_from_hex_success ( fromhex );
|
||||
test_from_hex_success ( fromhex_w );
|
||||
return 0;
|
||||
}
|
||||
@@ -1,79 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/iota.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <iostream>
|
||||
#include <string>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
// Test to make sure a sequence is "correctly formed"; i.e, ascending by one
|
||||
template <typename Iterator, typename T>
|
||||
bool test_iota_results ( Iterator first, Iterator last, T initial_value ) {
|
||||
if ( first == last ) return true;
|
||||
if ( initial_value != *first ) return false;
|
||||
Iterator prev = first;
|
||||
while ( ++first != last ) {
|
||||
if (( *first - *prev ) != 1 )
|
||||
return false;
|
||||
prev = first;
|
||||
}
|
||||
return true;
|
||||
}
|
||||
|
||||
template <typename Range, typename T>
|
||||
bool test_iota_results ( const Range &r, T initial_value ) {
|
||||
return test_iota_results (boost::begin (r), boost::end (r), initial_value );
|
||||
}
|
||||
|
||||
|
||||
void test_ints () {
|
||||
std::vector<int> v;
|
||||
std::list<int> l;
|
||||
|
||||
v.clear (); v.reserve ( 10 );
|
||||
boost::algorithm::iota ( v.begin (), v.end (), 23 );
|
||||
BOOST_CHECK ( test_iota_results ( v.begin (), v.end (), 23 ));
|
||||
|
||||
v.clear (); v.reserve ( 19 );
|
||||
boost::algorithm::iota ( v, 18 );
|
||||
BOOST_CHECK ( test_iota_results ( v, 18 ));
|
||||
|
||||
v.clear ();
|
||||
boost::algorithm::iota_n ( std::back_inserter(v), 99, 20 );
|
||||
BOOST_CHECK ( test_iota_results ( v, 99 ));
|
||||
|
||||
/*
|
||||
l.clear (); l.reserve ( 5 );
|
||||
boost::algorithm::iota ( l.begin (), l.end (), 123 );
|
||||
BOOST_CHECK ( test_iota_results ( l.begin (), l.end (), 123 ));
|
||||
|
||||
l.clear (); l.reserve ( 9 );
|
||||
boost::algorithm::iota ( l.begin (), l.end (), 87 );
|
||||
BOOST_CHECK ( test_iota_results ( l.begin (), l.end (), 87 ));
|
||||
*/
|
||||
|
||||
l.clear ();
|
||||
boost::algorithm::iota_n ( std::back_inserter(l), 99, 20 );
|
||||
BOOST_CHECK ( test_iota_results ( l, 99 ));
|
||||
|
||||
l.clear ();
|
||||
boost::algorithm::iota_n ( std::front_inserter(l), 123, 20 );
|
||||
BOOST_CHECK ( test_iota_results ( l.rbegin (), l.rend (), 123 ));
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_ints ();
|
||||
return 0;
|
||||
}
|
||||
@@ -1,63 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <iostream>
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/is_partitioned.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <string>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
// namespace ba = boost;
|
||||
|
||||
template <typename T>
|
||||
struct less_than {
|
||||
public:
|
||||
less_than ( T foo ) : val ( foo ) {}
|
||||
less_than ( const less_than &rhs ) : val ( rhs.val ) {}
|
||||
|
||||
bool operator () ( const T &v ) const { return v < val; }
|
||||
private:
|
||||
less_than ();
|
||||
less_than operator = ( const less_than &rhs );
|
||||
T val;
|
||||
};
|
||||
|
||||
|
||||
void test_sequence1 () {
|
||||
std::vector<int> v;
|
||||
|
||||
v.clear ();
|
||||
for ( int i = 5; i < 15; ++i )
|
||||
v.push_back ( i );
|
||||
BOOST_CHECK ( ba::is_partitioned ( v, less_than<int>(3))); // no elements
|
||||
BOOST_CHECK ( ba::is_partitioned ( v, less_than<int>(6))); // only the first element
|
||||
BOOST_CHECK ( ba::is_partitioned ( v, less_than<int>(10))); // in the middle somewhere
|
||||
BOOST_CHECK ( ba::is_partitioned ( v, less_than<int>(99))); // all elements satisfy
|
||||
|
||||
// With bidirectional iterators.
|
||||
std::list<int> l;
|
||||
for ( int i = 5; i < 15; ++i )
|
||||
l.push_back ( i );
|
||||
BOOST_CHECK ( ba::is_partitioned ( l.begin (), l.end (), less_than<int>(3))); // no elements
|
||||
BOOST_CHECK ( ba::is_partitioned ( l.begin (), l.end (), less_than<int>(6))); // only the first element
|
||||
BOOST_CHECK ( ba::is_partitioned ( l.begin (), l.end (), less_than<int>(10))); // in the middle somewhere
|
||||
BOOST_CHECK ( ba::is_partitioned ( l.begin (), l.end (), less_than<int>(99))); // all elements satisfy
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_sequence1 ();
|
||||
return 0;
|
||||
}
|
||||
@@ -1,49 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <iostream>
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/is_permutation.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <string>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
// namespace ba = boost;
|
||||
|
||||
void test_sequence1 () {
|
||||
std::vector<int> v, v1;
|
||||
|
||||
v.clear ();
|
||||
for ( std::size_t i = 5; i < 15; ++i )
|
||||
v.push_back ( i );
|
||||
v1 = v;
|
||||
BOOST_CHECK ( ba::is_permutation ( v.begin (), v.end (), v.begin ())); // better be a permutation of itself!
|
||||
BOOST_CHECK ( ba::is_permutation ( v.begin (), v.end (), v1.begin ()));
|
||||
|
||||
// With bidirectional iterators.
|
||||
std::list<int> l;
|
||||
std::copy ( v.begin (), v.end (), std::back_inserter ( l ));
|
||||
BOOST_CHECK ( ba::is_permutation ( l.begin (), l.end (), l.begin ())); // better be a permutation of itself!
|
||||
BOOST_CHECK ( ba::is_permutation ( l.begin (), l.end (), v1.begin ()));
|
||||
for ( std::size_t i = 0; i < l.size (); ++i ) {
|
||||
l.push_back ( *l.begin ()); l.pop_front (); // rotation
|
||||
BOOST_CHECK ( ba::is_permutation ( l.begin (), l.end (), v1.begin ()));
|
||||
}
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_sequence1 ();
|
||||
return 0;
|
||||
}
|
||||
@@ -1,96 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/none_of.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <functional>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
template<typename T>
|
||||
struct is_ : public std::unary_function<T, bool> {
|
||||
is_ ( T v ) : val_ ( v ) {}
|
||||
~is_ () {}
|
||||
bool operator () ( T comp ) const { return val_ == comp; }
|
||||
private:
|
||||
is_ (); // need a value
|
||||
|
||||
T val_;
|
||||
};
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
|
||||
void test_none()
|
||||
{
|
||||
// Note: The literal values here are tested against directly, careful if you change them:
|
||||
int some_numbers[] = { 1, 5, 0, 18, 1 };
|
||||
std::vector<int> vi(some_numbers, some_numbers + 5);
|
||||
std::list<int> li(vi.begin(), vi.end ());
|
||||
|
||||
int some_letters[] = { 'a', 'q', 'n', 'y', 'n' };
|
||||
std::vector<char> vc(some_letters, some_letters + 5);
|
||||
|
||||
BOOST_CHECK ( ba::none_of_equal ( vi, 100 ));
|
||||
BOOST_CHECK ( ba::none_of ( vi, is_<int> ( 100 )));
|
||||
BOOST_CHECK ( ba::none_of_equal ( vi.begin(), vi.end(), 100 ));
|
||||
BOOST_CHECK ( ba::none_of ( vi.begin(), vi.end(), is_<int> ( 100 )));
|
||||
|
||||
BOOST_CHECK (!ba::none_of_equal ( vi, 1 ));
|
||||
BOOST_CHECK (!ba::none_of ( vi, is_<int> ( 1 )));
|
||||
BOOST_CHECK (!ba::none_of_equal ( vi.begin(), vi.end(), 1 ));
|
||||
BOOST_CHECK (!ba::none_of ( vi.begin(), vi.end(), is_<int> ( 1 )));
|
||||
|
||||
BOOST_CHECK ( ba::none_of_equal ( vi.end(), vi.end(), 0 ));
|
||||
BOOST_CHECK ( ba::none_of ( vi.end(), vi.end(), is_<int> ( 0 )));
|
||||
|
||||
// 5 is not in { 0, 18, 1 }, but 1 is
|
||||
BOOST_CHECK ( ba::none_of_equal ( vi.begin() + 2, vi.end(), 5 ));
|
||||
BOOST_CHECK ( ba::none_of ( vi.begin() + 2, vi.end(), is_<int> ( 5 )));
|
||||
BOOST_CHECK (!ba::none_of_equal ( vi.begin() + 2, vi.end(), 1 ));
|
||||
BOOST_CHECK (!ba::none_of ( vi.begin() + 2, vi.end(), is_<int> ( 1 )));
|
||||
|
||||
// 18 is not in { 1, 5, 0 }, but 5 is
|
||||
BOOST_CHECK ( ba::none_of_equal ( vi.begin(), vi.begin() + 3, 18 ));
|
||||
BOOST_CHECK ( ba::none_of ( vi.begin(), vi.begin() + 3, is_<int> ( 18 )));
|
||||
BOOST_CHECK (!ba::none_of_equal ( vi.begin(), vi.begin() + 3, 5 ));
|
||||
BOOST_CHECK (!ba::none_of ( vi.begin(), vi.begin() + 3, is_<int> ( 5 )));
|
||||
|
||||
BOOST_CHECK ( ba::none_of_equal ( vc, 'z' ));
|
||||
BOOST_CHECK ( ba::none_of ( vc, is_<char> ( 'z' )));
|
||||
|
||||
BOOST_CHECK (!ba::none_of_equal ( vc, 'a' ));
|
||||
BOOST_CHECK (!ba::none_of ( vc, is_<char> ( 'a' )));
|
||||
|
||||
BOOST_CHECK (!ba::none_of_equal ( vc, 'n' ));
|
||||
BOOST_CHECK (!ba::none_of ( vc, is_<char> ( 'n' )));
|
||||
|
||||
BOOST_CHECK ( ba::none_of_equal ( vi.begin(), vi.begin(), 1 ));
|
||||
BOOST_CHECK ( ba::none_of_equal ( vc.begin(), vc.begin(), 'a' ));
|
||||
BOOST_CHECK ( ba::none_of ( vi.begin(), vi.begin(), is_<int> ( 1 )));
|
||||
BOOST_CHECK ( ba::none_of ( vc.begin(), vc.begin(), is_<char> ( 'a' )));
|
||||
|
||||
BOOST_CHECK ( ba::none_of_equal ( li, 100 ));
|
||||
BOOST_CHECK ( ba::none_of ( li, is_<int> ( 100 )));
|
||||
BOOST_CHECK ( ba::none_of_equal ( li.begin(), li.end(), 100 ));
|
||||
BOOST_CHECK ( ba::none_of ( li.begin(), li.end(), is_<int> ( 100 )));
|
||||
|
||||
std::list<int>::iterator l_iter = li.begin ();
|
||||
l_iter++; l_iter++; l_iter++;
|
||||
BOOST_CHECK ( ba::none_of_equal ( li.begin(), l_iter, 18 ));
|
||||
BOOST_CHECK ( ba::none_of ( li.begin(), l_iter, is_<int> ( 18 )));
|
||||
BOOST_CHECK (!ba::none_of ( li.begin(), l_iter, is_<int> ( 5 )));
|
||||
}
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_none();
|
||||
return 0;
|
||||
}
|
||||
@@ -1,101 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2008-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/one_of.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <functional>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
template<typename T>
|
||||
struct is_ : public std::unary_function<T, bool> {
|
||||
is_ ( T v ) : val_ ( v ) {}
|
||||
~is_ () {}
|
||||
bool operator () ( T comp ) const { return val_ == comp; }
|
||||
private:
|
||||
is_ (); // need a value
|
||||
|
||||
T val_;
|
||||
};
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
|
||||
void test_one ()
|
||||
{
|
||||
// Note: The literal values here are tested against directly, careful if you change them:
|
||||
int some_numbers[] = { 1, 1, 2, 3, 5 };
|
||||
std::vector<int> vi(some_numbers, some_numbers + 5);
|
||||
std::list<int> li(vi.begin(), vi.end ());
|
||||
|
||||
int some_letters[] = { 'a', 'q', 'n', 'y', 'n' };
|
||||
std::vector<char> vc(some_letters, some_letters + 5);
|
||||
|
||||
BOOST_CHECK (!ba::one_of_equal ( vi, 1 ));
|
||||
BOOST_CHECK (!ba::one_of ( vi, is_<int> ( 1 )));
|
||||
BOOST_CHECK (!ba::one_of_equal ( vi.begin(), vi.end(), 1 ));
|
||||
BOOST_CHECK (!ba::one_of ( vi.begin(), vi.end(), is_<int> ( 1 )));
|
||||
|
||||
BOOST_CHECK (!ba::one_of_equal ( vi, 0 ));
|
||||
BOOST_CHECK (!ba::one_of ( vi, is_<int> ( 0 )));
|
||||
BOOST_CHECK (!ba::one_of_equal ( vi.begin(), vi.end(), 0 ));
|
||||
BOOST_CHECK (!ba::one_of ( vi.begin(), vi.end(), is_<int> ( 0 )));
|
||||
|
||||
BOOST_CHECK ( ba::one_of_equal ( vi, 2 ));
|
||||
BOOST_CHECK ( ba::one_of ( vi, is_<int> ( 2 )));
|
||||
BOOST_CHECK ( ba::one_of_equal ( vi.begin(), vi.end(), 2 ));
|
||||
BOOST_CHECK ( ba::one_of ( vi.begin(), vi.end(), is_<int> ( 2 )));
|
||||
|
||||
// Check for a match at the end
|
||||
BOOST_CHECK ( ba::one_of_equal ( vi, 5 ));
|
||||
BOOST_CHECK ( ba::one_of ( vi, is_<int> ( 5 )));
|
||||
BOOST_CHECK ( ba::one_of_equal ( vi.begin(), vi.end(), 5 ));
|
||||
BOOST_CHECK ( ba::one_of ( vi.begin(), vi.end(), is_<int> ( 5 )));
|
||||
|
||||
BOOST_CHECK ( ba::one_of_equal ( vi.begin() + 1, vi.end(), 1 ));
|
||||
BOOST_CHECK ( ba::one_of ( vi.begin() + 1, vi.end(), is_<int> ( 1 )));
|
||||
|
||||
BOOST_CHECK ( ba::one_of_equal ( vc.begin() + 1, vc.begin() + 2, 'q' ));
|
||||
BOOST_CHECK ( ba::one_of ( vc.begin() + 1, vc.begin() + 2, is_<char> ( 'q' )));
|
||||
|
||||
BOOST_CHECK (!ba::one_of_equal ( vc, '!' ));
|
||||
BOOST_CHECK (!ba::one_of ( vc, is_<char> ( '!' )));
|
||||
|
||||
BOOST_CHECK (!ba::one_of_equal ( vc, 'n' ));
|
||||
BOOST_CHECK (!ba::one_of ( vc, is_<char> ( 'n' )));
|
||||
|
||||
// Empty range check
|
||||
BOOST_CHECK (!ba::one_of_equal ( vi.begin(), vi.begin(), 1 ));
|
||||
BOOST_CHECK (!ba::one_of_equal ( vc.begin(), vc.begin(), 'a' ));
|
||||
BOOST_CHECK (!ba::one_of ( vi.begin(), vi.begin(), is_<int> ( 1 )));
|
||||
BOOST_CHECK (!ba::one_of ( vc.begin(), vc.begin(), is_<char> ( 'a' )));
|
||||
|
||||
BOOST_CHECK (!ba::one_of_equal ( li, 1 ));
|
||||
BOOST_CHECK (!ba::one_of ( li, is_<int> ( 1 )));
|
||||
BOOST_CHECK (!ba::one_of_equal ( li.begin(), li.end(), 1 ));
|
||||
BOOST_CHECK (!ba::one_of ( li.begin(), li.end(), is_<int> ( 1 )));
|
||||
|
||||
std::list<int>::iterator l_iter = li.begin ();
|
||||
l_iter++; l_iter++; l_iter++;
|
||||
BOOST_CHECK (!ba::one_of_equal ( li.begin(), l_iter, 1 ));
|
||||
BOOST_CHECK (!ba::one_of ( li.begin(), l_iter, is_<int> ( 1 )));
|
||||
BOOST_CHECK ( ba::one_of_equal ( li.begin(), l_iter, 2 ));
|
||||
BOOST_CHECK ( ba::one_of ( li.begin(), l_iter, is_<int> ( 2 )));
|
||||
BOOST_CHECK (!ba::one_of_equal ( li.begin(), l_iter, 3 ));
|
||||
BOOST_CHECK (!ba::one_of ( li.begin(), l_iter, is_<int> ( 3 )));
|
||||
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_one ();
|
||||
return 0;
|
||||
}
|
||||
@@ -1,154 +0,0 @@
|
||||
// Copyright (c) 2010 Nuovation System Designs, LLC
|
||||
// Grant Erickson <gerickson@nuovations.com>
|
||||
//
|
||||
// Reworked by Marshall Clow; August 2010
|
||||
//
|
||||
// Distributed under the Boost Software License, Version 1.0. (See
|
||||
// accompanying file LICENSE_1_0.txt or copy at
|
||||
// http://www.boost.org/LICENSE_1_0.txt)
|
||||
//
|
||||
// See http://www.boost.org/ for latest version.
|
||||
|
||||
#include <algorithm>
|
||||
#include <iostream>
|
||||
|
||||
#include <boost/algorithm/cxx11/is_sorted.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
using namespace boost;
|
||||
|
||||
/* Preprocessor Defines */
|
||||
|
||||
#define elementsof(v) (sizeof (v) / sizeof (v[0]))
|
||||
#define a_begin(v) (&v[0])
|
||||
#define a_end(v) (v + elementsof (v))
|
||||
#define a_range(v) v
|
||||
#define b_e(v) a_begin(v),a_end(v)
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
|
||||
static void
|
||||
test_ordered(void)
|
||||
{
|
||||
const int strictlyIncreasingValues[] = { 1, 2, 3, 4, 5 };
|
||||
const int randomValues[] = { 3, 6, 1, 2, 7 };
|
||||
const int constantValues[] = { 1, 2, 2, 2, 5 };
|
||||
int nonConstantArray[] = { 1, 2, 2, 2, 5 };
|
||||
const int inOrderUntilTheEnd [] = { 0, 1, 2, 3, 4, 5, 6, 7, 6 };
|
||||
|
||||
// Begin/end checks
|
||||
BOOST_CHECK ( ba::is_sorted (b_e(strictlyIncreasingValues)));
|
||||
BOOST_CHECK ( !ba::is_sorted (b_e(randomValues)));
|
||||
BOOST_CHECK ( ba::is_sorted (b_e(strictlyIncreasingValues), std::less<int>()));
|
||||
BOOST_CHECK ( !ba::is_sorted (b_e(strictlyIncreasingValues), std::greater<int>()));
|
||||
|
||||
// Range checks
|
||||
BOOST_CHECK ( ba::is_sorted (a_range(strictlyIncreasingValues)));
|
||||
BOOST_CHECK ( !ba::is_sorted (a_range(randomValues)));
|
||||
BOOST_CHECK ( ba::is_sorted (a_range(strictlyIncreasingValues), std::less<int>()));
|
||||
BOOST_CHECK ( !ba::is_sorted (a_range(strictlyIncreasingValues), std::greater<int>()));
|
||||
|
||||
BOOST_CHECK ( ba::is_sorted_until ( b_e(strictlyIncreasingValues)) == a_end(strictlyIncreasingValues));
|
||||
BOOST_CHECK ( ba::is_sorted_until ( b_e(strictlyIncreasingValues), std::less<int>()) == a_end(strictlyIncreasingValues));
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_range(strictlyIncreasingValues)) == boost::end(strictlyIncreasingValues));
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_range(strictlyIncreasingValues), std::less<int>()) == boost::end(strictlyIncreasingValues));
|
||||
|
||||
// Check for const and non-const arrays
|
||||
BOOST_CHECK ( ba::is_sorted_until ( b_e(constantValues), std::less<int>()) != a_end(constantValues));
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_range(constantValues), std::less<int>()) != boost::end(constantValues));
|
||||
BOOST_CHECK ( ba::is_sorted_until ( b_e(nonConstantArray), std::less<int>()) != a_end(nonConstantArray));
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_range(nonConstantArray), std::less<int>()) != boost::end(nonConstantArray));
|
||||
|
||||
BOOST_CHECK ( ba::is_sorted_until ( b_e(randomValues), std::less<int>()) == &randomValues[2] );
|
||||
BOOST_CHECK ( ba::is_sorted_until ( b_e(randomValues)) == &randomValues[2] );
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_range(randomValues), std::less<int>()) == &randomValues[2] );
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_range(randomValues)) == &randomValues[2] );
|
||||
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_range(inOrderUntilTheEnd), std::less<int>()) == &inOrderUntilTheEnd[8] );
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_range(inOrderUntilTheEnd)) == &inOrderUntilTheEnd[8] );
|
||||
|
||||
// For zero and one element collections, the comparison predicate should never be called
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_begin(randomValues), a_begin(randomValues), std::equal_to<int>()) == a_begin(randomValues));
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_begin(randomValues), a_begin(randomValues)) == a_begin(randomValues));
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_begin(randomValues), a_begin(randomValues) + 1, std::equal_to<int>()) == a_begin(randomValues) + 1);
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_begin(randomValues), a_begin(randomValues) + 1 ) == a_begin(randomValues) + 1);
|
||||
}
|
||||
|
||||
|
||||
static void
|
||||
test_increasing_decreasing(void)
|
||||
{
|
||||
const int strictlyIncreasingValues[] = { 1, 2, 3, 4, 5 };
|
||||
const int strictlyDecreasingValues[] = { 9, 8, 7, 6, 5 };
|
||||
const int increasingValues[] = { 1, 2, 2, 2, 5 };
|
||||
const int decreasingValues[] = { 9, 7, 7, 7, 5 };
|
||||
const int randomValues[] = { 3, 6, 1, 2, 7 };
|
||||
const int constantValues[] = { 7, 7, 7, 7, 7 };
|
||||
|
||||
// Test a strictly increasing sequence
|
||||
BOOST_CHECK ( ba::is_strictly_increasing (b_e(strictlyIncreasingValues)));
|
||||
BOOST_CHECK ( ba::is_increasing (b_e(strictlyIncreasingValues)));
|
||||
BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(strictlyIncreasingValues)));
|
||||
BOOST_CHECK ( !ba::is_decreasing (b_e(strictlyIncreasingValues)));
|
||||
|
||||
BOOST_CHECK ( ba::is_strictly_increasing (a_range(strictlyIncreasingValues)));
|
||||
BOOST_CHECK ( ba::is_increasing (a_range(strictlyIncreasingValues)));
|
||||
BOOST_CHECK ( !ba::is_strictly_decreasing (a_range(strictlyIncreasingValues)));
|
||||
BOOST_CHECK ( !ba::is_decreasing (a_range(strictlyIncreasingValues)));
|
||||
|
||||
// Test a strictly decreasing sequence
|
||||
BOOST_CHECK ( !ba::is_strictly_increasing (b_e(strictlyDecreasingValues)));
|
||||
BOOST_CHECK ( !ba::is_increasing (b_e(strictlyDecreasingValues)));
|
||||
BOOST_CHECK ( ba::is_strictly_decreasing (b_e(strictlyDecreasingValues)));
|
||||
BOOST_CHECK ( ba::is_decreasing (b_e(strictlyDecreasingValues)));
|
||||
|
||||
// Test an increasing sequence
|
||||
BOOST_CHECK ( !ba::is_strictly_increasing (b_e(increasingValues)));
|
||||
BOOST_CHECK ( ba::is_increasing (b_e(increasingValues)));
|
||||
BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(increasingValues)));
|
||||
BOOST_CHECK ( !ba::is_decreasing (b_e(increasingValues)));
|
||||
|
||||
// Test a decreasing sequence
|
||||
BOOST_CHECK ( !ba::is_strictly_increasing (b_e(decreasingValues)));
|
||||
BOOST_CHECK ( !ba::is_increasing (b_e(decreasingValues)));
|
||||
BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(decreasingValues)));
|
||||
BOOST_CHECK ( ba::is_decreasing (b_e(decreasingValues)));
|
||||
|
||||
// Test a random sequence
|
||||
BOOST_CHECK ( !ba::is_strictly_increasing (b_e(randomValues)));
|
||||
BOOST_CHECK ( !ba::is_increasing (b_e(randomValues)));
|
||||
BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(randomValues)));
|
||||
BOOST_CHECK ( !ba::is_decreasing (b_e(randomValues)));
|
||||
|
||||
// Test a constant sequence
|
||||
BOOST_CHECK ( !ba::is_strictly_increasing (b_e(constantValues)));
|
||||
BOOST_CHECK ( ba::is_increasing (b_e(constantValues)));
|
||||
BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(constantValues)));
|
||||
BOOST_CHECK ( ba::is_decreasing (b_e(constantValues)));
|
||||
|
||||
// Test an empty sequence
|
||||
BOOST_CHECK ( ba::is_strictly_increasing (strictlyIncreasingValues, strictlyIncreasingValues));
|
||||
BOOST_CHECK ( ba::is_increasing (strictlyIncreasingValues, strictlyIncreasingValues));
|
||||
BOOST_CHECK ( ba::is_strictly_decreasing (strictlyIncreasingValues, strictlyIncreasingValues));
|
||||
BOOST_CHECK ( ba::is_decreasing (strictlyIncreasingValues, strictlyIncreasingValues));
|
||||
|
||||
// Test a one-element sequence
|
||||
BOOST_CHECK ( ba::is_strictly_increasing (strictlyIncreasingValues, strictlyIncreasingValues+1));
|
||||
BOOST_CHECK ( ba::is_increasing (strictlyIncreasingValues, strictlyIncreasingValues+1));
|
||||
BOOST_CHECK ( ba::is_strictly_decreasing (strictlyIncreasingValues, strictlyIncreasingValues+1));
|
||||
BOOST_CHECK ( ba::is_decreasing (strictlyIncreasingValues, strictlyIncreasingValues+1));
|
||||
|
||||
// Test a two-element sequence
|
||||
BOOST_CHECK ( ba::is_strictly_increasing (strictlyIncreasingValues, strictlyIncreasingValues+2));
|
||||
BOOST_CHECK ( ba::is_increasing (strictlyIncreasingValues, strictlyIncreasingValues+2));
|
||||
BOOST_CHECK ( !ba::is_strictly_decreasing (strictlyIncreasingValues, strictlyIncreasingValues+2));
|
||||
BOOST_CHECK ( !ba::is_decreasing (strictlyIncreasingValues, strictlyIncreasingValues+2));
|
||||
|
||||
}
|
||||
|
||||
int test_main( int, char * [] )
|
||||
{
|
||||
test_ordered ();
|
||||
test_increasing_decreasing ();
|
||||
return 0;
|
||||
}
|
||||
@@ -1,87 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <iostream>
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/partition_copy.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <boost/algorithm/cxx11/all_of.hpp>
|
||||
#include <boost/algorithm/cxx11/none_of.hpp>
|
||||
#include <string>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
// namespace ba = boost;
|
||||
|
||||
template <typename Container, typename Predicate>
|
||||
void test_sequence ( const Container &c, Predicate comp ) {
|
||||
std::vector<typename Container::value_type> v1, v2;
|
||||
|
||||
v1.clear (); v2.clear ();
|
||||
ba::partition_copy ( c.begin (), c.end (),
|
||||
std::back_inserter (v1), std::back_inserter (v2), comp );
|
||||
// std::cout << "Sizes(1): " << c.size () << " -> { " << v1.size () << ", " << v2.size () << " }" << std::endl;
|
||||
BOOST_CHECK ( v1.size () + v2.size () == c.size ());
|
||||
BOOST_CHECK ( ba::all_of ( v1.begin (), v1.end (), comp ));
|
||||
BOOST_CHECK ( ba::none_of ( v2.begin (), v2.end (), comp ));
|
||||
|
||||
v1.clear (); v2.clear ();
|
||||
ba::partition_copy ( c, std::back_inserter (v1), std::back_inserter ( v2 ), comp );
|
||||
// std::cout << "Sizes(2): " << c.size () << " -> { " << v1.size () << ", " << v2.size () << " }" << std::endl;
|
||||
BOOST_CHECK ( v1.size () + v2.size () == c.size ());
|
||||
BOOST_CHECK ( ba::all_of ( v1, comp ));
|
||||
BOOST_CHECK ( ba::none_of ( v2, comp ));
|
||||
}
|
||||
|
||||
template <typename T>
|
||||
struct less_than {
|
||||
public:
|
||||
less_than ( T foo ) : val ( foo ) {}
|
||||
less_than ( const less_than &rhs ) : val ( rhs.val ) {}
|
||||
|
||||
bool operator () ( const T &v ) const { return v < val; }
|
||||
private:
|
||||
less_than ();
|
||||
less_than operator = ( const less_than &rhs );
|
||||
T val;
|
||||
};
|
||||
|
||||
bool is_even ( int v ) { return v % 2 == 0; }
|
||||
|
||||
void test_sequence1 () {
|
||||
std::vector<int> v;
|
||||
|
||||
v.clear ();
|
||||
for ( int i = 5; i < 15; ++i )
|
||||
v.push_back ( i );
|
||||
test_sequence ( v, less_than<int>(3)); // no elements
|
||||
test_sequence ( v, less_than<int>(6)); // only the first element
|
||||
test_sequence ( v, less_than<int>(10));
|
||||
test_sequence ( v, less_than<int>(99)); // all elements satisfy
|
||||
|
||||
// With bidirectional iterators.
|
||||
std::list<int> l;
|
||||
for ( int i = 5; i < 16; ++i )
|
||||
l.push_back ( i );
|
||||
test_sequence ( l, less_than<int>(3)); // no elements
|
||||
test_sequence ( l, less_than<int>(6)); // only the first element
|
||||
test_sequence ( l, less_than<int>(10));
|
||||
test_sequence ( l, less_than<int>(99)); // all elements satisfy
|
||||
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_sequence1 ();
|
||||
return 0;
|
||||
}
|
||||
@@ -1,98 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <iostream>
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/partition_point.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <string>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
// namespace ba = boost;
|
||||
|
||||
template <typename Container>
|
||||
typename Container::iterator offset_to_iter ( Container &v, int offset ) {
|
||||
typename Container::iterator retval;
|
||||
|
||||
if ( offset >= 0 ) {
|
||||
retval = v.begin ();
|
||||
std::advance ( retval, offset );
|
||||
}
|
||||
else {
|
||||
retval = v.end ();
|
||||
std::advance ( retval, offset + 1 );
|
||||
}
|
||||
return retval;
|
||||
}
|
||||
|
||||
template <typename Container, typename Predicate>
|
||||
void test_sequence ( Container &v, Predicate comp, int expected ) {
|
||||
typename Container::iterator res, exp;
|
||||
|
||||
res = ba::partition_point ( v.begin (), v.end (), comp );
|
||||
exp = offset_to_iter ( v, expected );
|
||||
std::cout << "Expected(1): " << std::distance ( v.begin (), exp )
|
||||
<< ", got: " << std::distance ( v.begin (), res ) << std::endl;
|
||||
BOOST_CHECK ( exp == res );
|
||||
|
||||
// Duplicate the last element; this checks for any even/odd problems
|
||||
v.push_back ( * v.rbegin ());
|
||||
res = ba::partition_point ( v.begin (), v.end (), comp );
|
||||
exp = offset_to_iter ( v, expected );
|
||||
std::cout << "Expected(2): " << std::distance ( v.begin (), exp )
|
||||
<< ", got: " << std::distance ( v.begin (), res ) << std::endl;
|
||||
BOOST_CHECK ( exp == res );
|
||||
}
|
||||
|
||||
template <typename T>
|
||||
struct less_than {
|
||||
public:
|
||||
less_than ( T foo ) : val ( foo ) {}
|
||||
less_than ( const less_than &rhs ) : val ( rhs.val ) {}
|
||||
|
||||
bool operator () ( const T &v ) const { return v < val; }
|
||||
private:
|
||||
less_than ();
|
||||
less_than operator = ( const less_than &rhs );
|
||||
T val;
|
||||
};
|
||||
|
||||
|
||||
void test_sequence1 () {
|
||||
std::vector<int> v;
|
||||
|
||||
v.clear ();
|
||||
for ( int i = 5; i < 15; ++i )
|
||||
v.push_back ( i );
|
||||
test_sequence ( v, less_than<int>(3), 0 ); // no elements
|
||||
test_sequence ( v, less_than<int>(6), 1 ); // only the first element
|
||||
test_sequence ( v, less_than<int>(10), 5 );
|
||||
test_sequence ( v, less_than<int>(99), -1 ); // all elements satisfy
|
||||
|
||||
// With bidirectional iterators.
|
||||
std::list<int> l;
|
||||
for ( int i = 5; i < 15; ++i )
|
||||
l.push_back ( i );
|
||||
test_sequence ( l, less_than<int>(3), 0 ); // no elements
|
||||
test_sequence ( l, less_than<int>(6), 1 ); // only the first element
|
||||
test_sequence ( l, less_than<int>(10), 5 );
|
||||
test_sequence ( l, less_than<int>(99), -1 ); // all elements satisfy
|
||||
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_sequence1 ();
|
||||
return 0;
|
||||
}
|
||||
@@ -1,26 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <vector>
|
||||
#include <boost/algorithm/searching/boyer_moore.hpp>
|
||||
|
||||
int main( int argc, char *argv [] )
|
||||
{
|
||||
std::vector<char> cv;
|
||||
std::vector<int> iv;
|
||||
|
||||
// Should fail to compile because the underlying types are different
|
||||
// They are (almost certainly) different sizes
|
||||
(void) boost::algorithm::boyer_moore_search (
|
||||
cv.begin (), cv.end (), iv.begin (), iv.end ());
|
||||
|
||||
|
||||
(void) argv; (void) argc;
|
||||
return 0;
|
||||
}
|
||||
@@ -1,27 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <vector>
|
||||
#include <boost/cstdint.hpp>
|
||||
#include <boost/algorithm/searching/boyer_moore.hpp>
|
||||
|
||||
int main( int argc, char *argv [] )
|
||||
{
|
||||
std::vector<boost::uint8_t> cv;
|
||||
std::vector<boost:: int8_t> iv;
|
||||
|
||||
// Should fail to compile because the underlying types are different
|
||||
// They are the same size, but one is signed, and the other is not.
|
||||
(void) boost::algorithm::boyer_moore_search (
|
||||
cv.begin (), cv.end (), iv.begin (), iv.end ());
|
||||
|
||||
|
||||
(void) argv; (void) argc;
|
||||
return 0;
|
||||
}
|
||||
@@ -1,20 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <vector>
|
||||
#include <boost/algorithm/searching/boyer_moore.hpp>
|
||||
|
||||
int main( int argc, char *argv [] )
|
||||
{
|
||||
// Should fail to compile because the search objects are not default-constructible
|
||||
boost::algorithm::boyer_moore<std::vector<char>::iterator> bm;
|
||||
|
||||
(void) argv; (void) argc;
|
||||
return 0;
|
||||
}
|
||||
@@ -1,272 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/algorithm/searching/boyer_moore.hpp>
|
||||
#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
|
||||
#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
|
||||
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <iostream>
|
||||
#include <string>
|
||||
#include <vector>
|
||||
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
|
||||
template <typename Iter>
|
||||
std::string make_str ( Iter first, std::size_t len ) {
|
||||
std::string retVal ( len + 2, '\'' );
|
||||
std::copy ( first, first+len, retVal.begin () + 1);
|
||||
return retVal;
|
||||
}
|
||||
|
||||
namespace {
|
||||
|
||||
// Check using iterators
|
||||
template<typename Container>
|
||||
void check_one_iter ( const Container &haystack, const std::string &needle, int expected ) {
|
||||
typedef typename Container::const_iterator iter_type;
|
||||
typedef std::string::const_iterator pattern_type;
|
||||
|
||||
iter_type hBeg = haystack.begin ();
|
||||
iter_type hEnd = haystack.end ();
|
||||
pattern_type nBeg = needle.begin ();
|
||||
pattern_type nEnd = needle.end ();
|
||||
|
||||
iter_type it0 = std::search (hBeg, hEnd, nBeg, nEnd);
|
||||
iter_type it1 = ba::boyer_moore_search (hBeg, hEnd, nBeg, nEnd);
|
||||
iter_type it1r = ba::boyer_moore_search (haystack, nBeg, nEnd);
|
||||
iter_type it2 = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd);
|
||||
iter_type it3 = ba::knuth_morris_pratt_search (hBeg, hEnd, nBeg, nEnd);
|
||||
const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
|
||||
|
||||
std::cout << "(Iterators) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
|
||||
try {
|
||||
if ( it0 != it1 ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between std::search and boyer-moore search" ));
|
||||
}
|
||||
|
||||
if ( it1 != it1r ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between iterator and range boyer_moore search" ));
|
||||
}
|
||||
|
||||
if ( it1 != it2 ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
|
||||
}
|
||||
|
||||
if ( it1 != it3 )
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
|
||||
|
||||
}
|
||||
|
||||
catch ( ... ) {
|
||||
std::cout << "Searching for: " << needle << std::endl;
|
||||
std::cout << "Expected: " << expected << "\n";
|
||||
std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n";
|
||||
std::cout << " bm: " << std::distance ( hBeg, it1 ) << "\n";
|
||||
std::cout << " bm(r): " << std::distance ( hBeg, it1r ) << "\n";
|
||||
std::cout << " bmh: " << std::distance ( hBeg, it2 ) << "\n";
|
||||
std::cout << " kpm: " << std::distance ( hBeg, it3 )<< "\n";
|
||||
std::cout << std::flush;
|
||||
throw ;
|
||||
}
|
||||
|
||||
BOOST_CHECK_EQUAL ( dist, expected );
|
||||
}
|
||||
|
||||
// Check using pointers
|
||||
// We're assuming that the container implements contiguous storage here.
|
||||
template<typename Container>
|
||||
void check_one_pointer ( const Container &haystack, const std::string &needle, int expected ) {
|
||||
typedef const typename Container::value_type *ptr_type;
|
||||
ptr_type hBeg = haystack.size () == 0 ? NULL : &*haystack.begin ();
|
||||
ptr_type hEnd = hBeg + haystack.size ();
|
||||
ptr_type nBeg = needle.size () == 0 ? NULL : &*needle.begin ();
|
||||
ptr_type nEnd = nBeg + needle.size ();
|
||||
|
||||
ptr_type it0 = std::search (hBeg, hEnd, nBeg, nEnd);
|
||||
ptr_type it1 = ba::boyer_moore_search (hBeg, hEnd, nBeg, nEnd);
|
||||
ptr_type it2 = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd);
|
||||
ptr_type it3 = ba::knuth_morris_pratt_search (hBeg, hEnd, nBeg, nEnd);
|
||||
const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
|
||||
|
||||
std::cout << "(Pointers) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
|
||||
try {
|
||||
if ( it0 != it1 ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between std::search and boyer-moore search" ));
|
||||
}
|
||||
|
||||
if ( it1 != it2 ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
|
||||
}
|
||||
|
||||
if ( it1 != it3 )
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
|
||||
|
||||
}
|
||||
|
||||
catch ( ... ) {
|
||||
std::cout << "Searching for: " << needle << std::endl;
|
||||
std::cout << "Expected: " << expected << "\n";
|
||||
std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n";
|
||||
std::cout << " bm: " << std::distance ( hBeg, it1 ) << "\n";
|
||||
std::cout << " bmh: " << std::distance ( hBeg, it2 ) << "\n";
|
||||
std::cout << " kpm: " << std::distance ( hBeg, it3 )<< "\n";
|
||||
std::cout << std::flush;
|
||||
throw ;
|
||||
}
|
||||
|
||||
BOOST_CHECK_EQUAL ( dist, expected );
|
||||
}
|
||||
|
||||
// Check using objects
|
||||
template<typename Container>
|
||||
void check_one_object ( const Container &haystack, const std::string &needle, int expected ) {
|
||||
typedef typename Container::const_iterator iter_type;
|
||||
typedef std::string::const_iterator pattern_type;
|
||||
|
||||
iter_type hBeg = haystack.begin ();
|
||||
iter_type hEnd = haystack.end ();
|
||||
pattern_type nBeg = needle.begin ();
|
||||
pattern_type nEnd = needle.end ();
|
||||
|
||||
ba::boyer_moore<pattern_type> bm_r = ba::make_boyer_moore ( needle );
|
||||
ba::boyer_moore<pattern_type> bm ( nBeg, nEnd );
|
||||
ba::boyer_moore_horspool<pattern_type> bmh ( nBeg, nEnd );
|
||||
ba::knuth_morris_pratt<pattern_type> kmp ( nBeg, nEnd );
|
||||
|
||||
iter_type it0 = std::search (hBeg, hEnd, nBeg, nEnd);
|
||||
iter_type it1 = bm (hBeg, hEnd);
|
||||
iter_type it1r = bm (haystack);
|
||||
iter_type rt1 = bm_r (hBeg, hEnd);
|
||||
iter_type rt1r = bm_r (haystack);
|
||||
iter_type it2 = bmh (hBeg, hEnd);
|
||||
iter_type it3 = kmp (hBeg, hEnd);
|
||||
const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
|
||||
|
||||
std::cout << "(Objects) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
|
||||
try {
|
||||
if ( it0 != it1 ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between std::search and boyer-moore search" ));
|
||||
}
|
||||
|
||||
if ( it1 != it1r ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between iterator and range boyer_moore search(1)" ));
|
||||
}
|
||||
|
||||
if ( it1 != rt1 ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between iterator and range boyer_moore search(2)" ));
|
||||
}
|
||||
|
||||
if ( rt1 != rt1r ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between iterator and range boyer_moore search(3)" ));
|
||||
}
|
||||
|
||||
if ( it1 != it2 ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
|
||||
}
|
||||
|
||||
if ( it1 != it3 )
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
|
||||
|
||||
}
|
||||
|
||||
catch ( ... ) {
|
||||
std::cout << "Searching for: " << needle << std::endl;
|
||||
std::cout << "Expected: " << expected << "\n";
|
||||
std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n";
|
||||
std::cout << " bm: " << std::distance ( hBeg, it1 ) << "\n";
|
||||
std::cout << " bm(r1): " << std::distance ( hBeg, it1r ) << "\n";
|
||||
std::cout << " bm(r2): " << std::distance ( hBeg, rt1 ) << "\n";
|
||||
std::cout << " bm(r3): " << std::distance ( hBeg, rt1r ) << "\n";
|
||||
std::cout << " bmh: " << std::distance ( hBeg, it2 ) << "\n";
|
||||
std::cout << " kpm: " << std::distance ( hBeg, it3 )<< "\n";
|
||||
std::cout << std::flush;
|
||||
throw ;
|
||||
}
|
||||
|
||||
BOOST_CHECK_EQUAL ( dist, expected );
|
||||
}
|
||||
|
||||
|
||||
template<typename Container>
|
||||
void check_one ( const Container &haystack, const std::string &needle, int expected ) {
|
||||
check_one_iter ( haystack, needle, expected );
|
||||
check_one_pointer ( haystack, needle, expected );
|
||||
check_one_object ( haystack, needle, expected );
|
||||
}
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
std::string haystack1 ( "NOW AN FOWE\220ER ANNMAN THE ANPANMANEND" );
|
||||
std::string needle1 ( "ANPANMAN" );
|
||||
std::string needle2 ( "MAN THE" );
|
||||
std::string needle3 ( "WE\220ER" );
|
||||
std::string needle4 ( "NOW " ); // At the beginning
|
||||
std::string needle5 ( "NEND" ); // At the end
|
||||
std::string needle6 ( "NOT FOUND" ); // Nowhere
|
||||
std::string needle7 ( "NOT FO\340ND" ); // Nowhere
|
||||
|
||||
std::string haystack2 ( "ABC ABCDAB ABCDABCDABDE" );
|
||||
std::string needle11 ( "ABCDABD" );
|
||||
|
||||
std::string haystack3 ( "abra abracad abracadabra" );
|
||||
std::string needle12 ( "abracadabra" );
|
||||
|
||||
std::string needle13 ( "" );
|
||||
std::string haystack4 ( "" );
|
||||
|
||||
check_one ( haystack1, needle1, 26 );
|
||||
check_one ( haystack1, needle2, 18 );
|
||||
check_one ( haystack1, needle3, 9 );
|
||||
check_one ( haystack1, needle4, 0 );
|
||||
check_one ( haystack1, needle5, 33 );
|
||||
check_one ( haystack1, needle6, -1 );
|
||||
check_one ( haystack1, needle7, -1 );
|
||||
|
||||
check_one ( needle1, haystack1, -1 ); // cant find long pattern in short corpus
|
||||
check_one ( haystack1, haystack1, 0 ); // find something in itself
|
||||
check_one ( haystack2, haystack2, 0 ); // find something in itself
|
||||
|
||||
check_one ( haystack2, needle11, 15 );
|
||||
check_one ( haystack3, needle12, 13 );
|
||||
|
||||
check_one ( haystack1, needle13, 0 ); // find the empty string
|
||||
check_one ( haystack4, needle1, -1 ); // can't find in an empty haystack
|
||||
|
||||
// Mikhail Levin <svarneticist@gmail.com> found a problem, and this was the test
|
||||
// that triggered it.
|
||||
|
||||
const std::string mikhail_pattern =
|
||||
"GATACACCTACCTTCACCAGTTACTCTATGCACTAGGTGCGCCAGGCCCATGCACAAGGGCTTGAGTGGATGGGAAGGA"
|
||||
"TGTGCCCTAGTGATGGCAGCATAAGCTACGCAGAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACATCCACGAG"
|
||||
"CACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCCATGTATTACTGTGGGAGAGATGTCTGGAGTGGT"
|
||||
"TATTATTGCCCCGGTAATATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACG"
|
||||
;
|
||||
const std::string mikhail_corpus = std::string (8, 'a') + mikhail_pattern;
|
||||
|
||||
check_one ( mikhail_corpus, mikhail_pattern, 8 );
|
||||
return 0;
|
||||
}
|
||||
@@ -1,145 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/algorithm/searching/boyer_moore.hpp>
|
||||
#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
|
||||
#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
|
||||
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <iostream>
|
||||
#include <algorithm>
|
||||
#include <vector>
|
||||
|
||||
typedef std::vector<char> vec;
|
||||
#define NUM_TRIES 100
|
||||
|
||||
#define runOne(call, refDiff) { \
|
||||
std::clock_t bTime, eTime; \
|
||||
bTime = std::clock (); \
|
||||
for ( i = 0; i < NUM_TRIES; ++i ) { \
|
||||
res = boost::algorithm::call \
|
||||
( haystack.begin (), haystack.end (), \
|
||||
needle.begin (), needle.end ()); \
|
||||
if ( res != exp ) { \
|
||||
std::cout << "On run # " << i << " expected " \
|
||||
<< exp - haystack.begin () << " got " \
|
||||
<< res - haystack.begin () << std::endl; \
|
||||
throw std::runtime_error \
|
||||
( "Unexpected result from " #call ); \
|
||||
} \
|
||||
} \
|
||||
eTime = std::clock (); \
|
||||
printRes ( #call, eTime - bTime, refDiff ); }
|
||||
|
||||
#define runObject(obj, refDiff) { \
|
||||
std::clock_t bTime, eTime; \
|
||||
bTime = std::clock (); \
|
||||
boost::algorithm::obj <vec::const_iterator> \
|
||||
s_o ( needle.begin (), needle.end ()); \
|
||||
for ( i = 0; i < NUM_TRIES; ++i ) { \
|
||||
res = s_o ( haystack.begin (), haystack.end ()); \
|
||||
if ( res != exp ) { \
|
||||
std::cout << "On run # " << i << " expected " \
|
||||
<< exp - haystack.begin () << " got " \
|
||||
<< res - haystack.begin () << std::endl; \
|
||||
throw std::runtime_error \
|
||||
( "Unexpected result from " #obj " object" ); \
|
||||
} \
|
||||
} \
|
||||
eTime = std::clock (); \
|
||||
printRes ( #obj " object", eTime - bTime, refDiff ); }
|
||||
|
||||
|
||||
|
||||
namespace {
|
||||
|
||||
vec ReadFromFile ( const char *name ) {
|
||||
std::ifstream in ( name, std::ios_base::binary | std::ios_base::in );
|
||||
vec retVal;
|
||||
std::istream_iterator<char, char> begin(in);
|
||||
std::istream_iterator<char, char> end;
|
||||
|
||||
std::copy ( begin, end, std::back_inserter ( retVal ));
|
||||
return retVal;
|
||||
}
|
||||
|
||||
void printRes ( const char *prompt, unsigned long diff, unsigned long stdDiff ) {
|
||||
std::cout
|
||||
<< std::setw(34) << prompt << " "
|
||||
<< std::setw(6) << ( 1.0 * diff) / CLOCKS_PER_SEC << " seconds\t"
|
||||
<< std::setw(5) << (100.0 * diff) / stdDiff << "% \t"
|
||||
<< std::setw(12) << diff;
|
||||
if ( diff > stdDiff )
|
||||
std::cout << " !!";
|
||||
std::cout << std::endl;
|
||||
}
|
||||
|
||||
void check_one ( const vec &haystack, const vec &needle, int expected ) {
|
||||
std::size_t i;
|
||||
std::clock_t sTime;
|
||||
unsigned long stdDiff;
|
||||
|
||||
vec::const_iterator res;
|
||||
vec::const_iterator exp; // the expected result
|
||||
|
||||
if ( expected >= 0 )
|
||||
exp = haystack.begin () + expected;
|
||||
else if ( expected == -1 )
|
||||
exp = haystack.end (); // we didn't find it!
|
||||
else if ( expected == -2 )
|
||||
exp = std::search ( haystack.begin (), haystack.end (), needle.begin (), needle.end ());
|
||||
else
|
||||
throw std::logic_error ( "Expected must be -2, -1, or >= 0" );
|
||||
|
||||
std::cout << "Pattern is " << needle.size () << " entries long" << std::endl;
|
||||
std::cout << "Corpus is " << haystack.size () << " entries long" << std::endl;
|
||||
|
||||
// First, the std library search
|
||||
sTime = std::clock ();
|
||||
for ( i = 0; i < NUM_TRIES; ++i ) {
|
||||
res = std::search ( haystack.begin (), haystack.end (), needle.begin (), needle.end ());
|
||||
if ( res != exp ) {
|
||||
std::cout << "On run # " << i << " expected " << exp - haystack.begin () << " got " << res - haystack.begin () << std::endl;
|
||||
throw std::runtime_error ( "Unexpected result from std::search" );
|
||||
}
|
||||
}
|
||||
stdDiff = std::clock () - sTime;
|
||||
printRes ( "std::search", stdDiff, stdDiff );
|
||||
|
||||
runOne ( boyer_moore_search, stdDiff );
|
||||
runObject ( boyer_moore, stdDiff );
|
||||
runOne ( boyer_moore_horspool_search, stdDiff );
|
||||
runObject ( boyer_moore_horspool, stdDiff );
|
||||
runOne ( knuth_morris_pratt_search, stdDiff );
|
||||
runObject ( knuth_morris_pratt, stdDiff );
|
||||
}
|
||||
}
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
vec c1 = ReadFromFile ( "search_test_data/0001.corpus" );
|
||||
vec p1b = ReadFromFile ( "search_test_data/0001b.pat" );
|
||||
vec p1e = ReadFromFile ( "search_test_data/0001e.pat" );
|
||||
vec p1n = ReadFromFile ( "search_test_data/0001n.pat" );
|
||||
vec p1f = ReadFromFile ( "search_test_data/0001f.pat" );
|
||||
|
||||
std::cout << std::ios::fixed << std::setprecision(4);
|
||||
// std::cout << "Corpus is " << c1.size () << " entries long\n";
|
||||
std::cout << "--- Beginning ---" << std::endl;
|
||||
check_one ( c1, p1b, 0 ); // Find it at position zero
|
||||
std::cout << "---- Middle -----" << std::endl;
|
||||
check_one ( c1, p1f, -2 ); // Don't know answer
|
||||
std::cout << "------ End ------" << std::endl;
|
||||
check_one ( c1, p1e, c1.size() - p1e.size ());
|
||||
std::cout << "--- Not found ---" << std::endl;
|
||||
check_one ( c1, p1n, -1 ); // Not found
|
||||
|
||||
return 0;
|
||||
}
|
||||
@@ -1,145 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/algorithm/searching/boyer_moore.hpp>
|
||||
#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
|
||||
#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
|
||||
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <iostream>
|
||||
#include <algorithm>
|
||||
#include <vector>
|
||||
#include <string>
|
||||
|
||||
typedef std::vector<std::string> vec;
|
||||
#define NUM_TRIES 100
|
||||
|
||||
#define runOne(call, refDiff) { \
|
||||
std::clock_t bTime, eTime; \
|
||||
bTime = std::clock (); \
|
||||
for ( i = 0; i < NUM_TRIES; ++i ) { \
|
||||
res = boost::algorithm::call \
|
||||
( haystack.begin (), haystack.end (), \
|
||||
needle.begin (), needle.end ()); \
|
||||
if ( res != exp ) { \
|
||||
std::cout << "On run # " << i << " expected " \
|
||||
<< exp - haystack.begin () << " got " \
|
||||
<< res - haystack.begin () << std::endl; \
|
||||
throw std::runtime_error \
|
||||
( "Unexpected result from " #call ); \
|
||||
} \
|
||||
} \
|
||||
eTime = std::clock (); \
|
||||
printRes ( #call, eTime - bTime, refDiff ); }
|
||||
|
||||
#define runObject(obj, refDiff) { \
|
||||
std::clock_t bTime, eTime; \
|
||||
bTime = std::clock (); \
|
||||
boost::algorithm::obj <vec::const_iterator> \
|
||||
s_o ( needle.begin (), needle.end ()); \
|
||||
for ( i = 0; i < NUM_TRIES; ++i ) { \
|
||||
res = s_o ( haystack.begin (), haystack.end ()); \
|
||||
if ( res != exp ) { \
|
||||
std::cout << "On run # " << i << " expected " \
|
||||
<< exp - haystack.begin () << " got " \
|
||||
<< res - haystack.begin () << std::endl; \
|
||||
throw std::runtime_error \
|
||||
( "Unexpected result from " #obj " object" ); \
|
||||
} \
|
||||
} \
|
||||
eTime = std::clock (); \
|
||||
printRes ( #obj " object", eTime - bTime, refDiff ); }
|
||||
|
||||
|
||||
namespace {
|
||||
|
||||
vec ReadFromFile ( const char *name ) {
|
||||
std::ifstream in ( name, std::ios_base::binary | std::ios_base::in );
|
||||
std::string temp;
|
||||
vec retVal;
|
||||
while ( std::getline ( in, temp ))
|
||||
retVal.push_back ( temp );
|
||||
|
||||
return retVal;
|
||||
}
|
||||
|
||||
void printRes ( const char *prompt, unsigned long diff, unsigned long stdDiff ) {
|
||||
std::cout
|
||||
<< std::setw(34) << prompt << " "
|
||||
<< std::setw(6) << ( 1.0 * diff) / CLOCKS_PER_SEC << " seconds\t"
|
||||
<< std::setw(5) << (100.0 * diff) / stdDiff << "% \t"
|
||||
<< std::setw(12) << diff;
|
||||
if ( diff > stdDiff )
|
||||
std::cout << " !!";
|
||||
std::cout << std::endl;
|
||||
}
|
||||
|
||||
void check_one ( const vec &haystack, const vec &needle, int expected ) {
|
||||
std::size_t i;
|
||||
std::clock_t sTime;
|
||||
unsigned long stdDiff;
|
||||
|
||||
vec::const_iterator res;
|
||||
vec::const_iterator exp; // the expected result
|
||||
|
||||
if ( expected >= 0 )
|
||||
exp = haystack.begin () + expected;
|
||||
else if ( expected == -1 )
|
||||
exp = haystack.end (); // we didn't find it1
|
||||
else if ( expected == -2 )
|
||||
exp = std::search ( haystack.begin (), haystack.end (), needle.begin (), needle.end ());
|
||||
else
|
||||
throw std::logic_error ( "Expected must be -2, -1, or >= 0" );
|
||||
|
||||
std::cout << "Pattern is " << needle.size () << " entries long" << std::endl;
|
||||
std::cout << "Corpus is " << haystack.size () << " entries long" << std::endl;
|
||||
|
||||
// First, the std library search
|
||||
sTime = std::clock ();
|
||||
for ( i = 0; i < NUM_TRIES; ++i ) {
|
||||
res = std::search ( haystack.begin (), haystack.end (), needle.begin (), needle.end ());
|
||||
if ( res != exp ) {
|
||||
std::cout << "On run # " << i << " expected " << exp - haystack.begin () << " got " << res - haystack.begin () << std::endl;
|
||||
throw std::runtime_error ( "Unexpected result from std::search" );
|
||||
}
|
||||
}
|
||||
stdDiff = std::clock () - sTime;
|
||||
printRes ( "std::search", stdDiff, stdDiff );
|
||||
|
||||
runOne ( boyer_moore_search, stdDiff );
|
||||
runObject ( boyer_moore, stdDiff );
|
||||
runOne ( boyer_moore_horspool_search, stdDiff );
|
||||
runObject ( boyer_moore_horspool, stdDiff );
|
||||
runOne ( knuth_morris_pratt_search, stdDiff );
|
||||
runObject ( knuth_morris_pratt, stdDiff );
|
||||
}
|
||||
}
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
vec c1 = ReadFromFile ( "search_test_data/0001.corpus" );
|
||||
vec p1b = ReadFromFile ( "search_test_data/0002b.pat" );
|
||||
vec p1e = ReadFromFile ( "search_test_data/0002e.pat" );
|
||||
vec p1n = ReadFromFile ( "search_test_data/0002n.pat" );
|
||||
vec p1f = ReadFromFile ( "search_test_data/0002f.pat" );
|
||||
|
||||
std::cout << std::ios::fixed << std::setprecision(4);
|
||||
// std::cout << "Corpus is " << c1.size () << " entries long\n";
|
||||
std::cout << "--- Beginning ---" << std::endl;
|
||||
check_one ( c1, p1b, 0 ); // Find it at position zero
|
||||
std::cout << "---- Middle -----" << std::endl;
|
||||
check_one ( c1, p1f, -2 ); // Don't know answer
|
||||
std::cout << "------ End ------" << std::endl;
|
||||
check_one ( c1, p1e, c1.size() - p1e.size ());
|
||||
std::cout << "--- Not found ---" << std::endl;
|
||||
check_one ( c1, p1n, -1 ); // Not found
|
||||
|
||||
return 0;
|
||||
}
|
||||
File diff suppressed because it is too large
Load Diff
@@ -1,2 +0,0 @@
|
||||
TU0AKgAfhPqScHN4dnZ2e3p5e3h7eXl4dnd1dnV3enp5dnd3dHV1dHNzd3l3eHh5
|
||||
eXZ4dXd2dHNwcHFwcXBxc3h0dHN1eHVzcXV1dXV2c3h5dHV3eHVwcHF
|
||||
@@ -1,2 +0,0 @@
|
||||
iBJbmMuLCBhbGwg
|
||||
cmlnaHRzIHJlc2VydmVkLgAAAAA=
|
||||
@@ -1,2 +0,0 @@
|
||||
q/y9PZ3uHj5ufo6UJDQ0NFQz8+RUZBQEBAOzo6Ozs4Nz06Ojs4Ojo9PT47Ojk0
|
||||
Nzc7OjQ6NzU6OjgxMzg1OjY2NjU3NTU1Nzc3NTU1NzU
|
||||
@@ -1,2 +0,0 @@
|
||||
TIzMjIyMjM0MjM1nTQzNTc3MzY1NDU2NzQ2MjEwMjU1MTQ2NzU0NDI1
|
||||
NDMyMzQxMzQ0NDU1MjU2NTc5NzU1NDc4ODY1
|
||||
@@ -1,170 +0,0 @@
|
||||
TU0AKgAfhPqScHN4dnZ2e3p5e3h7eXl4dnd1dnV3enp5dnd3dHV1dHNzd3l3eHh5
|
||||
eXZ4dXd2dHNwcHFwcXBxc3h0dHN1eHVzcXV1dXV2c3h5dHV3eHVwcHF1d3V0dXJy
|
||||
cXNzcHBwcHJyc3R0dXl7eHJycnF1dHV2d3h4eHV0cnRycXN1dXN0c3R0c3R0cXJx
|
||||
cHNxb3B0c29scHFybm9sbGpscXJ1c3NycXN0cHFvb3JzdHBycG9vb29vb29ubXBt
|
||||
bG9vcW5tbGptb3Fwb3Bwb25vbXFtbGtvbGlrbnBuamxsbW1rbW1vbm1ub3Btamxw
|
||||
bWpsbG9xcG5ua2tpamhqZ2hnam5saWhsbG1nZmZnZ2lnamtxa2ppZWZmZWlrZ2hp
|
||||
Z2hraWRmZ2psa2pmZWVkZmplZWZiYF1gZGVlYmJiY2RhY2NiYVxdW1xgXl9iZV9d
|
||||
X11hXF5gZWJhYF5dXWFmYl9hXl5gXmBhZGFhYV1cYWFiX2FgXFxgYF5iYmNiYWRk
|
||||
YWFjYGFgXl9jYmVlZGZiYV1cXFtbW1pYV1dVV1VWVlFQT1FRUVBRTkxLSktNTVFP
|
||||
UU1RUVBSUlBPUlNTUVRWWFpcVldXWldXVVhYVlpbWV1dX1tbW11fYWFdXV5iY2Rg
|
||||
YFxeYmNmZGJgYFxdYmdjYWFhYGJoZGReXF9gX2BhYWJhXltdXVtaXGJlYV5gYF9f
|
||||
XVxcX2JiYWJkZmNjZGNhYmFcW15dXmBgX1xdYF5fXF5eX15bWV1dXl9eWlldXGJf
|
||||
XmFgXVpcXF1dXlpdXl9dXWRlYF5cXFtfYF1eYl1hX1xbXV1ZV1hZWltbW1peW1lb
|
||||
XlteW1xeXlxbXVpYW11dY19fW1xfX2NhXV5hZWNfX2FjZGJlZmVoaWtlY2FkXl5f
|
||||
YWJjX19fX15dXWBjYmJeWlteXVlaXmBeXF1fXVxdXFtaW19dXFtfWllZWVxeXlxb
|
||||
XV9eW1xcXF5cW1paVVdbWVteW1pbWlZeYV1ZV1tYVlVWV1hbWVhcWVhVWlhbWFtX
|
||||
V1ZWWFtXVlZaVlRVVVdVVldWVlNRU1NTUVNXVVlZWVZVVFNWVlRTU1JVV1ZWVFRU
|
||||
UVFVWVpZWlZWWFpYWllcXVpYWFdWWFxbWFlYWVhVVVRVV1dZWllYV1lcXVpcWVhY
|
||||
V1VbW1tVVVdaXFpXVlZZW1leW1lWWFdaXVpXWlZXW1xdXFxgX1xYXVxcXFhaW1tb
|
||||
WlxcWltdWldXVldXWVZVUVJVWFlcW1tcWVpgXF9hX11aWVpdXFxeXFtbX19aW1lb
|
||||
W1paWlxdXVpaXVxeX1xdX2JjYV9gYl9cW1xbWFpeXl1gYGBgYFtdY2JhYmBgYGBe
|
||||
YGJkY2NjYmNjYGNiY2JgX19hYV1gX2BgX19hZWRiZWJjZWVgYmFiZGRmaWdmYWJj
|
||||
YmJjZGFhY2FhY2RkZmVmY2FhYWVnaWVjZGNhY2RlZWZqZ2doZ2RjZGRmaGVlZmZm
|
||||
Z2dnaGhoZ2hmY2VmZWZjZWNlaWdlZmVoZ2hpamlra2hram1samtqZWpuc2tpa21u
|
||||
bmtraWtqYWNmZmZmZGVpZ2p0kMLk8vv+/////////5drcHZ1dnd7fHt6end0c3V1
|
||||
dnR0d3l3d3Z3fH16dnV2d3h0d3l2d3h4dXZ3d3d3dnBucW5vb3BxdHR3d3Jzd3Vz
|
||||
dndzc3V6eHVyc3JydXZxc3Z1d3V0eHZ1c3Bvc3V0dnR0dXR0dHd4dnRxc3J0c3d3
|
||||
dXNycXd1dnVzcHJ0d3h0dHFwcXFzc3N0dXFxcXFwcHFwcnFycHJwcHJzc3Fwc3Nx
|
||||
cnRyc29ucHJ0cnBwb29ub3Fwc3R0cnJubnBycG1ucHBxcXBuc3FwbGpoamlsb3By
|
||||
c25qaW1tcW1qbXFua25xb21vcG9tbG5qa2doaW1sbGpqamxsaWpmZ2VlZ2tqZ2Zn
|
||||
amVoa2tvZ2ttamxpamlmZmdoZ2dnZ2traWZmaGlpa2loaGdmZ2ZoZmRnZ2ZmZ2Vl
|
||||
ZmJiZWBhYmBhZGBhX2BfXVxfYmJkZF5dY2JjYWNhY2BgXl5gXl5dXl5cXFxgZGVh
|
||||
Xl5eXlxeXl5iYl9fYF9iYWFhZWRkY2RgX2BhX19gY2VlZWRkZF1gYV9bWV1dWVxX
|
||||
WldXVlZVU1BQUE5QUU9SUU5NUE9OTk9NT1FRUk5PUVRUUVJSVFVYWVpXVldVVlRV
|
||||
V1dZXl9bW1pYWVhaXl9gXl5bYGJhYWFhX19jZGZmZGJgYF9eX19fYWRmX2RgYWBe
|
||||
XmFhYWNhYmBeXV5eW1xdYF5dX2NiX19hX11dYmVoY2RlZWFeYF5fXV5hYGFgYF9i
|
||||
Y19dXl5dYGNgXFZbXlxZWVxhYl5gYF9cXV1cXFxdX19gYVxZW11dX2NjXF5eXF5e
|
||||
Xl9eYGJfXl9eW1xcX11ZW1xdW15eW11gXl1dW11cX15dXl1cXF5iX2BgYV9iYmJf
|
||||
XF1mY2NiamZiYWNiY2JiYmVpbGdkYGBmY2VoY11dXFxcX15iYmFiYmBeW19hX19h
|
||||
XV5aYlxZWlxcW1xcW2BfW1hZXF5cXVtcXlxbWldYW1xcXVpYWFlYWllbW1paWFpe
|
||||
XFtYWFdUU1ZVWFhVWFteWFdYW1pYVlhVU1RVWVZXVVdXVVFSU1ZWVFNSVVtSUlJT
|
||||
UlNUVVVWVVVWVVJWVVVTVldXXFlXVVlbVVNUWVtXWVtVVVZVWltZWltYVVVZWVlY
|
||||
V1ZXWVVUV1dXWl1dW1tcX1lZWl5cXVtcWVVXXFxZXVxZVVRUWVlcWVZWWFhaWFtd
|
||||
WV5YVlZZWVxbXFxdXFtbXl5dXVtbWV5dYF9cXl9eXF9iXl5bWlhbWltZWFpgXlpa
|
||||
W15iXF1jYVtcYGBfXVpbXFxcWlxbXFtZXFxaWllaXl1aW11gXV5fX19fX19hXl5f
|
||||
YGFgYWBhXmBiXlxfXFtcXmBgYmJkYWJgYmNgYGJiYWBfX19jZWBeYWJgYFxcY2Vj
|
||||
ZGJfX2JiYWNmY2RjYmFhYWFjYWNpZmNjZ2ZkZGBiYmVmZ2VjYmNlZV9iZWhlZWJi
|
||||
Y2JmZWdoZWVoZmdrZ2VmZmhmZGRkZ2VmZmVkZmppZmVnaGhqamhiZmZnaWdnamZm
|
||||
ZmtubGtpZWhna21rZmRpaWVlZ2l0bGtrbG1obmdmamZnaGVkZGNobYekwePx+///
|
||||
////////l2pzdnh3fHt8enp5fnl2d3Vyc3d5eXd1d3d3eXx+eHp3eHR0d3d6enl1
|
||||
dHNzc3d1dXNwcHJ0c3Byc3V3eXVycnZ5enl3dnh3dnJxdHZ3dXh8eHl1dXZ3dnZ1
|
||||
dHV0ent2dXl3dXV1d3h3dnZ3enV0d3d0dXN3dXZ1dnd3d3h6eHZzc3JwcnN0dHJy
|
||||
cXFub3FycW9vcHBvbGxsbXFzcHF1c3N0dHR0c3Bvc3N1cnFvcW9tbXFzcm5ub3Bw
|
||||
b21ucXBxcXBvc3Bvbm5sa25sbW1vbnJ0b2trbWpqbGtsbnFxcG9vbm1xbm5tbGpp
|
||||
amtqbm1rbW9sa21taWhoZmlqaGlramxqaWdraGdqaWluam9ua2psamhkZmxpaWpq
|
||||
aWVlZWdnaGZjY2RpZmZnZmZmZ2ZnZGFhZWNgZGJhY11dXV5hXF9lZGRiY2JhYV5f
|
||||
YGZgYF5fYWJgYmBgX15gZF9eYF1gYlxeYV5fYV5eYF5gYWJkX2JhZGNlZGJjYmFh
|
||||
YWNgY2VhZGZkY2JgYWBjY15fXFtaWllaXFlYVlNRUVNTUU5PUlNSVlRPU09PUVJS
|
||||
U1FNT1JVUk9RU1NRU1NSVFRWVllWWFtXWFhaWlpeXl1hYV9cXV5fXl9gXmFgYGBh
|
||||
ZmJjYmJjYV9fX19dYWFiZmRiYWBeX2FcW15fYWBfXmNkX11cXF1cXVxfYl9hYWJd
|
||||
X2BhY2JjX2BkZGFgYWFfYWFgYF9eX2JiZGVjY19dYF9eXV1eXF9hXmBeXF1fXV9b
|
||||
XGFhY2FkX11dW1peXl9hYWJgX19jYV5dYGFgYGBdWV5cXV9hYGBcX2BhYF5gZWBb
|
||||
X19dXWBeXl1eYWNhXl1eYGFhYGFgYWFhZGNiZGZoZWdnZWNgXWFhX2NlY2NjYGBl
|
||||
Y2NjY11bXl9eXmBiYGFgXF9kYF5iYF9iYl9cW15aWV5fXFtaWVpdW1xfYGBfXV5d
|
||||
XFtcWlhXVlZWWFhYV1ZWV1daWlhbWlpcXFhaWFdYVldYWFlZWWFYWltYWVhSVFdV
|
||||
VlpWV1RYV1VTVFRYVVRWU1RUVVhWVVRUVFZXVFVXV1VWV1ZYV1lcbltbWV5ZWlpX
|
||||
V1VSWFtfW1laXV5bWFpZWlpYWVhYW1hYV1daWVlZV15dWlxgXVpZWV1hXFpbW1dY
|
||||
WlpZVldXWlpWVlZXWlhaWVlZWVpZW1xbWltcWVhaXVxdWVxZWVtaX2BfXFlaWVte
|
||||
XV5dXV9eXF9bW1xbXl9hXFdcXlxbWVpbXFpcWF1gXV9gYF9aW11cX15dX19gXFtY
|
||||
WVtZW1tdXWBiYWBfXV5cXV5dX15eXV1iZWRhYWFiYF9eYmBeXV5dYWBdXWBlY2Fh
|
||||
YWRfYF9hY2RhZGJjZGZjYmJfYV5fZGJkYWBgYGBjY2RlaGNhY2BjYF9eYWJgY2Vk
|
||||
Y2JlZWRhYmRlY2FjY2RjY2RjY2NjYWBkY2NjZGVjYWRnaGhramtqZmdnZmhoZ2pn
|
||||
aGhoZmhpa2lpaGhoZ2hlZmdqaGZsbWhpamlqamppa21qaGhmaGxqZWVra25sbW5p
|
||||
aWhraWprbW1pZ2ZoZ2hsfKXG4/D7//////////+UbnR5e3t6eHmAfH58eHZ2dHd2
|
||||
d3x3dHZ2dnl4eHt8fHh4dXVydXR3eXd2dXR4d3Z1dXZ1dnhydHd5d3ZzdHV4dXR2
|
||||
eX13dnV2dHN1eXh4eHd3dnd2d3Z3dXZ3dXZ3eXh5dnR4eHV2eHt8e3l1d3d1dndz
|
||||
dXV2d3Z1eHh0dXR2d3V0dnNxcXFvb29yc3FucnJycW9ycnBvbG5ycXF0cnNyc3Nz
|
||||
cnFydHFvcHFycnNucXJvb3FzcHBxc3NxcG1ucG9wb3NxcXJwa2xtbXFwbnJtbnFv
|
||||
b25uamtqbG1scHJwa25tbXBycG9tbW5vbnBvb2xtb2xxbmtsbGtpamtrbGtnamlq
|
||||
a2pnaGhmZmptaGhoaGxqaGhpaGhpaWlpZmVkZWdoZ2lmY2RgYmhmamdlamdhYWNg
|
||||
X2BgYmNhYV1eYWFmZGRkZF9cXWBgX19fY2NdYWFiYWJhXl5kYWJhXF5eX19hYmZi
|
||||
Xl1gYmJiYV5iY2FhYmRhX2BlYWFiY2FfYWJhYmRjZGJeYmNmZGBhYmFaWVpaXFtZ
|
||||
V1ZUU1NSVVVXWVNSUE5NT1JPTk1NT09OUlVOTk1PU1NRU1JTVFRRU1NWV1dXWlhb
|
||||
W19bX11cX15fXFpeXV1dXV9fX15hYGBhZWJhX2FhYGBeXmFmZmJhYV9fYWFeXl1b
|
||||
XFxcXWJgYGFgXV5eW1peX2BgYF5iY2RiYV9gYmFhX2BhYmNiYWBhYWJfYWFfYF1f
|
||||
YWBgY19fXV5kYVlcX2FgYF1eW11gX15dXGBgX11hXltbW1teX2FdX15cW11cXF1e
|
||||
X2BfYGRmW1tfYFxeYWNiX15dXmBcXF5gX2RfW2BjYmFhY19bWl9hXl9hYmBeYWVk
|
||||
YmRiYmNjY2NjY2FjZGNgZGJjYmBfX19eYmJeXl1eXF5gXV1dXV1cXFtbW15fXV1e
|
||||
XlxdW1xeXmBbWVpYVltgYF5dXV1eWVlbW1xZVlZVWFhcXl1aWllWWllbXVxbWFha
|
||||
WFpbW1lZVldXVVZdV1daW1hYV1hVV1hTV1VUWFlXVVNVVVJSVVVWVlJWVlZWVFRW
|
||||
U1VVUlVUV1RWUlJYVldXVFdcXVlYV1JQVVlTVVZXV1ZTU1dYV1VUWV5bV1RWV1pY
|
||||
WFlbWldZWlpaWFdZXVlcXlpcXFlcWltfW1hZWltZXVteWFRSV1hZWlpZWFhXWFla
|
||||
WFheWVtZV1laW1tcWFlcXF1eXVtYWlpbXF1dX1xbWltcXl5hYVtZWl5ZWVxeXV5d
|
||||
XltaVlhaWVxcW1pbXV5eXlxdXV9eWllbW1tfXlxeXWBeXGFeXl5gX2BfXlxgY2Ji
|
||||
YWFhZWJgXWBfYV9dXl1cX2BeXl9eXFtcX19gX15hY2NgY2NnZWFjY2FkZGJjZGJi
|
||||
Y2BhYmNkY2NhYWJjZWJiYGJkY2BhZWVmYmRkZmVmZGNiX2FkZGNkZGJjZWRlZGJi
|
||||
YmRjYmhjYGJmaGlmY2NnZWhlaWtramhmZmZqZGhpaGZnZmRnaGloZGhqbW9tamdp
|
||||
bGtubGlsbmxpbW9wbGtra3ZoZGdpamhnZmhpaGhtbW1ra21qaGt+psnk8Pr+////
|
||||
/////3ZnbnV6fHh2eHp7fHx6d3h3dXV6eHd5dXNzc3h5eXl1d3d3d3h2dnd0dXR0
|
||||
d3h5eXh6dnV1cXR1dHV1dHR2d3h3d3p4enp5c3Z3dXV0dXl4dXV4eXt5dnZ0dnp5
|
||||
eHZ4dnd1dnNzdHJ4fHx8eX16eXh2dnR0dHV2eHV0eXRycnB0cnNwc3dzb3FvcXNv
|
||||
b3Fyc3Bxc3JwbmxucXJycnRzcXBwdHV1dnVzdHJvcnFycnZxcXFxcXJwb3BvcXRw
|
||||
bXFvbXBubGpwcXFtbG5ub25xcW9rbG1tbGxta2xrcnRxcm5qaWxra25wb3Byc3Zw
|
||||
b2xsbWtub21ra2xpam5tbG9ybGxrampramlpbHVza21maGxqaGhnaWxrbHBsa2tp
|
||||
amhnZ2ZmZWViYGNjZmRjZWRoZ2VhX2JjY2JiYGFhYGBfY2dnY2FiY2BiX19fX2Fh
|
||||
YWJgY2JjYGFgYV9dXF5fYFxfYWJkYmJeX2BiYmFiYGFkZGJfX19iZGlhYGBkZGJj
|
||||
YmRlZWRhYWBhYmBcXV1dXVxbW1xbW1ZXVFBXVFNUUFRUUk5RVldQT1FPTkxMT1JR
|
||||
UFFRUFBRU1NRUFBRU1RRUlRVUlNWWFhaWV1eW1tdX2BgXllYXV1bXWBgZWNgYV9g
|
||||
X2JfX2JlY2VmZ2RmZWZiYl9fX19hX2BeW15hYF9dW15gYWRiXVlbXF9hYmNjZWBm
|
||||
YmFdY2RkYWFhXV9gZGFhY2JeY2FeXmFgXl9iYl5dYGFcX15dYF5dXVpZXGBfXl1d
|
||||
W19gYF9cXF1cXl1bX2JeXl9aW11cXF5fYGBhY2ReYF9dYWFjYmFfXlxcXVtdXlpe
|
||||
X19lY2NgYWBeYmJdXl1hY2JiYl5fYGBhYmRkZGJjY2JjYmJiYGFiYmBfXV5eXV1g
|
||||
Y2VgX1xbW1teXVpZW15fXVxeXVteW1lZW1pcXFxfW1tZWmBeWl1eXV1eXlxYWlxc
|
||||
WlhZWFlYWFdbWltdWVlZXFlaW1xaWFdYXFtaWFhYVVZZWVhYWVdWVVZZWFxXW1lU
|
||||
WVhVU1dXU1JVVVZYWVlaWllYWVZWVldWV1hWVlhXXllYV1ZYVlZVW1lYWFRUU1RX
|
||||
VlZYWVlYWFhTWFZYW1xaW1lYWVtZVVZXWVpXWltZXFxaWFpXWV9fWltYVVhdWlla
|
||||
WltZV1hYWVxbV1hWWFxbWl1cWlddWVlbW11aV1daXFlZW1xbWlpeW1pdW1lXW11e
|
||||
W1tbXFhaXl1bX19cW1tcXF5cXF1aV15eWlpbWl5cXlxcWltcXFxbWlpcXFxdXV1i
|
||||
X1tcX11gX2BhYWNhYF1eYmJfXmFnZWBeX2JeX2FfX2FjYWNeX2BfYmRkYWBfXl1f
|
||||
YmNgX2BiYGFhYmNmZmZlZmRjZGVlZWZkYF9kZGNfXl9gX2BjZWVlYmJhZGJlZGJl
|
||||
Y2JkZmRjY2ZnZGVkaGZlamJiYGRlZGNhY2hoZGNiaGVpZmtpZmBkZ2plYmRnaWdl
|
||||
ZWdpZGZnaGdkZGlta2pqaGlnZ2RoamlmZ2pta2lqa2tqbG1sbGtqZmtsamhqbGlr
|
||||
aGloa2dnbmpwZ2lra3uly+Hv+P7/////////cHR9e3x6d3Z3eX16eXh3d3p6dnh3
|
||||
e3l0dnVxc3Z3dnd5dHV2eXh1c3N0d3Z4eXl8fXyAenl4c3RzcnJ2enZ2dnV0dnl+
|
||||
e3d0c3V2dXR4eHh2dnZ1eHZ2dHh4d3V3dXR1dnZ1dHR0dHd3eX97eXl2d3R1dnd2
|
||||
dnd5c3JzdXJ1c3Z3dXZ2eXRwc3FycHBwbnBvbnB3dXV1c3RwcW9ydXJzcnR3eHZ1
|
||||
eHR0dXRzb29wc3FwbXBtb21ubWxtcnNxbm1rb3Fubm9ubm5vbmlqbmxpamxvbW1s
|
||||
bm9vb3FycHJsamtra21rbW1vcG5xb25tbGlpbWttbmxsbGxpa2hoamtrbWxqamxt
|
||||
bW9ub21rbnBoamdlZ2ppbW5tbW1vbmxqZWdmY2VlZGNjZWZlYmVjZGBiZGBfYmJp
|
||||
Z2NkZWNgX2NjYmNhX15lZWBdYF5iXVxbYWBgYmJgYF5gX15cX19jY2BeXmBfYGJi
|
||||
YV9gYmFfYWJjYF5gY2RiX2FdYWJlZGRkZWVmZ2NhX2FhXmNiXVtcXV1dXVxaWFZX
|
||||
WFVUUlNTU1VTVVNVT05QUFFNTU5MTU9RT1JTUFBRU1BRU1VUVVVTU1NWVFZaW1pY
|
||||
WlpaX11eX15cXVxdXlteXF5hZF9fX2BiYWFgXmBhYmJiZGVkY2RjYGBfXWBiXVxg
|
||||
YWJhX19jYF9hYGFfXFpbXWJjYmFgYGFiYmNiY2VhXV9fZmNkYWFiZGNjYF5cXVtb
|
||||
Xl5eX2RkZF9eXF5dYF5hXlxbXFlYW2FiY2JfYlxZXl5dXV9dXV5gXl1cW1tbWVpd
|
||||
Yl9fYl9eY2FdXV5eXlxdXFtbXmBgYGJiYmhlX2FeXl5fYF9fX11fYGBiYGFiYWFl
|
||||
Y2NiYmBiYWJnZ2FfY2NgX2JkYmNlYl9fYFxdXV5fXVxZWlpdXF1cYF9gX19eXlla
|
||||
XWBiXlxYWFxcXVtdXFpfXmFgW1lbWlpYW1pbW1tZWFtdYF1aWVpZXWFfWFZUVlZX
|
||||
WVtaWFZWWVZUV1dYWFVUVFZVWFxcXVtaW1hWVlVUU1ZXWVhbWFlWVFhaW1lYVlVU
|
||||
V1pYVllZWFdaW1pYWFtVVlpcWlRUWFdXWVlWWVtbW15YWVtbXFtXWllWVVdZVlZY
|
||||
V1hZWFlYV1daVVZZV1tcXF5cW1paWVheXl5dW1xcWVpbWFhXWllYW1hZXlpWXFxc
|
||||
W15aWVpZWllZW15dWlxbW1lbXVxaXF5cXFpaWlpbXVtcXFxcXl1aWFpcYWNfXFxc
|
||||
XF1dX2FaWVtaWVpbXVxbVltaWVpfXF1cYWBeYWFeX19dX2FfXmBfX2NqZGFfYGJg
|
||||
YGBjY2VhYGFmZGFgYWJgYV9eXl5fYmNiYWJiYF9eX15gYGBiYGFjZGNjY2JjZmdj
|
||||
ZGFhX2JfYGJhY2RjYWRjYmNiZGBkZmZmZWRkZmVmZmVlZGlmZ2lpaGZmZWdkZWRl
|
||||
aWhjY2FjZmNmaGlnZmtqZ2dkZWdkZWVkZGdkZ2hpamhoZ2ltZmZnZWVlY2dpamtr
|
||||
a25wbWppbW9vcHFxb2xxbGxva2xoamlpaWprbGprb21mZ2h3gqDN4u/3/f//////
|
||||
//9ueHx9fnx5eHl8eXp7fnl4eX14e3l5d3l3dHV0dXZ4dHZ1c3N0dXRzdnR3eXd4
|
||||
dHV6e359eXd4dnZ5d3d3dXZzdHZ0eHh3d3h3dXh1cnB0c3R2d3Zyc3R4enp3eXh4
|
||||
dnd2d3p7e3x6dXh2eHd2dHd5dHR0dXd5d3V0dXR1dHRzdnZ3eHhzdHd4eHJxbmxu
|
||||
b29wcnJzdnV0dXBydnNxcHFwcnV2dHd1dHV3dXRycnRzdHFtb3FxcXBubm9wbG9w
|
||||
b29vbnFycXBsbW1xc3Jtbm9ubW9ubWxtb25wdG9tbm1wcWttbW5sbWtwbnFsamps
|
||||
bGtoaWtvcW9tbGxsa25vbWtoaWtsa2psa2tpbWxqbGloZ2loaWtsbG5tbGxraWlq
|
||||
a2lnZWVlY2JiYGJnY2JkZV9hY2JjYmBga2dhYWNkY2ZkYWBfXmBgXlpdYl9bW11h
|
||||
ZGRhX19fXGFcXWFfX19hXmBhYGBiZGZlY11cXWNkY2ZmYmJgXl9eXmFhZGFjY2Nm
|
||||
Z2hmZGJjYl9eYGNhXl9eXFpcXVxbXFhWU1FRUlNSUE1OUFFNTE1NTUxPT0xKT1JY
|
||||
U1JSUE9SVFZTUlJTVVdZWlhZWlhZWVhdXF9hXV9cXVxeYl9dYWBdXV9gYl9fXmBg
|
||||
ZGNfX2NjY2NkYl9jYGFjY2FfYV5gYV9gY2JhYV9lXWBiXmFjX2BfXV9eXF5dX2Bf
|
||||
ZWNkZWhmX19dYF9jYmFfY2NhXF1dYV1dXFxdXl9gYGFdXGBeXmFhXFtdXVxcXl5g
|
||||
YmFeXVtcYGBcXl9dYFxfXl9fXl9eXV1eYWBeXVxdYGNhX2FfYWFgYV9eYGNgYWJj
|
||||
X19gX11cXl5dXl5hX19hYWFkZGJiZGNiYmJjYWFjY2FfXmFkY2RlZmdhX2BhXmBi
|
||||
ZGRiY19dXVxZXF1eXV1gYV9eYl5hX19eX2JdWl1cXVxcXmFeXF5eXV5bXmBkXFla
|
||||
WFtbWltbWllbW1hbWVlZWltZW1hXWFdaWlpZW1tVVldYV1ZXWFRWU1NWV1hYWVpY
|
||||
V1hWVlRTV1ZXVlVTUVNaVlVUWFdVVVNUWl5bWldYWFpbWlhZV1ZYVldcWltaWVdY
|
||||
WVdVV1lbW1hXWFpXVVZWVlVUV1dZVVVVVVZVWFpXVlhaWlpYWFtaXWFdWllZWltb
|
||||
W1pbW1lYWVxZWFhUVlhZXF9bWVtYXFxcW1pdXV5YWFlXWltcWldaWVlbW1pXV1pa
|
||||
W15hXVxgXVlZW11aW1laW11bXF1ZWmBcXFxdXF9cX15aWlpZXFteWl1gYl9hW1la
|
||||
Xl1eXV1eXV9dXl1dXV9hYGFhX11dX2BgX2RlZWNlYl9hYWNgX2BfW1tdXV9iZGJg
|
||||
YF9gYGNiYGFjZ2FgZGFgYWVhY2ZkZWdgYGBmZGFgYWFiYmBfY2RlZWRkZGVkYmVn
|
||||
Z2RnamdoZ2VjY2ZnZGJiZmplZmVlaGNkZ2ZmZWFiY2ZmZ2trbGtpZ2hqa2xqaGZn
|
||||
@@ -1,120 +0,0 @@
|
||||
5eXl5uXk5eTl5eXl5eXm5eXl5eXl5ebl5ufl5efl5ebm5+bm5ubm5ebm5ufm5ufm
|
||||
5uXm5+bl5+bl5ufm5+bm5ebn5ufm5ubn5+bm5+bm6Ofn5+fm6Ofn5+jn5ubn6Ofn
|
||||
5+fm5+fn5+fn6Ofo5ujo5+fo5+fn6Ofo6Ojn6Ojn5+nn5+fn5+jn5+fo5+fo6Ojn
|
||||
6Ofn5+np6Ofo5ufo6Ojn6Ojn6Ojn5+no5+bn6Ofn5+fn5ufn5+fo5+fo5+fm6Obn
|
||||
6Ofn5+jo6Ofo6Ojn6Ojo6Ono6eno6ejo5+jo6Ojo6Ono6Ono5Ofo6Ono6ejo6Orp
|
||||
6ejp6enp6Ojo6Onq6Onp6ejo6eno6enp6eno6ejp6Onp6enp6unp6eno6Onp6unp
|
||||
6ejp6enq6ejp6unp6enp6Ono6eno6uno6enp6Orp6enq6uno6unp6enp6erp6Orq
|
||||
6Onq6eno6unp6unp6urp6urq6enp6urq6uno6urp6erp6erq6urp6urq6erq6uvr
|
||||
6erq6enq6ejq6urp6uvr6erq6urp6unq6unq6Orp6+nq6unp6err6unp6+rp6urp
|
||||
6ejq6erp6enp6erp6erp6eno6ujp6unq6+rq6urp6+vq6uvr6urq6urp6+rq6urr
|
||||
6+nq6unq6urq6uvr6+rq6uvr6+rq6uvq6+rr6urr6uvr6+vr6+vq6+vr6+zr6+vr
|
||||
6+zr6+rr6uvr6+rr6urq6+vr6uzr6+zs6+zs6+zr6+zs7Ovr7Ozr7O3r7Ozs7Ozs
|
||||
7e3s7ezr6+3r7Ozs7e3t7O7t7O3t7ezt7u3t7u3t7u3t7+/t7e7u7+7u7+3u7+7v
|
||||
7u7u7u7v7+/w7u/v7/Dv7+/w7+/v7u/w7+/w8O/w8PDw8PDw8PHy8PHw8PHx8PLx
|
||||
8fLx8vGVjoV7dW1kYmJYVlRVVFRWVldZW1xdYGJjZmlqbG5wcnZ3en1+gYKFh4qL
|
||||
jY6OkZKTlJaXmZqdnqGjpqipq6yur7Gxs7S0tLa2uLm5u7u9vr7AwMHCw8PDxsbI
|
||||
ycrJy8zNz8/S09PU1dfX2dnZ2dja2tra2tvb2tra2tvb29rb3Nzd3d3d3t/e3d/f
|
||||
3t/f39/f197f39/f3+Df39/e3t7e3t/f3d7d3t7e397e39/e3uDg4ODg4OHh4ODg
|
||||
4d/f3+De3uDf39/g3d7d3Nza29va2tja2tnZ2NjW1tjX1tbW1tXU1dXV1dXV1dXV
|
||||
1dXW1dTT09PS0tLS0dHS0NHR09PS09LT0tTU1NPT0tPT09TS09PT0tLR09PT09PT
|
||||
09TU1NTU1NTU1dXV1dXU1dXV1dXV1dXW1tXX2NfX19fX2djZ2dnZ2drZ2tvb2trb
|
||||
29vc29vb29vc3Nzd3N7d3d/e3d7e397f3t7e39/f3uDg3t/g4OHg4ODh4d/h4OHh
|
||||
4OHh4eHh4eHi4uLi4uLj4ePi4+Li4uPj4+Pi4uPj4+Pj4+Ti5OPj4+Xj5eTk5OTk
|
||||
5OXj5OTk5OTk5OTk5OTj5OPj4+Tk5OTj5uXl5OXl5OTl5eTl5OXl5ebl5ebk5eXl
|
||||
5ubk5OXn5ubl5eXl5uXl5+Xk5eXl5ebl5ebm5ubl5uXm5ufn5uXn5ubn5ubm5+fm
|
||||
5ubl5ubn5ufm5ufm5ujn5ubn5+fn5ufm5+jo6Ofn5ubm5+bm5+fn5ufn5+fo6Ofo
|
||||
5+bn5+jn5ujn5+fn5+fo6Ofo6Ojn6Ofo6Ofn6Ojp5ufo6Ojo6ejn6efn6eno6ejo
|
||||
6Ojo5+fn6Ojp6Ojo6ejo5+no6Ojo6Ofo5+fo6Onp6Ojn6Obn6Ofm5+fn6Ojn6Ojo
|
||||
5+jo6Ojo5+jo6Ofo6Onp6Ojo6Ojn6Ojo6Ojo6eno6ejo6enp6Ojp6ejp6unp6Onp
|
||||
6enp6Onp6Onp6eno6Ono6enp6enp6Ono6enp6OXp6Ojq6ero6unp6unp6enp6unp
|
||||
6unp6eno6enp6urq6enp6enq6unq6enp6erq6urq6unq6unp6Orp6enp6erq6erp
|
||||
6erp6urq6urq6enq6+rp6urq6unp6ujp6unq6enq6evq6unq6unq6uvq6unq6urq
|
||||
6+vp6ujq6unq6urp6unq6unp6+rq6evq6urp6unq6+rq6urq6erp6urr6+nq6urp
|
||||
6unq6+nq6erp6erq6erq6erp6urq6urq6evq6enp6enp6ero6unq6+nr6urq6+rr
|
||||
6urq6uvr6urq6+vr6+vq6+zq6+vr6+vq6urr6+rr6+vr6urr6urq6+zr6+rq6+vr
|
||||
6+vr6uzt6uvr6+vr6+vr7Ovs6+vs6+zs6+vs6+rr6+rr6+vr6+vr6+vr6+zr6+zt
|
||||
7Ozr7Ovr7Ovr6+zt6+zs7e3t7O3s7O3t7ezt7O3t7ezs7O3u7ezt7O3s7u3t7e3u
|
||||
7ezu7e3u7e/u7u3u7+3u7u/u7u/v7u/u7+/v8O/v7+/v7+/v8PDv7/Dv7+7v7/Dx
|
||||
8PDw8PDx8PHv8fHy8PHw8fDx8fHw8fHy8vLy8qOdlpGLhH56dXRycHFxcnR1d3l6
|
||||
fH+ChIeJi42PkpSWmZyfoaKmqKqrra+vsLK0s7W3uLm6vL2+wMLExcfGyMrKzczN
|
||||
zs/OztDQ0tLT09TV1tbW1dfY2NfY2dra2trc3Nzd3N7e3t7e39/f39/f4ODg4ODg
|
||||
4eHg3+Hh4eDg4OHg4ODh4uHh4OHh4uHh4eHj4eHi4OHh4uHi4eDh4eHg4eHh4eHi
|
||||
4eHg4eHg4eDi4eLg4eLj4+Li4+Li4+Hi4eLg4eHh4uHi4uLh4OHg4eDh4N/e4ODf
|
||||
4ODf397e3d/f3d7f393e3t/d3t7d3d7d3d3d3d3d3tze3d3c3tzb3d3d3Nzc3N3d
|
||||
3d3e3d3d3d3d3d3d3t7e3tze3d3e3d3e3dzf3d7e3d7d3t7d3t7e3t7e3t7e3t7f
|
||||
3eDg3+Df4N/f4ODf4N/g4N/g4ODh4OHh4eHg4eDi4eHi4OHh4uHh4uLh4eLi4uLj
|
||||
4eLj4uLj4+Lh4uPj5OLj5OLj5OPk4+Tk4uPj4+Tj4+Ti5OPk4+Pj5OTl5OXj5OTj
|
||||
5OPk4+Tk5OXk5eXl5eXl5ubm5eXl5eXm5uXk5eTl5ubl5eXk5Obl5eTj5OXl5OTl
|
||||
5uXm5ubl4+bl5uXl5ebk5uXl5eXm5uTm5ubn5ubm5uXn5ubm5ufl5ebm5uXm5+Xm
|
||||
5ufm5+fm5ebm5ubn5ujn5ubl5ubn5ufn5ufn5+fn6Ojn5+fn5+jn5+fm5ufm5+fo
|
||||
5+fn5+nn5ufn5+bm6Ofm6Ojn5+jo6ejn6Ofp6Ojo5+jo6ejo6Ojn5+jp6ejo6Ojo
|
||||
6eno6Ojo6Onp6efn6ejo6Ojo6ejo6enp6Ojo6ejo6eno6ejp6eno6ejo6Ojn6Ono
|
||||
6Ojp6enp6Ojp5+fo6Ojn6Ojo6ejo6ejo6enp6Ofo6ejo6ejp6Ojo6eno6ejp6erp
|
||||
6Ono6Ojo6eno6eno6enq6erp6uno6ero6Orp6unp6erp6unq6unq6urp6uno6ero
|
||||
6Orp5eno6erq6urp6unp6erp6Onr6erp6+nq6unq6enq6+nq6urp6urq6erp6urp
|
||||
6urq6urq6urq6urq6+rp6+rq6uvq6Orq6unr6urs6urr6urp6unq6urq6urq6+rq
|
||||
6erp6urp6urq6urq6urq6err6err6+rq6+rr6urq6+rr6urr6urq6+vq6uvq6+zq
|
||||
6urr6uvr6+vq6+rr6urr6uvq6uvq6uvq6+vr6urq6err6evq6uvr6urr6urp6urq
|
||||
6+rq6unp6urq6urq6urq6uvq6urq6+vr6+vr6+vr6uvs7Ovr6+rq6+vq6+vq6+vq
|
||||
6+vq6+vr6urr6+zq6uzr6+zr6uvs6uvs6+zr6+zr6+zs6+vr6uzs7Ozs6+vq6+zr
|
||||
6+zs6+zr6+zs6+zs7Ovr7Ovs7Ovs7Ozs7Ozs7Ozs7O3s7Ozs7Ozt7O3s7Ozs7u3t
|
||||
7e3t7O3t7e3t7e3t7u3u7e3u7e3t7e3t7e7t7u7u7u7u7u3v7u3v7+/u7+7u7+7w
|
||||
7+7u7u/w8O7v7+/w8O/x8PDv8PDw8fHw7/Dv8fHx8fDx8fHx8fHx8fHw8fHx8vLy
|
||||
8vLxs6+qpqGcmJWRkI6Oj5CQkZOVl5mbnaCipKepq62wsrS2uLu9vsDDxMXGx8jI
|
||||
yszNzc7P0NDS0tLU1dXY2NjY2dnc3Nvc3Nzc3Nzd3d3d3t7e397e4N/f39/g4eHh
|
||||
4OLg4eHh4eHi4eLh4uDh4uHi4eLi4uPi4+Hh4ePh4uHi4+Lh4uLj4uLi4uPi4uLj
|
||||
4uPi4uLi4uLi4+Pi4uPi4uHi4uPj4uLj4uLi4uPh4eLi4uLi4+Li4+Pj4+Li4+Pj
|
||||
4uLi4uLi4uPi4+Lh4uHi4uLi4uPi4eHi4eDh4eHf4eHh4eLi4OLh4ODg4eDh4eHh
|
||||
4eDh4eDh4eLf4eHg4N/h4ODi4ODg4OHh4eDg4OHh4eDh4uDg4uHi4eLg4OHh4eDh
|
||||
4OHg4uHh4eHh4eDg4eHi4eHi4eHi4eLh4uLi4uHi4uLi4uPj4uPj4uHi5OPk4+Pj
|
||||
4+Pj4uPk5OLi5OPj4+Pk5OTi4+Pj5OPk5OPj5OPk5OPk5OTk5OXk5OTk4+Tl5eTk
|
||||
5eXk4+Tk5OTk5OXk5OXl5eXk5eXm5eXk5OXk5uXl5ebl5uXl5ubn5eXm5ubl5ubm
|
||||
5uXl5eXm5uXm5uXl5eXl5eXk5eXm5uXl5ubn5ubl5ubl5+Xm5ubm5ubn5ubn5efm
|
||||
5+fm5ubn5+fn6Ofn5+fm5ufo5ubn5+bm5+fn5+fn5+fn5+jm6Ofn5ujn5+fn5+fn
|
||||
6Ojo6Ojn6Ojn5+jo6Ofn6Ofo5+fn5+jo6Ofo5+jn5+jn5+jn5+jn6Ojo5+jo6Ono
|
||||
5+no6Ofo6Ojo6Ofp6ejn6Ojo6Onn6Onp6enp6eno6efo5+jo6Ono6Ojo6enp6Ojo
|
||||
6enp6enp6Ojq6Ojo6eno6Onp6ejp6unp6ujq6unq6enp6Ojp6Orp6Onp6enq6enq
|
||||
6eno6Onp6eno6ejp6eno6Onp6erp6ejq6eno6erp6enp6enq6urp6Onq6unp6urp
|
||||
6+nq6enp6enq6unp6erp6+nq6enp6unp6enp6erq6unr6uvq6erp6+rp6erp6unq
|
||||
6urq6urp6urq6err6uvq6urq6urp6+rq6uvr6uvq6+rp6urq6urq6uvp6+nq6urr
|
||||
6unq6+vq6+rr6urq6urq6uvq6urp6urq6urr6urq6urq6urr6+rr6urq6uvq6urr
|
||||
6uvq6erq6uvr6+rr6urr7Ovq6uvr6+vr6+vq6+vr6+rq6+rr6+vr6urq6+vr6uvq
|
||||
6uvq6+vq6+zq6uvr6+rq6uvq6+rq6urr6+vq6urq6+rq6urq6uvr6+vq6+rq6uvr
|
||||
6+zr6+vr6uvr6+vr6+vs6+vr6+vr7Ozr7Orr7evr6+rr6uvs6+vr6+rq6+zs6+vs
|
||||
7Ovs7Ozs7Ovs6+zs7Ozs7Ovs6+zs7Ovs7Ovs6+zs7O3s7Ovs7Ozr7Ozr7Ozs7Ozs
|
||||
7O3s7O3s7e3t7Ozr7Ozs7uzt7ezs7O3t7uzs7e3t7uzt7ezu7e7t7u3u7u7u7e7u
|
||||
7e7u7u/u7u/v7e/u7+7v7+/v7u/u7u/w7+/v7u/w7vHv7u/v7vDw8PDw8PHx8fHx
|
||||
8PDw8fDx8PLx8vLx8fDw8fHy8vLy8vLy8/MAEAEAAAMAAAABBJcAAAEBAAMAAAAB
|
||||
Bt4AAAECAAMAAAABAAgAAAEDAAMAAAABAAEAAAEGAAMAAAABAAEAAAERAAQAAAAQ
|
||||
AB+FwAESAAMAAAABAAEAAAEVAAMAAAABAAEAAAEWAAMAAAABAG8AAAEXAAQAAAAQ
|
||||
AB+GAAEaAAUAAAABAB+GQAEbAAUAAAABAB+GSAEcAAMAAAABAAEAAAEoAAMAAAAB
|
||||
AAIAAAFTAAMAAAABAAEAAIdzAAcAAASkAB+GUAAAAAAAAAAIAAH9gQAD+voABfhz
|
||||
AAf17AAJ82UAC/DeAA3uVwAP69AAEelJABPmwgAV5DsAF+G0ABnfLQAb3KYAHdof
|
||||
AAH9eQAB/XkAAf15AAH9eQAB/XkAAf15AAH9eQAB/XkAAf15AAH9eQAB/XkAAf15
|
||||
AAH9eQAB/XkAAf15AAGq2yWAAAAAIAAAJYAAAAAgAAAAAASkYXBwbAIgAABzY25y
|
||||
R1JBWVhZWiAH0wAHAAEAAAAAAABhY3NwQVBQTAAAAABub25lAAAAAAAAAAAAAAAA
|
||||
AAAAAAAA9tYAAQAAAADTLWFwcGyYcjd2/nI/x5EwPxA3BfUzAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAVkZXNjAAAA5AAAAEF3dHB0AAAAwAAAABRrVFJD
|
||||
AAAA1AAAAA5jcHJ0AAAEYAAAAEFkc2NtAAABKAAAAzZYWVogAAAAAAAA81EAAQAA
|
||||
AAEWzGN1cnYAAAAAAAAAAQHNAABkZXNjAAAAAAAAABVTY2FubmVyIEdyYXkgUHJv
|
||||
ZmlsZQAAAAAAAAAAAAAAFVNjYW5uZXIgR3JheSBQcm9maWxlAAAAAG1sdWMAAAAA
|
||||
AAAADwAAAAxlblVTAAAAKAAAAw5lc0VTAAAAMAAAAYpkYURLAAAAPAAAAjZkZURF
|
||||
AAAAOgAAAeJmaUZJAAAAMgAAAMRmckZVAAAALgAAATBpdElUAAAALAAAAuJubE5M
|
||||
AAAAKAAAAnJub05PAAAAKAAAAbpwdEJSAAAALgAAArRzdlNFAAAAOgAAAPZqYUpQ
|
||||
AAAAGgAAAV5rb0tSAAAAGgAAApp6aFRXAAAAEgAAAXh6aENOAAAAGgAAAhwAUwBr
|
||||
AGEAbgBuAGUAcgBpAG4AIABIAGEAcgBtAGEAYQAtAHAAcgBvAGYAaQBpAGwAaQBH
|
||||
AHIA5QBzAGsAYQBsAGUAcAByAG8AZgBpAGwAIABmAPYAcgAgAEIAaQBsAGQAbADk
|
||||
AHMAYQByAGUAUAByAG8AZgBpAGwAIABHAHIAaQBzACAAZAB1ACAAUwBjAGEAbgBu
|
||||
AGUAdQByMLkwrTDjMMowsDDsMKQw1zDtMNUwoTCkMOtjg2PPVmhwcJaOgnJfaWPP
|
||||
j/AAUABlAHIAZgBpAGwAIABHAHIAaQBzACAAcABhAHIAYQAgAEUAcwBjAOEAbgBl
|
||||
AHIARwByAOUAdABvAG4AZQBzAGsAYQBuAG4AZQByAHAAcgBvAGYAaQBsAEcAcgBh
|
||||
AHUAcwB0AHUAZgBlAG4ALQBQAHIAbwBmAGkAbAAgAGYA/AByACAAUwBjAGEAbgBu
|
||||
AGUAcmJrY89O6gAgAEcAcgBhAHkAIGPPj/Blh072AEcAcgDlAHQAbwBuAGUAYgBl
|
||||
AHMAawByAGkAdgBlAGwAcwBlACAAdABpAGwAIABTAGMAYQBuAG4AZQByAEcAcgBp
|
||||
AGoAcwBwAHIAbwBmAGkAZQBsACAAUwBjAGEAbgBuAGUAcsKkzpCxCAAgAEcAcgBh
|
||||
AHkAINUEuFzTDMd8AFAAZQByAGYAaQBsACAAQwBpAG4AegBhACAAZABlACAAUwBj
|
||||
AGEAbgBuAGUAcgBQAHIAbwBmAGkAbABvACAARwByAGkAZwBpAG8AIABTAGMAYQBu
|
||||
AG4AZQByAFMAYwBhAG4AbgBlAHIAIABHAHIAYQB5ACAAUAByAG8AZgBpAGwAZQAA
|
||||
dGV4dAAAAABDb3B5cmlnaHQgMjAwMyBBcHBsZSBDb21wdXRlciBJbmMuLCBhbGwg
|
||||
cmlnaHRzIHJlc2VydmVkLgAAAAA=
|
||||
@@ -1,136 +0,0 @@
|
||||
TUxOT1JVUFNUVlVRT1VYWVdXUlJUT1FPU1VPT01PUE9WVlFSUFJRTkxKTU1PTEtJ
|
||||
R0JDR0RDQEBBQD8/PDs/PD0+Pz44NzY1NjY5ODw5OT08Nzk5ODs8QUNBQj9BQUND
|
||||
QklLSk5KSU9TXlhLT0xWUlFaVFdMTVdVW1VgWVdWXV9dWFtWUlFSTkVERTk1NTUz
|
||||
MzUzNjU0ODg1ODY2Nzk6PTo6P0NETE1JR1RSTFBISkpKVVVLSUpUTU5STVZRVFpT
|
||||
Vk5XXGBYUFhVWFJTV19kXVdVUFdVVlZUW1xbWlhZV1pcWE9TWlRWWVlXUE1MTlJD
|
||||
PDo8Ozo+P0pOTVhWVFJWW15oYFxbXlpUVlpZXFhYVVdXUFlcYFhUVFdaW1RQXVxc
|
||||
XltXUVBSTU1RUVRYVVNNSU1RUFFWVFFST05QUk9OSU5QTk1KS1BVSkxLTE5LT1RO
|
||||
VlRZWlZYVE1FRkVHR0ZLSU9LTlFOXWaJo7CspZ2WlZOJfXFmYmFqdG9eS0E+OTk4
|
||||
ODtBQTw9Ojg5PD5EQT8/P0BAPDc6OEE+Pzo+QENAPDtBQENDRkNDR0A6QEQ8ODU0
|
||||
MTQ3NTg3Mzc2NDg0OTs/RUpTS05JT1xYWVlUXFZWVVtdWVlXUE5TUlJQT1BUVlZR
|
||||
VFVYW1NRTkxMUlZUUEtMTk9PTE1MSERESUpLSkxJRklJSUtLRkRJSEVCRENERUZE
|
||||
QkNBQ0JEQ0FAPjk6PDo3OTc3ODU2ODY2NTc+Rk9YYmdqaGhna3B3e3x+gYGBgYaH
|
||||
iYuKi4uKioWCfXdwbmpnaWlsb3eCiIuMjYmJjo6SkJCTl5ORjIaBfnZnVEc/Ojo6
|
||||
ODo7P0RJSkxPUlVWWVhWVlVSVFFRT05JRkVARD5BPkBCRERDQ0ZGRUdFSUpKSkpK
|
||||
SklOS0xNTkxOT05MS0tMTk9NT1ZWU1dZWl1eXWJkZ2hqbm91dXV4fH5/gYB/gYOC
|
||||
hYmGiIiHh4iGh4qLi4qMjY2Li4uLjZKTlpeWlpSPjo+SkZOQkpGRlZiXlpaZmZuZ
|
||||
mZibl5mZmJiampual5aYnKCpr7KqmImGiJWosbzAvLu5u7i1tbGwsbKzt7a8vcC/
|
||||
vL29vr6/v7q8vLq8vrq4ube1tLe3t7S0ta2ysrK1tKyginBfXVhTUlBOTVBMTU9M
|
||||
S0tLSUpLSkhJSkdPT05KSUdNS0lJSE1LSkxKTk9MTUtNSk9OTUxPUU5NUE9OT0xM
|
||||
Tk5QUVFQUU9QUVJSVFVSUlNTU1JRTlJTUFBSVFRSUlFTT09RUlBSUVNTUU9QUVNV
|
||||
VVVVUVFSU1FVU1JSUFFSU1hUUVFPUVRQUVJRU1NUVVZYWFZWWlhYVFFVWFhXVlhW
|
||||
WFhaWltbWF5bV1dYVlhbWFZYWVlaWVlYV1laWVpZV1taWVlaWlpaWVtcXV1cXF1d
|
||||
YF9dYF5dXV1dYF5bXV1cWlxWV1dYV1ZWWFdYV1ZZXIO9ydPa3uHk5efo6el7enh5
|
||||
ent8eHd1dnl2dnh6enl4eXdwZ1pMR0VFSkVEQz09Q0hKQ0A/P0I/PEJCQT4+PTpA
|
||||
RURFQ0RHQ0RBPT5ARkhJSkxMTk1JS05QTklKTk5QUVNUU1FXU1ddWVVRUFFTU1JQ
|
||||
UlBQT0tRVVVVU1JSUFJNSktPT0tJSUhHREVFQ0dEQkNAPj0+PTw7Ozs6OTw2Nzk4
|
||||
ODg6PDs5OTg3Nzs4Ojw7Ozw9PURBQkQ/RktGS0tISUpRVU5RTUpTT1lTV1VOVlNc
|
||||
WV1cWVddY1xdXllPT1JVT0pAODc1MzU5Njc6OTs3Njg2NTc7ODg4OTg+Q0dPUEpH
|
||||
VVRMUUxRSkpUTklOSVNSTU1KV1RSWlFYVFRVWVdNUFJeVFRVYWFdXVZQUVVYV1VZ
|
||||
VFdYWVhZXGVhVlRbW1pXUU1LTFBMTkhAOTg6OTk7Q1BSVVldWFpeXmFhY2VjXlNR
|
||||
U1BXWFVVUVZYWFdWU1NTVVZaV09WWVlaWlNQTUtOUE1OUlhZVFFXUE1NUFBQTlFS
|
||||
UFJWTU1OS0pRSkVJUFBNSkpNUEtPVFVXV1lXVldXU0hGRUdJSVBJSUhOVE9RWnWU
|
||||
qauroZiVkYl8c2xmY2VrdWlSQTs6Ozg7OTw8Oz08PDw7Ozw7PTtAPj09Pj1BQUJA
|
||||
OTo+QUQ9OD1FQUM+RUJCOzY9Q0E4ODU0NDY2NjQ0MzI1Njg4Oz1ESkpISkpTWlhY
|
||||
W1ZZV1hTVldOUVNOTE5OUlFQVFlYU01XV1dWU09MSktOUlRTUU1PT0xQTklFR0ZL
|
||||
TU1LS0dHR0dJSkpGRUNGSExHQ0RDREVBQD9APz5AOzs+QD88Pjw4NjY0Njc5Nzg7
|
||||
QUpTXmRmaGdoaGxwdHp7fXmBh4eHhoyQj5CNjYuJhYJ8dnN1b2xtbGtze4SJjI6M
|
||||
iImOj5KUlpWVk5GQi4B3a11RRj5APkFAQUFCSEpLTVBQU1hYWFZWV1NRUlBQTkxJ
|
||||
RkdDQT5AP0NDQkNARERJR0lJRkhHSUtQUE1MS0tNTExNTE1NT1FSUFBVVVVXWF1f
|
||||
XmNjZGdsbG5zdXZ1dnt9f4CDg4F/goOFhYaGh4uHhoWJi4mKi4mIiouNjIuMkZGR
|
||||
lpSUj5GQkpKSkpWTkpaXl5OVlpmbmpiYmZmZmJqWlZeYl5iZmp+jqrO5s6aTgXeB
|
||||
mK64vby7urq9ure0srSztba1t7m9vsDDwr69vb+9uru+wL69vbi3tbSztbq1tLe4
|
||||
rrOztrW1saylknplXFZUVVNPTU9PTk5NTU1NSkhISkpJR0lKS0lKUEpKS0xPTVBL
|
||||
TUxKS01KTExMTkpPTktQUE5PT09QTU5NUFBSUlNST1BPT05ST05PUVFTVlJSU1NS
|
||||
UlRTUVJTUVBRUU5RTlFSU1NQTk5NUFVTUlBSUVBRVFRTU1NSVFJQUlVUVlNUVFFS
|
||||
UFNVU1JUVVVWVVZXV1VWV1dWVVVYWVhZW1pYWVtdXF5aW1hZWFZZWVhYWlpYV1dY
|
||||
WFZXW1tZWFlYWVhWWVlZXFxcW11cXltcXltdXlxdX19dXl5bXVtbWFlYV1VXV1ZU
|
||||
VlVVVVdgfLvJ0dre4eTm5+jp6nl7e3x7eHp6dnh5dnd4dXd4dnZ5cmlgUkhCQEJH
|
||||
QEM/PkFCRERBQERDQz4/QkU7PD1CPkBBQUFAQEFDR0I9PENCR0dISEdJTklMT01P
|
||||
UlFNUFBRUlJZVVVWV1ZUU1hSVFZVUlJTUlBRUVNTVFVSUFFOUE5NTExPTUtIREhH
|
||||
RENDQkJFQj5APkE/Pz87Oj08Oz04Nzc4NzxBODQ1Nzc4Ozo6Ojg2OTs7Ozs+QT9D
|
||||
SUdISEZGRkpQS01LRElHTEpLVVRaWVhZXFtZVlhgX1xXV1BVblVUSkA5NzQ1NDc1
|
||||
NTQzNDQ0NDg1Njc2NTg7PD8+PkpJTUZNT0dPS1JNSFBLRkxIS0hLSk1UVFlgVl5X
|
||||
UVJUVUxRT1ZVUlFZXVpWVFJTVllZV1dUVFtaWltfZl1VWFtcVlZVT0tTUElIR0Q5
|
||||
NzY3Njk/SVJWWmxlWlxdWWBpYV9kV1JUUVJcWlhTT1NSV1pTVFNTVlVXVlZVWFJU
|
||||
WlNPS01VVVpaWVVYV1VWUU5QTk5PUFVRTE1LS0xIRU5KSEpOTk1JR01MSVBVWlxT
|
||||
VFhcWFpZTkdDQEFFS0VISElTUU9WYniWpqiooJeOhn92a2NgYGZwbV5JOzs/QkI7
|
||||
ODs9OkA+PDw6OT1APj4+SDw6Oz4/QkA7O0A9Pz5CPDs8QTxDQkJJPzpBPzo8Ozg2
|
||||
NzQ3NjczMjQ2Nzg7PT9HS0RJR01SUldSUE9OT01VWFJWVE5LTlFTUlBSVldSVFhW
|
||||
VFJWUVBNTEhLTFJUTExNS05OSUZITE1LS0pKT0pGREVGRkdIRklKSUlERURCQ0NC
|
||||
Q0E+PDk9QD9BPzw6ODo4OTo9Ojg5PUdQW2VqamlrbWttcnd6fH19fYKDiI2Ojo2N
|
||||
jo6LjIiIhX58eXVzcW9sb3d/hIyOkI+Lio6QkZOYlpSTjYuHgXJkWE1IRD89QEJF
|
||||
RUZMT0xPUVNUVlhaW1lXVVNSUlJPTUtNS0dDQUJEQkJDRUZGR0hFR0dHQ0dHSEtI
|
||||
SEtJS05LS0xSUVNQTlFUUlVZWFlcXWFlZ2hsbW9zcnV8fH9+fX+AgYGBg4SEg4KD
|
||||
hYOCh4eHh4eJi4qKi4uOjI2KjpGSlZWUmZaSkpeWkI6TmJWYmpiXmJiampuXnJmY
|
||||
lpaZmJqYmZmbnJ2jrLGwsbSwopSDfIeXrLu/vr28urq4s7OzsrK0trW3ubu8v8G/
|
||||
v7++vr27ur27vLy7ubW2uby7t7e1ube1tbe2tLW0sa+mmIFmWldXUlBRT0xOS0xO
|
||||
TVJPTUtKR0lKTEpKTUpJSUlLTUxJTE1PUExJS0tNS0xOTU5MS0xLS09PUVFTUE9R
|
||||
UFNSU1FRVFJNT09OTlBQUlNSUVBRT1JUVFFPUVRUUVNRUE5QUVFSUFFPSk5RUE9P
|
||||
UVNTVlFRTFBPUVJSUlJRT09SUlBQUE9RUlJTVVVTVFVWV1ZYWFZYV1hVVVRTV1ta
|
||||
W11bWVxaXV1aWlpcWllZWllaXV5bV1dXWFpZWldXWVpZVlVXWVlbXFxaXF9cX11f
|
||||
XFxcX15iYWBdXFhaW1pfXFtZV1RWVllXU1NXW2Z9usjT2d/h4+bn6OnpeXp7enl7
|
||||
d3t7enl6eHp4eHl1dG9rZFtRSkdDQkBAQUY/PEVESUREREM9QUFEQUVBPT9BPT8/
|
||||
Pz8+QT5BRENHQkNFRkhJS0xNTkxQTE1SU1NQUlNRUlVWVVVZWlZVU1VWU1ZWVFJQ
|
||||
VlJPUFNXWFZVU1RUUFFPTkxISEdJTEpGREJCQUBAQENHQj07PTo8OzU5Nzc4ODg3
|
||||
Nzg1ODk4ODc5Ozg6ODk3OTk4PD5FQj5AQEBFREU/QlFPSklIR0dHSkxUU1xZUVVZ
|
||||
YFhPU2BaV1RYUU9UWFZKQDo3NzI0NTAyNjQ0Ozg4Njc2Nzk5ODw6Ozo+S0ZLRUdF
|
||||
Q1RMWlVMUU9KT0pPTFVWSlVTVFtTWlNUVlJSTFNOUlRQSlRUWVdaWVVSUldZWlVT
|
||||
U1dUU1pdXFZXW15VVVVOTldSTUdHRzo2NzU2OTk+TV1eYmJYX11aYGleX2lYTVJR
|
||||
Vl5gXFhRUVNYXFJSWl1ZVlFWWlJSU1JcVVhTTlhYWFNTU1lYVVhSTU9RUVRTT05F
|
||||
SEhJRk9NS01OTU9KS1FJTFFRUlNUV1FTV1xdX1lRSERBQkJHRkpJRVJRU1dVYnqW
|
||||
pKekno+Jg3pybWhkZW1yZ1BEPDw+PTs3PDpEQ0E9Ozs7PDs/PEdCOjk9Oz1AQkA9
|
||||
QEFEQj06Ojw7PT9ASUhAPEFCPDg4OTczNDM2NDQ1MzU2ODk6PD5FRk1JUE5WXlJU
|
||||
UkxMTFVVT1BSUFRVVk5ISlNVVVRWWFRUVltYWE9LTUtKSkxJSUhLTU9NSUlMTkxI
|
||||
TU9NR0NHSElLS0xISkhKRkNBQ0RCREJCQz49PDtAPjw6ODg5PDs5Ozg2OkBLWGNo
|
||||
am1tbWtubXB1enp7e36Bg4aGiZKRjo2NjY2LiIiFhoKCd3Vua25vdH2DjI6NjIyO
|
||||
kpGQkpOVko+NiYN4aV5XU01LSUI+PUNHTFFSU05RUlVUWVtcXFZUUlFUU1FPTkxK
|
||||
R0ZCQUBAQUFEQz5CR0pIR0hESUhHRElKSklLS05MUFJVU1JRU1VaWFxdX19iY2lr
|
||||
bW9ycnR3enp5e318fX9/gH6Cg4SFgIOFhoeGh4mMiouOjo6PjY+MjY2RlJKSlJuX
|
||||
lZSUlZaQkpKWl5qTk5aYmpqbm5yampyam5mWl5uenZ+lqK2ytby9tqmcmJiRjJit
|
||||
uL6/vru6uLKuq62vs7a2t7e6u73BwcHAwcG/vcC9vLm4u7e4t7i4ur29urq4tre6
|
||||
uLa5trWzs62onohtXFVUVFJRT01NS0tKS05RS0tKS0xPTklJS0pJSUdLTEtJTEpO
|
||||
S0tHSUpNT05QTk5LS0xQTlBPUFJRTVBRTk9OT05PUlJPUlBQTk9QUFFRT1FRVVNU
|
||||
VFRTUlFWU1JQU1JRUFNVV1RPT1BRT1FSUVNUU1JOTlBPUFBQU1RSUVBSUVNSUVNR
|
||||
UVNVVFRTVVRWVFJTVlhXWVdXU1NTWFtbWl5dXFlZWFhZWFxYVlpYWFlbWVpZWVZX
|
||||
V1dYWVhYWFdXVVRZW1pZWlxdW1peXl1cXGBgX19gYV9fW1pZW1lcW1hWVFVXVVlW
|
||||
U1NVaoS8ytPa3uLk5+jo6el4eXh1eXh9eHt7e3t4eHZ1eHh0cm5jWEtLTEY/PTs8
|
||||
P0NGSklGREVBOz0+RD9BRENAPkE/Oj0+P0A9Pz0+Q0NCQkRJSUlKSUtMTEpLTFBU
|
||||
VlVUVlZSWVteXFpYU1RXWFlVWFlXV1VTVVJPUlZaVldTUVJRUVFOUE1KTE1LSElF
|
||||
QUVEQkVCRUNERD8/Pjs8QDw6Ojo6Ozw5Nzk5PDc2NDQ4Ojg6OTk4Ojc4PEQ7Oj0/
|
||||
PUNCRkNBSUtHSERJTEdKR1BLUVlVV1ZiV1BLU1JVVVZWU1RbWVBJQzo9NzY3NzYy
|
||||
Mjc3ODg0MzU3OTk/Pjo8Oz1ERk9FRkVJSklXUkxWUVBRSlFPV1ZHTU9SXlVdVVdc
|
||||
VlZMUk1QWVJRUFNZWF5eWU9PU1VWVFRSWFBPVllbWlZYWVdUVFFYXFhTUkxKQTo0
|
||||
MjQ1OT5DVFhPV1paYFtgX15gX1FPUlRUWltbVlNPUVdWUlhXXVZVVldaVlNWVllZ
|
||||
VFNPTVNRTVFPUlNUUVVUUlhVU1ZRS0lLRk1LSFFPTVFNTUpLT01LUlRMTVNVU1BU
|
||||
V1tiWFVQSUNDQEVDSEhHVVJYWlBYXn6Ypqiil4qBfHp4cGttcHNtYFBDOz47Ojo3
|
||||
OT07ODo7Oz88OjxAREA8Pj07OjxBQTw4PUFEQTxAPTtBRUVGR0U+QEI+ODUzMzc2
|
||||
Njc4ODQxNDY3OTs8P0RKR0hSTlVfVVtRT09RU1VSUVJTU1JQS05OTVJXVVZUUVNY
|
||||
VVRSTUxOSUtMSktKTEpJTEpKRkdLTE1NT01NSklJSktOTkpGREdGQUFERUREREI9
|
||||
Pj4/Ozc5ODo5Njc6OTs5NzpBSlhja21vb3RxcHBucnp9eXl6fH+EhIWGjo2Njo+N
|
||||
j4+MiYuLhH54cm5tb3BzfYaLjo6MjpKSkpORlJeWkpCHfnNrYVdWVVRMQj0/RE9V
|
||||
UVJQUVFRVFtcXF1dXFlWVlZXV1FRTk9NS0VDQ0FBQUFAP0FER0dHR0dHSUhKSkxL
|
||||
TEpJTlJOUFFUVlNWVltcYGBfZGhnaW5wcnR2dXh6eXt8f4GBgoKAg4GBgoODgoSE
|
||||
iIiHio6Ni4+Sk46KjY6Qk5WVkpGUlJOSlpKSlJWTkpOYmJiYmZial5iZm5mZmpye
|
||||
nZ+foKGip7Cyt7e5vLyznpKcn5aVorO5wcC/wLm2sa2rrK+zuLa4uL2/v768vMDA
|
||||
wsG+wL68vra1tLK1tri8vbi6ubi2tre3tra1tbW4trGroY1tW1hUVFNNTk5KSktP
|
||||
T0tLSkpMSktNTExLS0tLSkxKSUlMTUtLSk5JSE1OTk9MTE9RT0xNUFBRU1BPTU1P
|
||||
UFBTUlFPUlFOUVNRUFFRUU9OUFFTU1NTUlNUVFJTUU5QUlJUVVRUU1ZST1BPUFFS
|
||||
UVBOUVJPUFJSUFJRU1NRUFFSVFNSVFNUVFFRU1RXVlVXVFlYWFhZWFhVWFZUWFdX
|
||||
XV1cWFdYWVdaWFdaVVVaWVlaWVdaWVlYVVdaWVlXWFlbWFdYWVpdW1xcXlpbX2Fj
|
||||
YmBhYV9fX15cXl9aWFlVUFZWV1lYWVlXU1VvorzJ0tre4eTm5+jq6nl3d3l4d3h6
|
||||
ent8fHh2dXN1d3NxbGFUSkdGSEM7Pj89QUhJRkZFQ0RFQ0JCQj09PTg8PUE7Oj4+
|
||||
Qz0/QEFDQkVHR0pJSUxLTU1MTExLT1FSVFNTVVRVWFdXV1ZRUlNWVlVXWFlXWlta
|
||||
VFZXWlxZV1VTVVBTUU1NTEtNS05MR0pMSEVER0ZISEVERD4+Ozs6Ozs6OTk6Ojc1
|
||||
NTY5ODY2Njg2NzY4ODk3PDo4Pjw8PD9CRUFBPT5GRkVLTEZLTVFKSkxSW1daV11Z
|
||||
SlJWVlNSV1pUU1dXVlZQQjo7OTU1NDMyNjc0NTZINzc3OTo8PT07QUJDUkpOS0hN
|
||||
R1RRTlRQTlFIUFJVVEhSUVJgV1ZSWmFeYFJVTk5VUlJQV1lUVVZQSk5OUVZYVFBP
|
||||
UFNUWV1XUlRZWFlXVFVcXlpWWFBCOTIyMzc2PUNNV01TWlpbW1paXl1VVFZXVVZZ
|
||||
V1lcUk1OU1BVXVlaVlNTUVNYVVVbUk9VT05JTE9SUU9QUVZVUlNVWFlUS05LTFFU
|
||||
V09SUFNSUVRNSkpNUk5OV1FNVFpSTlRcYVxYW1FKQ0JER0NFR0hTTFFUTlVWbYma
|
||||
paOelImBfXx7dnRxcXBpWkY9Oj1COTQ5Ozs7QTk6Pzw7Ozs/QEJDPDo6PkBFPjtA
|
||||
QkRFQjk6PUJGREZEQkFCRj04MzQ1ODk1NTM5NzQ0NTk6Oj49P0JFSFRRWFlSXFNS
|
||||
VlZXVVRTU1ZTUFNNTU5PUFRUV1lRTk5SU09MTU5PUVBKS01MSkhIS0pJR0hDR0tL
|
||||
TUtFSk1OS0tIR0VHRkhEQ0NGRENBPj89PT87PDs4Ojw4OTo4Njk9QUxZZG1vb3By
|
||||
cnFzcnR2fH99eHh7gISHjJKJjpGRk5WSkpKOiomIgHx0cm5vcXV+hIeLjo+SlZiY
|
||||
mJWUlZmSjIJ4cG1jVE5NTkxIQ0ZMVFhXVldUVldYXWBiX19gXFxbWlhXU1FPTk1L
|
||||
@@ -1,136 +0,0 @@
|
||||
TUxOT1JVUFNUVlVRT1VYWVdXUlJUT1FPU1VPT01PUE9WVlFSUFJRTkxKTU1PTEtJ
|
||||
R0JDR0RDQEBBQD8/PDs/PD0+Pz44NzY1NjY5ODw5OT08Nzk5ODs8QUNBQj9BQUND
|
||||
QklLSk5KSU9TXlhLT0xWUlFaVFdMTVdVW1VgWVdWXV9dWFtWUlFSTkVERTk1NTUz
|
||||
MzUzNjU0ODg1ODY2Nzk6PTo6P0NETE1JR1RSTFBISkpKVVVLSUpUTU5STVZRVFpT
|
||||
Vk5XXGBYUFhVWFJTV19kXVdVUFdVVlZUW1xbWlhZV1pcWE9TWlRWWVlXUE1MTlJD
|
||||
PDo8Ozo+P0pOTVhWVFJWW15oYFxbXlpUVlpZXFhYVVdXUFlcYFhUVFdaW1RQXVxc
|
||||
XltXUVBSTU1RUVRYVVNNSU1RUFFWVFFST05QUk9OSU5QTk1KS1BVSkxLTE5LT1RO
|
||||
VlRZWlZYVE1FRkVHR0ZLSU9LTlFOXWaJo7CspZ2WlZOJfXFmYmFqdG9eS0E+OTk4
|
||||
ODtBQTw9Ojg5PD5EQT8/P0BAPDc6OEE+Pzo+QENAPDtBQENDRkNDR0A6QEQ8ODU0
|
||||
MTQ3NTg3Mzc2NDg0OTs/RUpTS05JT1xYWVlUXFZWVVtdWVlXUE5TUlJQT1BUVlZR
|
||||
VFVYW1NRTkxMUlZUUEtMTk9PTE1MSERESUpLSkxJRklJSUtLRkRJSEVCRENERUZE
|
||||
QkNBQ0JEQ0FAPjk6PDo3OTc3ODU2ODY2NTc+Rk9YYmdqaGhna3B3e3x+gYGBgYaH
|
||||
iYuKi4uKioWCfXdwbmpnaWlsb3eCiIuMjYmJjo6SkJCTl5ORjIaBfnZnVEc/Ojo6
|
||||
ODo7P0RJSkxPUlVWWVhWVlVSVFFRT05JRkVARD5BPkBCRERDQ0ZGRUdFSUpKSkpK
|
||||
SklOS0xNTkxOT05MS0tMTk9NT1ZWU1dZWl1eXWJkZ2hqbm91dXV4fH5/gYB/gYOC
|
||||
hYmGiIiHh4iGh4qLi4qMjY2Li4uLjZKTlpeWlpSPjo+SkZOQkpGRlZiXlpaZmZuZ
|
||||
mZibl5mZmJiampual5aYnKCpr7KqmImGiJWosbzAvLu5u7i1tbGwsbKzt7a8vcC/
|
||||
vL29vr6/v7q8vLq8vrq4ube1tLe3t7S0ta2ysrK1tKyginBfXVhTUlBOTVBMTU9M
|
||||
S0tLSUpLSkhJSkdPT05KSUdNS0lJSE1LSkxKTk9MTUtNSk9OTUxPUU5NUE9OT0xM
|
||||
Tk5QUVFQUU9QUVJSVFVSUlNTU1JRTlJTUFBSVFRSUlFTT09RUlBSUVNTUU9QUVNV
|
||||
VVVVUVFSU1FVU1JSUFFSU1hUUVFPUVRQUVJRU1NUVVZYWFZWWlhYVFFVWFhXVlhW
|
||||
WFhaWltbWF5bV1dYVlhbWFZYWVlaWVlYV1laWVpZV1taWVlaWlpaWVtcXV1cXF1d
|
||||
YF9dYF5dXV1dYF5bXV1cWlxWV1dYV1ZWWFdYV1ZZXIO9ydPa3uHk5efo6el7enh5
|
||||
ent8eHd1dnl2dnh6enl4eXdwZ1pMR0VFSkVEQz09Q0hKQ0A/P0I/PEJCQT4+PTpA
|
||||
RURFQ0RHQ0RBPT5ARkhJSkxMTk1JS05QTklKTk5QUVNUU1FXU1ddWVVRUFFTU1JQ
|
||||
UlBQT0tRVVVVU1JSUFJNSktPT0tJSUhHREVFQ0dEQkNAPj0+PTw7Ozs6OTw2Nzk4
|
||||
ODg6PDs5OTg3Nzs4Ojw7Ozw9PURBQkQ/RktGS0tISUpRVU5RTUpTT1lTV1VOVlNc
|
||||
WV1cWVddY1xdXllPT1JVT0pAODc1MzU5Njc6OTs3Njg2NTc7ODg4OTg+Q0dPUEpH
|
||||
VVRMUUxRSkpUTklOSVNSTU1KV1RSWlFYVFRVWVdNUFJeVFRVYWFdXVZQUVVYV1VZ
|
||||
VFdYWVhZXGVhVlRbW1pXUU1LTFBMTkhAOTg6OTk7Q1BSVVldWFpeXmFhY2VjXlNR
|
||||
U1BXWFVVUVZYWFdWU1NTVVZaV09WWVlaWlNQTUtOUE1OUlhZVFFXUE1NUFBQTlFS
|
||||
UFJWTU1OS0pRSkVJUFBNSkpNUEtPVFVXV1lXVldXU0hGRUdJSVBJSUhOVE9RWnWU
|
||||
qauroZiVkYl8c2xmY2VrdWlSQTs6Ozg7OTw8Oz08PDw7Ozw7PTtAPj09Pj1BQUJA
|
||||
OTo+QUQ9OD1FQUM+RUJCOzY9Q0E4ODU0NDY2NjQ0MzI1Njg4Oz1ESkpISkpTWlhY
|
||||
W1ZZV1hTVldOUVNOTE5OUlFQVFlYU01XV1dWU09MSktOUlRTUU1PT0xQTklFR0ZL
|
||||
TU1LS0dHR0dJSkpGRUNGSExHQ0RDREVBQD9APz5AOzs+QD88Pjw4NjY0Njc5Nzg7
|
||||
QUpTXmRmaGdoaGxwdHp7fXmBh4eHhoyQj5CNjYuJhYJ8dnN1b2xtbGtze4SJjI6M
|
||||
iImOj5KUlpWVk5GQi4B3a11RRj5APkFAQUFCSEpLTVBQU1hYWFZWV1NRUlBQTkxJ
|
||||
RkdDQT5AP0NDQkNARERJR0lJRkhHSUtQUE1MS0tNTExNTE1NT1FSUFBVVVVXWF1f
|
||||
XmNjZGdsbG5zdXZ1dnt9f4CDg4F/goOFhYaGh4uHhoWJi4mKi4mIiouNjIuMkZGR
|
||||
lpSUj5GQkpKSkpWTkpaXl5OVlpmbmpiYmZmZmJqWlZeYl5iZmp+jqrO5s6aTgXeB
|
||||
mK64vby7urq9ure0srSztba1t7m9vsDDwr69vb+9uru+wL69vbi3tbSztbq1tLe4
|
||||
rrOztrW1saylknplXFZUVVNPTU9PTk5NTU1NSkhISkpJR0lKS0lKUEpKS0xPTVBL
|
||||
TUxKS01KTExMTkpPTktQUE5PT09QTU5NUFBSUlNST1BPT05ST05PUVFTVlJSU1NS
|
||||
UlRTUVJTUVBRUU5RTlFSU1NQTk5NUFVTUlBSUVBRVFRTU1NSVFJQUlVUVlNUVFFS
|
||||
UFNVU1JUVVVWVVZXV1VWV1dWVVVYWVhZW1pYWVtdXF5aW1hZWFZZWVhYWlpYV1dY
|
||||
WFZXW1tZWFlYWVhWWVlZXFxcW11cXltcXltdXlxdX19dXl5bXVtbWFlYV1VXV1ZU
|
||||
VlVVVVdgfLvJ0dre4eTm5+jp6nl7e3x7eHp6dnh5dnd4dXd4dnZ5cmlgUkhCQEJH
|
||||
QEM/PkFCRERBQERDQz4/QkU7PD1CPkBBQUFAQEFDR0I9PENCR0dISEdJTklMT01P
|
||||
UlFNUFBRUlJZVVVWV1ZUU1hSVFZVUlJTUlBRUVNTVFVSUFFOUE5NTExPTUtIREhH
|
||||
RENDQkJFQj5APkE/Pz87Oj08Oz04Nzc4NzxBODQ1Nzc4Ozo6Ojg2OTs7Ozs+QT9D
|
||||
SUdISEZGRkpQS01LRElHTEpLVVRaWVhZXFtZVlhgX1xXV1BVblVUSkA5NzQ1NDc1
|
||||
NTQzNDQ0NDg1Njc2NTg7PD8+PkpJTUZNT0dPS1JNSFBLRkxIS0hLSk1UVFlgVl5X
|
||||
UVJUVUxRT1ZVUlFZXVpWVFJTVllZV1dUVFtaWltfZl1VWFtcVlZVT0tTUElIR0Q5
|
||||
NzY3Njk/SVJWWmxlWlxdWWBpYV9kV1JUUVJcWlhTT1NSV1pTVFNTVlVXVlZVWFJU
|
||||
WlNPS01VVVpaWVVYV1VWUU5QTk5PUFVRTE1LS0xIRU5KSEpOTk1JR01MSVBVWlxT
|
||||
VFhcWFpZTkdDQEFFS0VISElTUU9WYniWpqiooJeOhn92a2NgYGZwbV5JOzs/QkI7
|
||||
ODs9OkA+PDw6OT1APj4+SDw6Oz4/QkA7O0A9Pz5CPDs8QTxDQkJJPzpBPzo8Ozg2
|
||||
NzQ3NjczMjQ2Nzg7PT9HS0RJR01SUldSUE9OT01VWFJWVE5LTlFTUlBSVldSVFhW
|
||||
VFJWUVBNTEhLTFJUTExNS05OSUZITE1LS0pKT0pGREVGRkdIRklKSUlERURCQ0NC
|
||||
Q0E+PDk9QD9BPzw6ODo4OTo9Ojg5PUdQW2VqamlrbWttcnd6fH19fYKDiI2Ojo2N
|
||||
jo6LjIiIhX58eXVzcW9sb3d/hIyOkI+Lio6QkZOYlpSTjYuHgXJkWE1IRD89QEJF
|
||||
RUZMT0xPUVNUVlhaW1lXVVNSUlJPTUtNS0dDQUJEQkJDRUZGR0hFR0dHQ0dHSEtI
|
||||
SEtJS05LS0xSUVNQTlFUUlVZWFlcXWFlZ2hsbW9zcnV8fH9+fX+AgYGBg4SEg4KD
|
||||
hYOCh4eHh4eJi4qKi4uOjI2KjpGSlZWUmZaSkpeWkI6TmJWYmpiXmJiampuXnJmY
|
||||
lpaZmJqYmZmbnJ2jrLGwsbSwopSDfIeXrLu/vr28urq4s7OzsrK0trW3ubu8v8G/
|
||||
v7++vr27ur27vLy7ubW2uby7t7e1ube1tbe2tLW0sa+mmIFmWldXUlBRT0xOS0xO
|
||||
TVJPTUtKR0lKTEpKTUpJSUlLTUxJTE1PUExJS0tNS0xOTU5MS0xLS09PUVFTUE9R
|
||||
UFNSU1FRVFJNT09OTlBQUlNSUVBRT1JUVFFPUVRUUVNRUE5QUVFSUFFPSk5RUE9P
|
||||
UVNTVlFRTFBPUVJSUlJRT09SUlBQUE9RUlJTVVVTVFVWV1ZYWFZYV1hVVVRTV1ta
|
||||
W11bWVxaXV1aWlpcWllZWllaXV5bV1dXWFpZWldXWVpZVlVXWVlbXFxaXF9cX11f
|
||||
XFxcX15iYWBdXFhaW1pfXFtZV1RWVllXU1NXW2Z9usjT2d/h4+bn6OnpeXp7enl7
|
||||
d3t7enl6eHp4eHl1dG9rZFtRSkdDQkBAQUY/PEVESUREREM9QUFEQUVBPT9BPT8/
|
||||
Pz8+QT5BRENHQkNFRkhJS0xNTkxQTE1SU1NQUlNRUlVWVVVZWlZVU1VWU1ZWVFJQ
|
||||
VlJPUFNXWFZVU1RUUFFPTkxISEdJTEpGREJCQUBAQENHQj07PTo8OzU5Nzc4ODg3
|
||||
Nzg1ODk4ODc5Ozg6ODk3OTk4PD5FQj5AQEBFREU/QlFPSklIR0dHSkxUU1xZUVVZ
|
||||
YFhPU2BaV1RYUU9UWFZKQDo3NzI0NTAyNjQ0Ozg4Njc2Nzk5ODw6Ozo+S0ZLRUdF
|
||||
Q1RMWlVMUU9KT0pPTFVWSlVTVFtTWlNUVlJSTFNOUlRQSlRUWVdaWVVSUldZWlVT
|
||||
U1dUU1pdXFZXW15VVVVOTldSTUdHRzo2NzU2OTk+TV1eYmJYX11aYGleX2lYTVJR
|
||||
Vl5gXFhRUVNYXFJSWl1ZVlFWWlJSU1JcVVhTTlhYWFNTU1lYVVhSTU9RUVRTT05F
|
||||
SEhJRk9NS01OTU9KS1FJTFFRUlNUV1FTV1xdX1lRSERBQkJHRkpJRVJRU1dVYnqW
|
||||
pKekno+Jg3pybWhkZW1yZ1BEPDw+PTs3PDpEQ0E9Ozs7PDs/PEdCOjk9Oz1AQkA9
|
||||
QEFEQj06Ojw7PT9ASUhAPEFCPDg4OTczNDM2NDQ1MzU2ODk6PD5FRk1JUE5WXlJU
|
||||
UkxMTFVVT1BSUFRVVk5ISlNVVVRWWFRUVltYWE9LTUtKSkxJSUhLTU9NSUlMTkxI
|
||||
TU9NR0NHSElLS0xISkhKRkNBQ0RCREJCQz49PDtAPjw6ODg5PDs5Ozg2OkBLWGNo
|
||||
am1tbWtubXB1enp7e36Bg4aGiZKRjo2NjY2LiIiFhoKCd3Vua25vdH2DjI6NjIyO
|
||||
kpGQkpOVko+NiYN4aV5XU01LSUI+PUNHTFFSU05RUlVUWVtcXFZUUlFUU1FPTkxK
|
||||
R0ZCQUBAQUFEQz5CR0pIR0hESUhHRElKSklLS05MUFJVU1JRU1VaWFxdX19iY2lr
|
||||
bW9ycnR3enp5e318fX9/gH6Cg4SFgIOFhoeGh4mMiouOjo6PjY+MjY2RlJKSlJuX
|
||||
lZSUlZaQkpKWl5qTk5aYmpqbm5yampyam5mWl5uenZ+lqK2ytby9tqmcmJiRjJit
|
||||
uL6/vru6uLKuq62vs7a2t7e6u73BwcHAwcG/vcC9vLm4u7e4t7i4ur29urq4tre6
|
||||
uLa5trWzs62onohtXFVUVFJRT01NS0tKS05RS0tKS0xPTklJS0pJSUdLTEtJTEpO
|
||||
S0tHSUpNT05QTk5LS0xQTlBPUFJRTVBRTk9OT05PUlJPUlBQTk9QUFFRT1FRVVNU
|
||||
VFRTUlFWU1JQU1JRUFNVV1RPT1BRT1*SUVNUU1JOTlBPUFBQU1RSUVBSUVNSUVNR
|
||||
UVNVVFRTVVRWVFJTVlhXWVdXU1NTWFtbWl5dXFlZWFhZWFxYVlpYWFlbWVpZWVZX
|
||||
V1dYWVhYWFdXVVRZW1pZWlxdW1peXl1cXGBgX19gYV9fW1pZW1lcW1hWVFVXVVlW
|
||||
U1NVaoS8ytPa3uLk5+jo6el4eXh1eXh9eHt7e3t4eHZ1eHh0cm5jWEtLTEY/PTs8
|
||||
P0NGSklGREVBOz0+RD9BRENAPkE/Oj0+P0A9Pz0+Q0NCQkRJSUlKSUtMTEpLTFBU
|
||||
VlVUVlZSWVteXFpYU1RXWFlVWFlXV1VTVVJPUlZaVldTUVJRUVFOUE1KTE1LSElF
|
||||
QUVEQkVCRUNERD8/Pjs8QDw6Ojo6Ozw5Nzk5PDc2NDQ4Ojg6OTk4Ojc4PEQ7Oj0/
|
||||
PUNCRkNBSUtHSERJTEdKR1BLUVlVV1ZiV1BLU1JVVVZWU1RbWVBJQzo9NzY3NzYy
|
||||
Mjc3ODg0MzU3OTk/Pjo8Oz1ERk9FRkVJSklXUkxWUVBRSlFPV1ZHTU9SXlVdVVdc
|
||||
VlZMUk1QWVJRUFNZWF5eWU9PU1VWVFRSWFBPVllbWlZYWVdUVFFYXFhTUkxKQTo0
|
||||
MjQ1OT5DVFhPV1paYFtgX15gX1FPUlRUWltbVlNPUVdWUlhXXVZVVldaVlNWVllZ
|
||||
VFNPTVNRTVFPUlNUUVVUUlhVU1ZRS0lLRk1LSFFPTVFNTUpLT01LUlRMTVNVU1BU
|
||||
V1tiWFVQSUNDQEVDSEhHVVJYWlBYXn6Ypqiil4qBfHp4cGttcHNtYFBDOz47Ojo3
|
||||
OT07ODo7Oz88OjxAREA8Pj07OjxBQTw4PUFEQTxAPTtBRUVGR0U+QEI+ODUzMzc2
|
||||
Njc4ODQxNDY3OTs8P0RKR0hSTlVfVVtRT09RU1VSUVJTU1JQS05OTVJXVVZUUVNY
|
||||
VVRSTUxOSUtMSktKTEpJTEpKRkdLTE1NT01NSklJSktOTkpGREdGQUFERUREREI9
|
||||
Pj4/Ozc5ODo5Njc6OTs5NzpBSlhja21vb3RxcHBucnp9eXl6fH+EhIWGjo2Njo+N
|
||||
j4+MiYuLhH54cm5tb3BzfYaLjo6MjpKSkpORlJeWkpCHfnNrYVdWVVRMQj0/RE9V
|
||||
UVJQUVFRVFtcXF1dXFlWVlZXV1FRTk9NS0VDQ0FBQUFAP0FER0dHR0dHSUhKSkxL
|
||||
TEpJTlJOUFFUVlNWVltcYGBfZGhnaW5wcnR2dXh6eXt8f4GBgoKAg4GBgoODgoSE
|
||||
iIiHio6Ni4+Sk46KjY6Qk5WVkpGUlJOSlpKSlJWTkpOYmJiYmZial5iZm5mZmpye
|
||||
nZ+foKGip7Cyt7e5vLyznpKcn5aVorO5wcC/wLm2sa2rrK+zuLa4uL2/v768vMDA
|
||||
wsG+wL68vra1tLK1tri8vbi6ubi2tre3tra1tbW4trGroY1tW1hUVFNNTk5KSktP
|
||||
T0tLSkpMSktNTExLS0tLSkxKSUlMTUtLSk5JSE1OTk9MTE9RT0xNUFBRU1BPTU1P
|
||||
UFBTUlFPUlFOUVNRUFFRUU9OUFFTU1NTUlNUVFJTUU5QUlJUVVRUU1ZST1BPUFFS
|
||||
UVBOUVJPUFJSUFJRU1NRUFFSVFNSVFNUVFFRU1RXVlVXVFlYWFhZWFhVWFZUWFdX
|
||||
XV1cWFdYWVdaWFdaVVVaWVlaWVdaWVlYVVdaWVlXWFlbWFdYWVpdW1xcXlpbX2Fj
|
||||
YmBhYV9fX15cXl9aWFlVUFZWV1lYWVlXU1V#orzJ0tre4eTm5+jq6nl3d3l4d3h6
|
||||
ent8fHh2dXN1d3NxbGFUSkdGSEM7Pj89QUhJRkZFQ0RFQ0JCQj09PTg8PUE7Oj4+
|
||||
Qz0/QEFDQkVHR0pJSUxLTU1MTExLT1FSVFNTVVRVWFdXV1ZRUlNWVlVXWFlXWlta
|
||||
VFZXWlxZV1VTVVBTUU1NTEtNS05MR0pMSEVER0ZISEVERD4+Ozs6Ozs6OTk6Ojc1
|
||||
NTY5ODY2Njg2NzY4ODk3PDo4Pjw8PD9CRUFBPT5GRkVLTEZLTVFKSkxSW1daV11Z
|
||||
SlJWVlNSV1pUU1dXVlZQQjo7OTU1NDMyNjc0NTZINzc3OTo8PT07QUJDUkpOS0hN
|
||||
R1RRTlRQTlFIUFJVVEhSUVJgV1ZSWmFeYFJVTk5VUlJQV1lUVVZQSk5OUVZYVFBP
|
||||
UFNUWV1XUlRZWFlXVFVcXlpWWFBCOTIyMzc2PUNNV01TWlpbW1paXl1VVFZXVVZZ
|
||||
V1lcUk1OU1BVXVlaVlNTUVNYVVVbUk9VT05JTE9SUU9QUVZVUlNVWFlUS05LTFFU
|
||||
V09SUFNSUVRNSkpNUk5OV1FNVFpSTlRcYVxYW1FKQ0JER0NFR0hTTFFUTlVWbYma
|
||||
paOelImBfXx7dnRxcXBpWkY9Oj1COTQ5Ozs7QTk6Pzw7Ozs/QEJDPDo6PkBFPjtA
|
||||
QkRFQjk6PUJGREZEQkFCRj04MzQ1ODk1NTM5NzQ0NTk6Oj49P0JFSFRRWFlSXFNS
|
||||
VlZXVVRTU1ZTUFNNTU5PUFRUV1lRTk5SU09MTU5PUVBKS01MSkhIS0pJR0hDR0tL
|
||||
TUtFSk1OS0tIR0VHRkhEQ0NGRENBPj89PT87PDs4Ojw4OTo4Njk9QUxZZG1vb3By
|
||||
cnFzcnR2fH99eHh7gISHjJKJjpGRk5WSkpKOiomIgHx0cm5vcXV+hIeLjo+SlZiY
|
||||
mJWUlZmSjIJ4cG1jVE5NTkxIQ0ZMVFhXVldUVldYXWBiX19gXFxbWlhXU1FPTk1L
|
||||
Reference in New Issue
Block a user