mirror of
				https://github.com/boostorg/algorithm.git
				synced 2025-11-04 09:41:39 +01:00 
			
		
		
		
	
		
			
				
	
	
		
			273 lines
		
	
	
		
			11 KiB
		
	
	
	
		
			C++
		
	
	
		
			Executable File
		
	
	
	
	
			
		
		
	
	
			273 lines
		
	
	
		
			11 KiB
		
	
	
	
		
			C++
		
	
	
		
			Executable File
		
	
	
	
	
/* 
 | 
						|
   Copyright (c) Marshall Clow 2010-2012.
 | 
						|
 | 
						|
   Distributed under the Boost Software License, Version 1.0. (See accompanying
 | 
						|
   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
 | 
						|
 | 
						|
    For more information, see http://www.boost.org
 | 
						|
*/
 | 
						|
 | 
						|
#include <boost/algorithm/searching/boyer_moore.hpp>
 | 
						|
#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
 | 
						|
#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
 | 
						|
 | 
						|
#include <boost/test/included/test_exec_monitor.hpp>
 | 
						|
 | 
						|
#include <iostream>
 | 
						|
#include <string>
 | 
						|
#include <vector>
 | 
						|
 | 
						|
 | 
						|
namespace ba = boost::algorithm;
 | 
						|
 | 
						|
template <typename Iter>
 | 
						|
std::string make_str ( Iter first, std::size_t len ) {
 | 
						|
    std::string retVal ( len + 2, '\'' );
 | 
						|
    std::copy ( first, first+len, retVal.begin () + 1);
 | 
						|
    return retVal;
 | 
						|
    }
 | 
						|
 | 
						|
namespace {
 | 
						|
 | 
						|
//  Check using iterators
 | 
						|
    template<typename Container>
 | 
						|
    void check_one_iter ( const Container &haystack, const std::string &needle, int expected ) {
 | 
						|
        typedef typename Container::const_iterator iter_type;
 | 
						|
        typedef std::string::const_iterator pattern_type;
 | 
						|
 | 
						|
        iter_type hBeg = haystack.begin ();
 | 
						|
        iter_type hEnd = haystack.end ();
 | 
						|
        pattern_type nBeg = needle.begin ();
 | 
						|
        pattern_type nEnd = needle.end ();
 | 
						|
 | 
						|
        iter_type it0  = std::search                     (hBeg, hEnd, nBeg, nEnd);
 | 
						|
        iter_type it1  = ba::boyer_moore_search          (hBeg, hEnd, nBeg, nEnd);
 | 
						|
        iter_type it1r = ba::boyer_moore_search          (haystack, nBeg, nEnd);
 | 
						|
        iter_type it2  = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd);
 | 
						|
        iter_type it3  = ba::knuth_morris_pratt_search   (hBeg, hEnd, nBeg, nEnd);
 | 
						|
        const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
 | 
						|
 | 
						|
        std::cout << "(Iterators) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
 | 
						|
        try {
 | 
						|
            if ( it0 != it1 ) {
 | 
						|
                throw std::runtime_error ( 
 | 
						|
                    std::string ( "results mismatch between std::search and boyer-moore search" ));
 | 
						|
                }
 | 
						|
 | 
						|
            if ( it1 != it1r ) {
 | 
						|
                throw std::runtime_error ( 
 | 
						|
                    std::string ( "results mismatch between iterator and range boyer_moore search" ));
 | 
						|
                }
 | 
						|
 | 
						|
            if ( it1 != it2 ) {
 | 
						|
                throw std::runtime_error ( 
 | 
						|
                    std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
 | 
						|
                }
 | 
						|
 | 
						|
            if ( it1 != it3 )
 | 
						|
                throw std::runtime_error ( 
 | 
						|
                    std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
 | 
						|
 | 
						|
            }
 | 
						|
 | 
						|
        catch ( ... ) {
 | 
						|
            std::cout << "Searching for: " << needle << std::endl;
 | 
						|
            std::cout << "Expected: " << expected << "\n";
 | 
						|
            std::cout << "  std:    " << std::distance ( hBeg, it0 ) << "\n";
 | 
						|
            std::cout << "  bm:     " << std::distance ( hBeg, it1 ) << "\n";
 | 
						|
            std::cout << "  bm(r):  " << std::distance ( hBeg, it1r ) << "\n";
 | 
						|
            std::cout << "  bmh:    " << std::distance ( hBeg, it2 ) << "\n";
 | 
						|
            std::cout << "  kpm:    " << std::distance ( hBeg, it3 )<< "\n";
 | 
						|
            std::cout << std::flush;
 | 
						|
            throw ;
 | 
						|
            }
 | 
						|
 | 
						|
        BOOST_CHECK_EQUAL ( dist, expected );
 | 
						|
        }
 | 
						|
 | 
						|
//  Check using pointers
 | 
						|
//    We're assuming that the container implements contiguous storage here.
 | 
						|
    template<typename Container>
 | 
						|
    void check_one_pointer ( const Container &haystack, const std::string &needle, int expected ) {
 | 
						|
        typedef const typename Container::value_type *ptr_type;
 | 
						|
        ptr_type hBeg = haystack.size () == 0 ? NULL : &*haystack.begin ();
 | 
						|
        ptr_type hEnd = hBeg + haystack.size ();
 | 
						|
        ptr_type nBeg = needle.size () == 0 ? NULL : &*needle.begin ();
 | 
						|
        ptr_type nEnd = nBeg + needle.size ();
 | 
						|
 | 
						|
        ptr_type it0  = std::search                     (hBeg, hEnd, nBeg, nEnd);
 | 
						|
        ptr_type it1  = ba::boyer_moore_search          (hBeg, hEnd, nBeg, nEnd);
 | 
						|
        ptr_type it2  = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd);
 | 
						|
        ptr_type it3  = ba::knuth_morris_pratt_search   (hBeg, hEnd, nBeg, nEnd);
 | 
						|
        const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
 | 
						|
 | 
						|
        std::cout << "(Pointers) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
 | 
						|
        try {
 | 
						|
            if ( it0 != it1 ) {
 | 
						|
                throw std::runtime_error ( 
 | 
						|
                    std::string ( "results mismatch between std::search and boyer-moore search" ));
 | 
						|
                }
 | 
						|
 | 
						|
            if ( it1 != it2 ) {
 | 
						|
                throw std::runtime_error ( 
 | 
						|
                    std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
 | 
						|
                }
 | 
						|
 | 
						|
            if ( it1 != it3 )
 | 
						|
                throw std::runtime_error ( 
 | 
						|
                    std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
 | 
						|
 | 
						|
            }
 | 
						|
 | 
						|
        catch ( ... ) {
 | 
						|
            std::cout << "Searching for: " << needle << std::endl;
 | 
						|
            std::cout << "Expected: " << expected << "\n";
 | 
						|
            std::cout << "  std:    " << std::distance ( hBeg, it0 ) << "\n";
 | 
						|
            std::cout << "  bm:     " << std::distance ( hBeg, it1 ) << "\n";
 | 
						|
            std::cout << "  bmh:    " << std::distance ( hBeg, it2 ) << "\n";
 | 
						|
            std::cout << "  kpm:    " << std::distance ( hBeg, it3 )<< "\n";
 | 
						|
            std::cout << std::flush;
 | 
						|
            throw ;
 | 
						|
            }
 | 
						|
 | 
						|
        BOOST_CHECK_EQUAL ( dist, expected );
 | 
						|
        }
 | 
						|
 | 
						|
//  Check using objects
 | 
						|
    template<typename Container>
 | 
						|
    void check_one_object ( const Container &haystack, const std::string &needle, int expected ) {
 | 
						|
        typedef typename Container::const_iterator iter_type;
 | 
						|
        typedef std::string::const_iterator pattern_type;
 | 
						|
 | 
						|
        iter_type hBeg = haystack.begin ();
 | 
						|
        iter_type hEnd = haystack.end ();
 | 
						|
        pattern_type nBeg = needle.begin ();
 | 
						|
        pattern_type nEnd = needle.end ();
 | 
						|
 | 
						|
        ba::boyer_moore<pattern_type>          bm_r  = ba::make_boyer_moore ( needle );
 | 
						|
        ba::boyer_moore<pattern_type>          bm    ( nBeg, nEnd );
 | 
						|
        ba::boyer_moore_horspool<pattern_type> bmh   ( nBeg, nEnd );
 | 
						|
        ba::knuth_morris_pratt<pattern_type>   kmp   ( nBeg, nEnd );
 | 
						|
        
 | 
						|
        iter_type it0  = std::search  (hBeg, hEnd, nBeg, nEnd);
 | 
						|
        iter_type it1  = bm           (hBeg, hEnd);
 | 
						|
        iter_type it1r = bm           (haystack);
 | 
						|
        iter_type rt1  = bm_r         (hBeg, hEnd);
 | 
						|
        iter_type rt1r = bm_r         (haystack);
 | 
						|
        iter_type it2  = bmh          (hBeg, hEnd);
 | 
						|
        iter_type it3  = kmp          (hBeg, hEnd);
 | 
						|
        const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
 | 
						|
 | 
						|
        std::cout << "(Objects) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
 | 
						|
        try {
 | 
						|
            if ( it0 != it1 ) {
 | 
						|
                throw std::runtime_error ( 
 | 
						|
                    std::string ( "results mismatch between std::search and boyer-moore search" ));
 | 
						|
                }
 | 
						|
 | 
						|
            if ( it1 != it1r ) {
 | 
						|
                throw std::runtime_error ( 
 | 
						|
                    std::string ( "results mismatch between iterator and range boyer_moore search(1)" ));
 | 
						|
                }
 | 
						|
 | 
						|
            if ( it1 != rt1 ) {
 | 
						|
                throw std::runtime_error ( 
 | 
						|
                    std::string ( "results mismatch between iterator and range boyer_moore search(2)" ));
 | 
						|
                }
 | 
						|
 | 
						|
            if ( rt1 != rt1r ) {
 | 
						|
                throw std::runtime_error ( 
 | 
						|
                    std::string ( "results mismatch between iterator and range boyer_moore search(3)" ));
 | 
						|
                }
 | 
						|
 | 
						|
            if ( it1 != it2 ) {
 | 
						|
                throw std::runtime_error ( 
 | 
						|
                    std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
 | 
						|
                }
 | 
						|
 | 
						|
            if ( it1 != it3 )
 | 
						|
                throw std::runtime_error ( 
 | 
						|
                    std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
 | 
						|
 | 
						|
            }
 | 
						|
 | 
						|
        catch ( ... ) {
 | 
						|
            std::cout << "Searching for: " << needle << std::endl;
 | 
						|
            std::cout << "Expected: " << expected << "\n";
 | 
						|
            std::cout << "  std:    " << std::distance ( hBeg, it0 ) << "\n";
 | 
						|
            std::cout << "  bm:     " << std::distance ( hBeg, it1 ) << "\n";
 | 
						|
            std::cout << "  bm(r1):  " << std::distance ( hBeg, it1r ) << "\n";
 | 
						|
            std::cout << "  bm(r2):  " << std::distance ( hBeg, rt1 ) << "\n";
 | 
						|
            std::cout << "  bm(r3):  " << std::distance ( hBeg, rt1r ) << "\n";
 | 
						|
            std::cout << "  bmh:    " << std::distance ( hBeg, it2 ) << "\n";
 | 
						|
            std::cout << "  kpm:    " << std::distance ( hBeg, it3 )<< "\n";
 | 
						|
            std::cout << std::flush;
 | 
						|
            throw ;
 | 
						|
            }
 | 
						|
 | 
						|
        BOOST_CHECK_EQUAL ( dist, expected );
 | 
						|
        }
 | 
						|
 | 
						|
 | 
						|
    template<typename Container>
 | 
						|
    void check_one ( const Container &haystack, const std::string &needle, int expected ) {
 | 
						|
        check_one_iter ( haystack, needle, expected );
 | 
						|
        check_one_pointer ( haystack, needle, expected );
 | 
						|
        check_one_object ( haystack, needle, expected );
 | 
						|
        }
 | 
						|
    }
 | 
						|
 | 
						|
 | 
						|
int test_main( int , char* [] )
 | 
						|
{
 | 
						|
    std::string haystack1 ( "NOW AN FOWE\220ER ANNMAN THE ANPANMANEND" );
 | 
						|
    std::string needle1   ( "ANPANMAN" );
 | 
						|
    std::string needle2   ( "MAN THE" );
 | 
						|
    std::string needle3   ( "WE\220ER" );
 | 
						|
    std::string needle4   ( "NOW " );   //  At the beginning
 | 
						|
    std::string needle5   ( "NEND" );   //  At the end
 | 
						|
    std::string needle6   ( "NOT FOUND" );  // Nowhere
 | 
						|
    std::string needle7   ( "NOT FO\340ND" );   // Nowhere
 | 
						|
 | 
						|
    std::string haystack2 ( "ABC ABCDAB ABCDABCDABDE" );
 | 
						|
    std::string needle11  ( "ABCDABD" );
 | 
						|
 | 
						|
    std::string haystack3 ( "abra abracad abracadabra" );
 | 
						|
    std::string needle12  ( "abracadabra" );
 | 
						|
 | 
						|
    std::string needle13   ( "" );
 | 
						|
    std::string haystack4  ( "" );
 | 
						|
 | 
						|
    check_one ( haystack1, needle1, 26 );
 | 
						|
    check_one ( haystack1, needle2, 18 );
 | 
						|
    check_one ( haystack1, needle3,  9 );
 | 
						|
    check_one ( haystack1, needle4,  0 );
 | 
						|
    check_one ( haystack1, needle5, 33 );
 | 
						|
    check_one ( haystack1, needle6, -1 );
 | 
						|
    check_one ( haystack1, needle7, -1 );
 | 
						|
 | 
						|
    check_one ( needle1, haystack1, -1 );   // cant find long pattern in short corpus
 | 
						|
    check_one ( haystack1, haystack1, 0 );  // find something in itself
 | 
						|
    check_one ( haystack2, haystack2, 0 );  // find something in itself
 | 
						|
 | 
						|
    check_one ( haystack2, needle11, 15 );
 | 
						|
    check_one ( haystack3, needle12, 13 );
 | 
						|
 | 
						|
    check_one ( haystack1, needle13, 0 );   // find the empty string 
 | 
						|
    check_one ( haystack4, needle1, -1 );  // can't find in an empty haystack
 | 
						|
 | 
						|
//  Mikhail Levin <svarneticist@gmail.com> found a problem, and this was the test
 | 
						|
//  that triggered it.
 | 
						|
 | 
						|
  const std::string mikhail_pattern =   
 | 
						|
"GATACACCTACCTTCACCAGTTACTCTATGCACTAGGTGCGCCAGGCCCATGCACAAGGGCTTGAGTGGATGGGAAGGA"
 | 
						|
"TGTGCCCTAGTGATGGCAGCATAAGCTACGCAGAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACATCCACGAG"
 | 
						|
"CACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCCATGTATTACTGTGGGAGAGATGTCTGGAGTGGT"
 | 
						|
"TATTATTGCCCCGGTAATATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACG"
 | 
						|
;
 | 
						|
    const std::string mikhail_corpus = std::string (8, 'a') + mikhail_pattern;
 | 
						|
 | 
						|
    check_one ( mikhail_corpus, mikhail_pattern, 8 );
 | 
						|
    return 0;
 | 
						|
    }
 |