mirror of
https://github.com/boostorg/algorithm.git
synced 2025-10-07 21:30:56 +02:00
Compare commits
39 Commits
sandbox-br
...
boost-1.46
Author | SHA1 | Date | |
---|---|---|---|
|
9535d80b31 | ||
|
01492a93c6 | ||
|
50703b8c97 | ||
|
0f8d556130 | ||
|
bbd3220a1e | ||
|
9068069106 | ||
|
a37af3c81e | ||
|
f5885c6fb0 | ||
|
d45bb3545e | ||
|
d735b9fa1e | ||
|
62ec675581 | ||
|
e7cd4da67b | ||
|
6076f5a18e | ||
|
60cd5a0500 | ||
|
c33dad924d | ||
|
2f2935f07e | ||
|
3cbaafc27f | ||
|
c067b348bf | ||
|
c33935fa1f | ||
|
98a8b08afb | ||
|
fc0f3dcffc | ||
|
822636418b | ||
|
352e16aade | ||
|
89c76ea1bb | ||
|
50b5726a6f | ||
|
d4b95734dd | ||
|
05af96f84c | ||
|
5bdbb2b308 | ||
|
1a02969303 | ||
|
6309379618 | ||
|
37581bac55 | ||
|
a71a4ed5b1 | ||
|
c509c3fbad | ||
|
d8683f2498 | ||
|
7c0101aa51 | ||
|
6f3e85528f | ||
|
8af639b7cf | ||
|
d9bc7e800b | ||
|
b4ed9beb90 |
@@ -1,22 +0,0 @@
|
||||
# Boost algorithm library example programs Jamfile
|
||||
#
|
||||
# Copyright Marshall Clow 2010-2012. Use, modification and
|
||||
# distribution is subject to the Boost Software License, Version
|
||||
# 1.0. (See accompanying file LICENSE_1_0.txt or copy at
|
||||
# http://www.boost.org/LICENSE_1_0.txt)
|
||||
#
|
||||
# See http://www.boost.org for updates, documentation, and revision history.
|
||||
|
||||
|
||||
project /boost/algorithm/example
|
||||
: requirements
|
||||
<include>../../../
|
||||
<optimization>speed
|
||||
<toolset>msvc:<define>_SCL_SECURE_NO_WARNINGS
|
||||
<toolset>msvc:<define>NOMINMAX
|
||||
<link>static
|
||||
:
|
||||
;
|
||||
|
||||
exe clamp_example : clamp_example.cpp ;
|
||||
exe search_example : search_example.cpp ;
|
@@ -1,54 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <string>
|
||||
#include <iostream> // for cout, etc
|
||||
|
||||
#include <boost/algorithm/clamp.hpp>
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
|
||||
bool compare_string_lengths ( const std::string &one, const std::string &two )
|
||||
{
|
||||
return one.length () < two.length ();
|
||||
}
|
||||
|
||||
int main ( int /*argc*/, char * /*argv*/ [] ) {
|
||||
// Clamp takes a value and two "fenceposts", and brings the value "between" the fenceposts.
|
||||
|
||||
// If the input value is "between" the fenceposts, then it is returned unchanged.
|
||||
std::cout << "Clamping 5 to between [1, 10] -> " << ba::clamp ( 5, 1, 10 ) << std::endl;
|
||||
|
||||
// If the input value is out side the range of the fenceposts, it "brought into" range.
|
||||
std::cout << "Clamping 15 to between [1, 10] -> " << ba::clamp ( 15, 1, 10 ) << std::endl;
|
||||
std::cout << "Clamping -15 to between [1, 10] -> " << ba::clamp ( -15, 1, 10 ) << std::endl;
|
||||
|
||||
// It doesn't just work for ints
|
||||
std::cout << "Clamping 5.1 to between [1, 10] -> " << ba::clamp ( 5.1, 1.0, 10.0 ) << std::endl;
|
||||
|
||||
{
|
||||
std::string one ( "Lower Bound" ), two ( "upper bound!" ), test1 ( "test#" ), test2 ( "#test" );
|
||||
std::cout << "Clamping '" << test1 << "' between ['" << one << "' and '" << two << "'] -> '" <<
|
||||
ba::clamp ( test1, one, two ) << "'" << std::endl;
|
||||
std::cout << "Clamping '" << test2 << "' between ['" << one << "' and '" << two << "'] -> '" <<
|
||||
ba::clamp ( test2, one, two ) << "'" << std::endl;
|
||||
// There is also a predicate based version, if you want to compare objects in your own way
|
||||
std::cout << "Clamping '" << test1 << "' between ['" << one << "' and '" << two << "'] (comparing lengths) -> '" <<
|
||||
ba::clamp ( test1, one, two, compare_string_lengths ) << "'" << std::endl;
|
||||
std::cout << "Clamping '" << test2 << "' between ['" << one << "' and '" << two << "'] (comparing lengths) -> '" <<
|
||||
ba::clamp ( test2, one, two, compare_string_lengths ) << "'" << std::endl;
|
||||
|
||||
}
|
||||
|
||||
// Sometimes, though, you don't get quite what you expect
|
||||
// This is because the two double arguments get converted to int
|
||||
std::cout << "Somewhat unexpected: clamp ( 12, 14.7, 15.9 ) --> " << ba::clamp ( 12, 14.7, 15.9 ) << std::endl;
|
||||
std::cout << "Expected: clamp ((double)12, 14.7, 15.9 ) --> " << ba::clamp ((double) 12, 14.7, 15.9 ) << std::endl;
|
||||
return 0;
|
||||
}
|
@@ -1,57 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <string>
|
||||
#include <iostream> // for cout, etc.
|
||||
|
||||
#include <boost/algorithm/searching/boyer_moore.hpp>
|
||||
#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
|
||||
#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
|
||||
const std::string haystack ( "ABACAB is it everywhere!" );
|
||||
const std::string needle1 ( "ACAB" );
|
||||
const std::string needle2 ( "not ABA" );
|
||||
|
||||
|
||||
|
||||
int main ( int /*argc*/, char * /*argv*/ [] ) {
|
||||
// In search.hpp, there are generic implementations of three classic sequence search
|
||||
// algorithms. They all have the same (dual) interface.
|
||||
|
||||
// There is a procedural interface, based on std::search:
|
||||
if ( ba::boyer_moore_search ( haystack.begin (), haystack.end (), needle1.begin (), needle1.end ()) != haystack.end ())
|
||||
std::cout << "Found '" << needle1 << "' in '" << haystack << "' (boyer-moore 1)" << std::endl;
|
||||
else
|
||||
std::cout << "Did NOT find '" << needle1 << "' in '" << haystack << "' (boyer-moore 1)" << std::endl;
|
||||
|
||||
// If you plan on searching for the same pattern in several different data sets,
|
||||
// you can create a search object and use that over and over again - amortizing the setup
|
||||
// costs across several searches
|
||||
ba::boyer_moore<std::string::const_iterator> search1 ( needle1.begin (), needle1.end ());
|
||||
if ( search1 ( haystack.begin (), haystack.end ()) != haystack.end ())
|
||||
std::cout << "Found '" << needle1 << "' in '" << haystack << "' (boyer-moore 2)" << std::endl;
|
||||
else
|
||||
std::cout << "Did NOT find '" << needle1 << "' in '" << haystack << "' (boyer-moore 2)" << std::endl;
|
||||
|
||||
// There is also an implementation of boyer-moore-horspool searching
|
||||
if ( ba::boyer_moore_horspool_search ( haystack.begin (), haystack.end (), needle1.begin (), needle1.end ()) != haystack.end ())
|
||||
std::cout << "Found '" << needle1 << "' in '" << haystack << "' (boyer-moore-horspool)" << std::endl;
|
||||
else
|
||||
std::cout << "Did NOT find '" << needle1 << "' in '" << haystack << "' (boyer-moore-horspool)" << std::endl;
|
||||
|
||||
// And also the knuth-pratt-morris search algorithm
|
||||
if ( ba::knuth_morris_pratt_search ( haystack.begin (), haystack.end (), needle1.begin (), needle1.end ()) != haystack.end ())
|
||||
std::cout << "Found '" << needle1 << "' in '" << haystack << "' (knuth_morris_pratt)" << std::endl;
|
||||
else
|
||||
std::cout << "Did NOT find '" << needle1 << "' in '" << haystack << "' (knuth_morris_pratt)" << std::endl;
|
||||
|
||||
return 0;
|
||||
}
|
@@ -1,175 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2008-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
Revision history:
|
||||
27 June 2009 mtc First version
|
||||
23 Oct 2010 mtc Added predicate version
|
||||
|
||||
*/
|
||||
|
||||
/// \file clamp.hpp
|
||||
/// \brief Clamp algorithm
|
||||
/// \author Marshall Clow
|
||||
///
|
||||
/// Suggested by olafvdspek in https://svn.boost.org/trac/boost/ticket/3215
|
||||
|
||||
#ifndef BOOST_ALGORITHM_CLAMP_HPP
|
||||
#define BOOST_ALGORITHM_CLAMP_HPP
|
||||
|
||||
#include <functional> // For std::less
|
||||
#include <iterator> // For std::iterator_traits
|
||||
#include <cassert>
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
#include <boost/mpl/identity.hpp> // for identity
|
||||
#include <boost/utility/enable_if.hpp> // for boost::disable_if
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
/// \fn clamp ( T const& val,
|
||||
/// typename boost::mpl::identity<T>::type const& lo,
|
||||
/// typename boost::mpl::identity<T>::type const& hi, Pred p )
|
||||
/// \return the value "val" brought into the range [ lo, hi ]
|
||||
/// using the comparison predicate p.
|
||||
/// If p ( val, lo ) return lo.
|
||||
/// If p ( hi, val ) return hi.
|
||||
/// Otherwise, return the original value.
|
||||
///
|
||||
/// \param val The value to be clamped
|
||||
/// \param lo The lower bound of the range to be clamped to
|
||||
/// \param hi The upper bound of the range to be clamped to
|
||||
/// \param p A predicate to use to compare the values.
|
||||
/// p ( a, b ) returns a boolean.
|
||||
///
|
||||
template<typename T, typename Pred>
|
||||
T const & clamp ( T const& val,
|
||||
typename boost::mpl::identity<T>::type const & lo,
|
||||
typename boost::mpl::identity<T>::type const & hi, Pred p )
|
||||
{
|
||||
// assert ( !p ( hi, lo )); // Can't assert p ( lo, hi ) b/c they might be equal
|
||||
return p ( val, lo ) ? lo : p ( hi, val ) ? hi : val;
|
||||
}
|
||||
|
||||
|
||||
/// \fn clamp ( T const& val,
|
||||
/// typename boost::mpl::identity<T>::type const& lo,
|
||||
/// typename boost::mpl::identity<T>::type const& hi )
|
||||
/// \return the value "val" brought into the range [ lo, hi ].
|
||||
/// If the value is less than lo, return lo.
|
||||
/// If the value is greater than "hi", return hi.
|
||||
/// Otherwise, return the original value.
|
||||
///
|
||||
/// \param val The value to be clamped
|
||||
/// \param lo The lower bound of the range to be clamped to
|
||||
/// \param hi The upper bound of the range to be clamped to
|
||||
///
|
||||
template<typename T>
|
||||
T const& clamp ( const T& val,
|
||||
typename boost::mpl::identity<T>::type const & lo,
|
||||
typename boost::mpl::identity<T>::type const & hi )
|
||||
{
|
||||
return (clamp) ( val, lo, hi, std::less<T>());
|
||||
}
|
||||
|
||||
/// \fn clamp_range ( InputIterator first, InputIterator last, OutputIterator out,
|
||||
/// std::iterator_traits<InputIterator>::value_type lo,
|
||||
/// std::iterator_traits<InputIterator>::value_type hi )
|
||||
/// \return clamp the sequence of values [first, last) into [ lo, hi ]
|
||||
///
|
||||
/// \param first The start of the range of values
|
||||
/// \param last One past the end of the range of input values
|
||||
/// \param out An output iterator to write the clamped values into
|
||||
/// \param lo The lower bound of the range to be clamped to
|
||||
/// \param hi The upper bound of the range to be clamped to
|
||||
///
|
||||
template<typename InputIterator, typename OutputIterator>
|
||||
OutputIterator clamp_range ( InputIterator first, InputIterator last, OutputIterator out,
|
||||
typename std::iterator_traits<InputIterator>::value_type lo,
|
||||
typename std::iterator_traits<InputIterator>::value_type hi )
|
||||
{
|
||||
// this could also be written with bind and std::transform
|
||||
while ( first != last )
|
||||
*out++ = clamp ( *first++, lo, hi );
|
||||
return out;
|
||||
}
|
||||
|
||||
/// \fn clamp_range ( const Range &r, OutputIterator out,
|
||||
/// typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type lo,
|
||||
/// typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type hi )
|
||||
/// \return clamp the sequence of values [first, last) into [ lo, hi ]
|
||||
///
|
||||
/// \param r The range of values to be clamped
|
||||
/// \param out An output iterator to write the clamped values into
|
||||
/// \param lo The lower bound of the range to be clamped to
|
||||
/// \param hi The upper bound of the range to be clamped to
|
||||
///
|
||||
template<typename Range, typename OutputIterator>
|
||||
typename boost::disable_if_c<boost::is_same<Range, OutputIterator>::value, OutputIterator>::type
|
||||
clamp_range ( const Range &r, OutputIterator out,
|
||||
typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type lo,
|
||||
typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type hi )
|
||||
{
|
||||
return clamp_range ( boost::begin ( r ), boost::end ( r ), out, lo, hi );
|
||||
}
|
||||
|
||||
|
||||
/// \fn clamp_range ( InputIterator first, InputIterator last, OutputIterator out,
|
||||
/// std::iterator_traits<InputIterator>::value_type lo,
|
||||
/// std::iterator_traits<InputIterator>::value_type hi, Pred p )
|
||||
/// \return clamp the sequence of values [first, last) into [ lo, hi ]
|
||||
/// using the comparison predicate p.
|
||||
///
|
||||
/// \param first The start of the range of values
|
||||
/// \param last One past the end of the range of input values
|
||||
/// \param out An output iterator to write the clamped values into
|
||||
/// \param lo The lower bound of the range to be clamped to
|
||||
/// \param hi The upper bound of the range to be clamped to
|
||||
/// \param p A predicate to use to compare the values.
|
||||
/// p ( a, b ) returns a boolean.
|
||||
|
||||
///
|
||||
template<typename InputIterator, typename OutputIterator, typename Pred>
|
||||
OutputIterator clamp_range ( InputIterator first, InputIterator last, OutputIterator out,
|
||||
typename std::iterator_traits<InputIterator>::value_type lo,
|
||||
typename std::iterator_traits<InputIterator>::value_type hi, Pred p )
|
||||
{
|
||||
// this could also be written with bind and std::transform
|
||||
while ( first != last )
|
||||
*out++ = clamp ( *first++, lo, hi, p );
|
||||
return out;
|
||||
}
|
||||
|
||||
/// \fn clamp_range ( const Range &r, OutputIterator out,
|
||||
/// typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type lo,
|
||||
/// typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type hi,
|
||||
/// Pred p )
|
||||
/// \return clamp the sequence of values [first, last) into [ lo, hi ]
|
||||
/// using the comparison predicate p.
|
||||
///
|
||||
/// \param r The range of values to be clamped
|
||||
/// \param out An output iterator to write the clamped values into
|
||||
/// \param lo The lower bound of the range to be clamped to
|
||||
/// \param hi The upper bound of the range to be clamped to
|
||||
/// \param p A predicate to use to compare the values.
|
||||
/// p ( a, b ) returns a boolean.
|
||||
//
|
||||
// Disable this template if the first two parameters are the same type;
|
||||
// In that case, the user will get the two iterator version.
|
||||
template<typename Range, typename OutputIterator, typename Pred>
|
||||
typename boost::disable_if_c<boost::is_same<Range, OutputIterator>::value, OutputIterator>::type
|
||||
clamp_range ( const Range &r, OutputIterator out,
|
||||
typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type lo,
|
||||
typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type hi,
|
||||
Pred p )
|
||||
{
|
||||
return clamp_range ( boost::begin ( r ), boost::end ( r ), out, lo, hi, p );
|
||||
}
|
||||
|
||||
|
||||
}}
|
||||
|
||||
#endif // BOOST_ALGORITHM_CLAMP_HPP
|
@@ -1,90 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2008-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file all_of.hpp
|
||||
/// \brief Test ranges to see if all elements match a value or predicate.
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_ALL_OF_HPP
|
||||
#define BOOST_ALGORITHM_ALL_OF_HPP
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of all_of if it is available
|
||||
using std::all_of; // Section 25.2.1
|
||||
#else
|
||||
/// \fn all_of ( InputIterator first, InputIterator last, Predicate p )
|
||||
/// \return true if all elements in [first, last) satisfy the predicate 'p'
|
||||
/// \note returns true on an empty range
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param p A predicate for testing the elements of the sequence
|
||||
///
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template<typename InputIterator, typename Predicate>
|
||||
bool all_of ( InputIterator first, InputIterator last, Predicate p )
|
||||
{
|
||||
for ( ; first != last; ++first )
|
||||
if ( !p(*first))
|
||||
return false;
|
||||
return true;
|
||||
}
|
||||
#endif
|
||||
|
||||
/// \fn all_of ( const Range &r, Predicate p )
|
||||
/// \return true if all elements in the range satisfy the predicate 'p'
|
||||
/// \note returns true on an empty range
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename Range, typename Predicate>
|
||||
bool all_of ( const Range &r, Predicate p )
|
||||
{
|
||||
return boost::algorithm::all_of ( boost::begin (r), boost::end (r), p );
|
||||
}
|
||||
|
||||
/// \fn all_of_equal ( InputIterator first, InputIterator last, const T &val )
|
||||
/// \return true if all elements in [first, last) are equal to 'val'
|
||||
/// \note returns true on an empty range
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param val A value to compare against
|
||||
///
|
||||
template<typename InputIterator, typename T>
|
||||
bool all_of_equal ( InputIterator first, InputIterator last, const T &val )
|
||||
{
|
||||
for ( ; first != last; ++first )
|
||||
if ( val != *first )
|
||||
return false;
|
||||
return true;
|
||||
}
|
||||
|
||||
/// \fn all_of_equal ( const Range &r, const T &val )
|
||||
/// \return true if all elements in the range are equal to 'val'
|
||||
/// \note returns true on an empty range
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param val A value to compare against
|
||||
///
|
||||
template<typename Range, typename T>
|
||||
bool all_of_equal ( const Range &r, const T &val )
|
||||
{
|
||||
return boost::algorithm::all_of_equal ( boost::begin (r), boost::end (r), val );
|
||||
}
|
||||
|
||||
}} // namespace boost and algorithm
|
||||
|
||||
#endif // BOOST_ALGORITHM_ALL_OF_HPP
|
@@ -1,89 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2008-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
/// \file
|
||||
/// \brief Test ranges to see if any elements match a value or predicate.
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_ANY_OF_HPP
|
||||
#define BOOST_ALGORITHM_ANY_OF_HPP
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
// Use the C++11 versions of any_of if it is available
|
||||
#if __cplusplus >= 201103L
|
||||
using std::any_of; // Section 25.2.2
|
||||
#else
|
||||
/// \fn any_of ( InputIterator first, InputIterator last, Predicate p )
|
||||
/// \return true if any of the elements in [first, last) satisfy the predicate
|
||||
/// \note returns false on an empty range
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param p A predicate for testing the elements of the sequence
|
||||
///
|
||||
template<typename InputIterator, typename Predicate>
|
||||
bool any_of ( InputIterator first, InputIterator last, Predicate p )
|
||||
{
|
||||
for ( ; first != last; ++first )
|
||||
if ( p(*first))
|
||||
return true;
|
||||
return false;
|
||||
}
|
||||
#endif
|
||||
|
||||
/// \fn any_of ( const Range &r, Predicate p )
|
||||
/// \return true if any elements in the range satisfy the predicate 'p'
|
||||
/// \note returns false on an empty range
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename Range, typename Predicate>
|
||||
bool any_of ( const Range &r, Predicate p )
|
||||
{
|
||||
return boost::algorithm::any_of (boost::begin (r), boost::end (r), p);
|
||||
}
|
||||
|
||||
/// \fn any_of_equal ( InputIterator first, InputIterator last, const V &val )
|
||||
/// \return true if any of the elements in [first, last) are equal to 'val'
|
||||
/// \note returns false on an empty range
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param val A value to compare against
|
||||
///
|
||||
template<typename InputIterator, typename V>
|
||||
bool any_of_equal ( InputIterator first, InputIterator last, const V &val )
|
||||
{
|
||||
for ( ; first != last; ++first )
|
||||
if ( val == *first )
|
||||
return true;
|
||||
return false;
|
||||
}
|
||||
|
||||
/// \fn any_of_equal ( const Range &r, const V &val )
|
||||
/// \return true if any of the elements in the range are equal to 'val'
|
||||
/// \note returns false on an empty range
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param val A value to compare against
|
||||
///
|
||||
template<typename Range, typename V>
|
||||
bool any_of_equal ( const Range &r, const V &val )
|
||||
{
|
||||
return boost::algorithm::any_of_equal (boost::begin (r), boost::end (r), val);
|
||||
}
|
||||
|
||||
}} // namespace boost and algorithm
|
||||
|
||||
#endif // BOOST_ALGORITHM_ANY_OF_HPP
|
@@ -1,133 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2008-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file copy_if.hpp
|
||||
/// \brief Copy a subset of a sequence to a new sequence
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_COPY_IF_HPP
|
||||
#define BOOST_ALGORITHM_COPY_IF_HPP
|
||||
|
||||
#include <algorithm> // for std::copy_if, if available
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of copy_if if it is available
|
||||
using std::copy_if; // Section 25.3.1
|
||||
#else
|
||||
/// \fn copy_if ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
|
||||
/// \brief Copies all the elements from the input range that satisfy the
|
||||
/// predicate to the output range.
|
||||
/// \return The updated output iterator
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param result An output iterator to write the results into
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template<typename InputIterator, typename OutputIterator, typename Predicate>
|
||||
OutputIterator copy_if ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
|
||||
{
|
||||
for ( ; first != last; ++first )
|
||||
if (p(*first))
|
||||
*result++ = first;
|
||||
return result;
|
||||
}
|
||||
#endif
|
||||
|
||||
/// \fn copy_if ( const Range &r, OutputIterator result, Predicate p )
|
||||
/// \brief Copies all the elements from the input range that satisfy the
|
||||
/// predicate to the output range.
|
||||
/// \return The updated output iterator
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param result An output iterator to write the results into
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename Range, typename OutputIterator, typename Predicate>
|
||||
OutputIterator copy_if ( const Range &r, OutputIterator result, Predicate p )
|
||||
{
|
||||
return boost::algorithm::copy_if (boost::begin (r), boost::end(r), result, p);
|
||||
}
|
||||
|
||||
|
||||
/// \fn copy_while ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
|
||||
/// \brief Copies all the elements at the start of the input range that
|
||||
/// satisfy the predicate to the output range.
|
||||
/// \return The updated output iterator
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param result An output iterator to write the results into
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename InputIterator, typename OutputIterator, typename Predicate>
|
||||
OutputIterator copy_while ( InputIterator first, InputIterator last,
|
||||
OutputIterator result, Predicate p )
|
||||
{
|
||||
for ( ; first != last && p(*first); ++first )
|
||||
*result++ = first;
|
||||
return result;
|
||||
}
|
||||
|
||||
/// \fn copy_while ( const Range &r, OutputIterator result, Predicate p )
|
||||
/// \brief Copies all the elements at the start of the input range that
|
||||
/// satisfy the predicate to the output range.
|
||||
/// \return The updated output iterator
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param result An output iterator to write the results into
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename Range, typename OutputIterator, typename Predicate>
|
||||
OutputIterator copy_while ( const Range &r, OutputIterator result, Predicate p )
|
||||
{
|
||||
return boost::algorithm::copy_while (boost::begin (r), boost::end(r), result, p);
|
||||
}
|
||||
|
||||
|
||||
/// \fn copy_until ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
|
||||
/// \brief Copies all the elements at the start of the input range that do not
|
||||
/// satisfy the predicate to the output range.
|
||||
/// \return The updated output iterator
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param result An output iterator to write the results into
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename InputIterator, typename OutputIterator, typename Predicate>
|
||||
OutputIterator copy_until ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
|
||||
{
|
||||
for ( ; first != last && !p(*first); ++first )
|
||||
*result++ = first;
|
||||
return result;
|
||||
}
|
||||
|
||||
/// \fn copy_until ( const Range &r, OutputIterator result, Predicate p )
|
||||
/// \brief Copies all the elements at the start of the input range that do not
|
||||
/// satisfy the predicate to the output range.
|
||||
/// \return The updated output iterator
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param result An output iterator to write the results into
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename Range, typename OutputIterator, typename Predicate>
|
||||
OutputIterator copy_until ( const Range &r, OutputIterator result, Predicate p )
|
||||
{
|
||||
return boost::algorithm::copy_until (boost::begin (r), boost::end(r), result, p);
|
||||
}
|
||||
|
||||
}} // namespace boost and algorithm
|
||||
|
||||
#endif // BOOST_ALGORITHM_COPY_IF_HPP
|
@@ -1,44 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file copy_n.hpp
|
||||
/// \brief Copy n items from one sequence to another
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_COPY_N_HPP
|
||||
#define BOOST_ALGORITHM_COPY_N_HPP
|
||||
|
||||
#include <algorithm> // for std::copy_n, if available
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of copy_n if it is available
|
||||
using std::copy_n; // Section 25.3.1
|
||||
#else
|
||||
/// \fn copy_n ( InputIterator first, Size n, OutputIterator result )
|
||||
/// \brief Copies exactly n (n > 0) elements from the range starting at first to
|
||||
/// the range starting at result.
|
||||
/// \return The updated output iterator
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param n The number of elements to copy
|
||||
/// \param result An output iterator to write the results into
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template <typename InputIterator, typename Size, typename OutputIterator>
|
||||
OutputIterator copy_n ( InputIterator first, Size n, OutputIterator result )
|
||||
{
|
||||
for ( ; n > 0; --n, ++first, ++result )
|
||||
*result = *first;
|
||||
return result;
|
||||
}
|
||||
#endif
|
||||
}} // namespace boost and algorithm
|
||||
|
||||
#endif // BOOST_ALGORITHM_COPY_IF_HPP
|
@@ -1,60 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file find_if_not.hpp
|
||||
/// \brief Find the first element in a sequence that does not satisfy a predicate.
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_FIND_IF_NOT_HPP
|
||||
#define BOOST_ALGORITHM_FIND_IF_NOT_HPP
|
||||
|
||||
#include <algorithm> // for std::find_if_not, if it exists
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of find_if_not if it is available
|
||||
using std::find_if_not; // Section 25.2.5
|
||||
#else
|
||||
/// \fn find_if_not(InputIterator first, InputIterator last, Predicate p)
|
||||
/// \brief Finds the first element in the sequence that does not satisfy the predicate.
|
||||
/// \return The iterator pointing to the desired element.
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template<typename InputIterator, typename Predicate>
|
||||
InputIterator find_if_not ( InputIterator first, InputIterator last, Predicate p )
|
||||
{
|
||||
for ( ; first != last; ++first )
|
||||
if ( !p(*first))
|
||||
break;
|
||||
return first;
|
||||
}
|
||||
#endif
|
||||
|
||||
/// \fn find_if_not ( const Range &r, Predicate p )
|
||||
/// \brief Finds the first element in the sequence that does not satisfy the predicate.
|
||||
/// \return The iterator pointing to the desired element.
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename Range, typename Predicate>
|
||||
typename boost::range_iterator<const Range>::type find_if_not ( const Range &r, Predicate p )
|
||||
{
|
||||
return boost::algorithm::find_if_not (boost::begin (r), boost::end(r), p);
|
||||
}
|
||||
|
||||
}}
|
||||
#endif // BOOST_ALGORITHM_FIND_IF_NOT_HPP
|
@@ -1,74 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2008-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file iota.hpp
|
||||
/// \brief Generate an increasing series
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_IOTA_HPP
|
||||
#define BOOST_ALGORITHM_IOTA_HPP
|
||||
|
||||
#include <numeric>
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of iota if it is available
|
||||
using std::iota; // Section 26.7.6
|
||||
#else
|
||||
/// \fn iota ( ForwardIterator first, ForwardIterator last, T value )
|
||||
/// \brief Generates an increasing sequence of values, and stores them in [first, last)
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param value The initial value of the sequence to be generated
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template <typename ForwardIterator, typename T>
|
||||
void iota ( ForwardIterator first, ForwardIterator last, T value )
|
||||
{
|
||||
for ( ; first != last; ++first, ++value )
|
||||
*first = value;
|
||||
}
|
||||
#endif
|
||||
|
||||
/// \fn iota ( Range &r, T value )
|
||||
/// \brief Generates an increasing sequence of values, and stores them in the input Range.
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param value The initial value of the sequence to be generated
|
||||
///
|
||||
template <typename Range, typename T>
|
||||
void iota ( Range &r, T value )
|
||||
{
|
||||
boost::algorithm::iota (boost::begin(r), boost::end(r), value);
|
||||
}
|
||||
|
||||
|
||||
/// \fn iota_n ( OutputIterator out, T value, std::size_t n )
|
||||
/// \brief Generates an increasing sequence of values, and stores them in the input Range.
|
||||
///
|
||||
/// \param out An output iterator to write the results into
|
||||
/// \param value The initial value of the sequence to be generated
|
||||
/// \param n The number of items to write
|
||||
///
|
||||
template <typename OutputIterator, typename T>
|
||||
OutputIterator iota_n ( OutputIterator out, T value, std::size_t n )
|
||||
{
|
||||
while ( n-- > 0 )
|
||||
*out++ = value++;
|
||||
|
||||
return out;
|
||||
}
|
||||
|
||||
}}
|
||||
|
||||
#endif // BOOST_ALGORITHM_IOTA_HPP
|
@@ -1,65 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file is_partitioned.hpp
|
||||
/// \brief Tell if a sequence is partitioned
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_IS_PARTITIONED_HPP
|
||||
#define BOOST_ALGORITHM_IS_PARTITIONED_HPP
|
||||
|
||||
#include <algorithm> // for std::is_partitioned, if available
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of iota if it is available
|
||||
using std::is_partitioned; // Section 25.3.13
|
||||
#else
|
||||
/// \fn is_partitioned ( InputIterator first, InputIterator last, UnaryPredicate p )
|
||||
/// \brief Tests to see if a sequence is partititioned according to a predicate
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param p The predicicate to test the values with
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template <typename InputIterator, typename UnaryPredicate>
|
||||
bool is_partitioned ( InputIterator first, InputIterator last, UnaryPredicate p )
|
||||
{
|
||||
// Run through the part that satisfy the predicate
|
||||
for ( ; first != last; ++first )
|
||||
if ( !p (*first))
|
||||
break;
|
||||
// Now the part that does not satisfy the predicate
|
||||
for ( ; first != last; ++first )
|
||||
if ( p (*first))
|
||||
return false;
|
||||
return true;
|
||||
}
|
||||
#endif
|
||||
|
||||
/// \fn is_partitioned ( const Range &r, UnaryPredicate p )
|
||||
/// \brief Generates an increasing sequence of values, and stores them in the input Range.
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param p The predicicate to test the values with
|
||||
///
|
||||
template <typename Range, typename UnaryPredicate>
|
||||
bool is_partitioned ( const Range &r, UnaryPredicate p )
|
||||
{
|
||||
return boost::algorithm::is_partitioned (boost::begin(r), boost::end(r), p);
|
||||
}
|
||||
|
||||
|
||||
}}
|
||||
|
||||
#endif // BOOST_ALGORITHM_IS_PARTITIONED_HPP
|
@@ -1,139 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file is_permutation.hpp
|
||||
/// \brief Is a sequence a permutation of another sequence
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_IS_PERMUTATION_HPP
|
||||
#define BOOST_ALGORITHM_IS_PERMUTATION_HPP
|
||||
|
||||
#include <algorithm> // for std::less, tie, mismatch and is_permutation (if available)
|
||||
#include <utility> // for std::make_pair
|
||||
#include <functional> // for std::equal_to
|
||||
#include <iterator>
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
#include <boost/utility/enable_if.hpp>
|
||||
#include <boost/type_traits/is_same.hpp>
|
||||
#include <boost/tr1/tr1/tuple> // for tie
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of is_permutation if it is available
|
||||
using std::is_permutation; // Section 25.2.12
|
||||
#else
|
||||
/// \cond DOXYGEN_HIDE
|
||||
namespace detail {
|
||||
template <typename Predicate, typename Iterator>
|
||||
struct value_predicate {
|
||||
value_predicate ( Predicate p, Iterator it ) : p_ ( p ), it_ ( it ) {}
|
||||
|
||||
template <typename T1>
|
||||
bool operator () ( const T1 &t1 ) const { return p_ ( *it_, t1 ); }
|
||||
private:
|
||||
Predicate &p_;
|
||||
Iterator it_;
|
||||
};
|
||||
}
|
||||
/// \endcond
|
||||
|
||||
|
||||
/// \fn is_permutation ( ForwardIterator1 first, ForwardIterator1 last, ForwardIterator2 first2, BinaryPredicate p )
|
||||
/// \brief Tests to see if a the sequence [first,last) is a permutation of the sequence starting at first2
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param first2 The start of the second sequence
|
||||
/// \param p The predicate to compare elements with
|
||||
///
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template< class ForwardIterator1, class ForwardIterator2, class BinaryPredicate >
|
||||
bool is_permutation ( ForwardIterator1 first1, ForwardIterator1 last1,
|
||||
ForwardIterator2 first2, BinaryPredicate p )
|
||||
{
|
||||
// Skip the common prefix (if any)
|
||||
// std::tie (first1, first2) = std::mismatch (first1, last1, first2, p);
|
||||
std::pair<ForwardIterator1, ForwardIterator2> eq = std::mismatch (first1, last1, first2, p);
|
||||
first1 = eq.first;
|
||||
first2 = eq.second;
|
||||
if ( first1 != last1 ) {
|
||||
// Create last2
|
||||
ForwardIterator2 last2 = first2;
|
||||
std::advance ( last2, std::distance (first1, last1));
|
||||
|
||||
// for each unique value in the sequence [first1,last1), count how many times
|
||||
// it occurs, and make sure it occurs the same number of times in [first2, last2)
|
||||
for ( ForwardIterator1 iter = first1; iter != last1; ++iter ) {
|
||||
detail::value_predicate<BinaryPredicate, ForwardIterator1> pred ( p, iter );
|
||||
|
||||
/* For each value we haven't seen yet... */
|
||||
if ( std::find_if ( first1, iter, pred ) == iter ) {
|
||||
std::size_t dest_count = std::count_if ( first2, last2, pred );
|
||||
if ( dest_count == 0 || dest_count != (std::size_t) std::count_if ( iter, last1, pred ))
|
||||
return false;
|
||||
}
|
||||
}
|
||||
}
|
||||
|
||||
return true;
|
||||
}
|
||||
|
||||
/// \fn is_permutation ( ForwardIterator1 first, ForwardIterator1 last, ForwardIterator2 first2 )
|
||||
/// \brief Tests to see if a the sequence [first,last) is a permutation of the sequence starting at first2
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param first2 The start of the second sequence
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template< class ForwardIterator1, class ForwardIterator2 >
|
||||
bool is_permutation ( ForwardIterator1 first, ForwardIterator1 last, ForwardIterator2 first2 )
|
||||
{
|
||||
// How should I deal with the idea that ForwardIterator1::value_type
|
||||
// and ForwardIterator2::value_type could be different? Define my own comparison predicate?
|
||||
return boost::algorithm::is_permutation ( first, last, first2,
|
||||
std::equal_to<typename std::iterator_traits<ForwardIterator1>::value_type> ());
|
||||
}
|
||||
|
||||
#endif
|
||||
|
||||
/// \fn is_permutation ( const Range &r, ForwardIterator first2 )
|
||||
/// \brief Tests to see if a the sequence [first,last) is a permutation of the sequence starting at first2
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param first2 The start of the second sequence
|
||||
template <typename Range, typename ForwardIterator>
|
||||
bool is_permutation ( const Range &r, ForwardIterator first2 )
|
||||
{
|
||||
return boost::algorithm::is_permutation (boost::begin (r), boost::end (r), first2 );
|
||||
}
|
||||
|
||||
/// \fn is_permutation ( const Range &r, ForwardIterator first2, BinaryPredicate pred )
|
||||
/// \brief Tests to see if a the sequence [first,last) is a permutation of the sequence starting at first2
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param first2 The start of the second sequence
|
||||
/// \param pred The predicate to compare elements with
|
||||
///
|
||||
// Disable this template when the first two parameters are the same type
|
||||
// That way the non-range version will be chosen.
|
||||
template <typename Range, typename ForwardIterator, typename BinaryPredicate>
|
||||
typename boost::disable_if_c<boost::is_same<Range, ForwardIterator>::value, bool>::type
|
||||
is_permutation ( const Range &r, ForwardIterator first2, BinaryPredicate pred )
|
||||
{
|
||||
return boost::algorithm::is_permutation (boost::begin (r), boost::end (r), first2, pred );
|
||||
}
|
||||
|
||||
}}
|
||||
|
||||
#endif // BOOST_ALGORITHM_IS_PERMUTATION_HPP
|
@@ -1,87 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2008-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file none_of.hpp
|
||||
/// \brief Test ranges to see if no elements match a value or predicate.
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_NONE_OF_HPP
|
||||
#define BOOST_ALGORITHM_NONE_OF_HPP
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
// Use the C++11 versions of the none_of if it is available
|
||||
#if __cplusplus >= 201103L
|
||||
using std::none_of; // Section 25.2.3
|
||||
#else
|
||||
/// \fn none_of ( InputIterator first, InputIterator last, Predicate p )
|
||||
/// \return true if none of the elements in [first, last) satisfy the predicate 'p'
|
||||
/// \note returns true on an empty range
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param p A predicate for testing the elements of the sequence
|
||||
///
|
||||
template<typename InputIterator, typename Predicate>
|
||||
bool none_of ( InputIterator first, InputIterator last, Predicate p )
|
||||
{
|
||||
for ( ; first != last; ++first )
|
||||
if ( p(*first))
|
||||
return false;
|
||||
return true;
|
||||
}
|
||||
#endif
|
||||
|
||||
/// \fn none_of ( const Range &r, Predicate p )
|
||||
/// \return true if none of the elements in the range satisfy the predicate 'p'
|
||||
/// \note returns true on an empty range
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename Range, typename Predicate>
|
||||
bool none_of ( const Range &r, Predicate p )
|
||||
{
|
||||
return boost::algorithm::none_of (boost::begin (r), boost::end (r), p );
|
||||
}
|
||||
|
||||
/// \fn none_of_equal ( InputIterator first, InputIterator last, const V &val )
|
||||
/// \return true if none of the elements in [first, last) are equal to 'val'
|
||||
/// \note returns true on an empty range
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param val A value to compare against
|
||||
///
|
||||
template<typename InputIterator, typename V>
|
||||
bool none_of_equal ( InputIterator first, InputIterator last, const V &val )
|
||||
{
|
||||
for ( ; first != last; ++first )
|
||||
if ( val == *first )
|
||||
return false;
|
||||
return true;
|
||||
}
|
||||
|
||||
/// \fn none_of_equal ( const Range &r, const V &val )
|
||||
/// \return true if none of the elements in the range are equal to 'val'
|
||||
/// \note returns true on an empty range
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param val A value to compare against
|
||||
///
|
||||
template<typename Range, typename V>
|
||||
bool none_of_equal ( const Range &r, const V & val )
|
||||
{
|
||||
return boost::algorithm::none_of_equal (boost::begin (r), boost::end (r), val);
|
||||
}
|
||||
|
||||
}} // namespace boost and algorithm
|
||||
|
||||
#endif // BOOST_ALGORITHM_NONE_OF_HPP
|
@@ -1,82 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2008-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file one_of.hpp
|
||||
/// \brief Test ranges to see if only one element matches a value or predicate.
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_ONE_OF_HPP
|
||||
#define BOOST_ALGORITHM_ONE_OF_HPP
|
||||
|
||||
#include <algorithm> // for std::find and std::find_if
|
||||
#include <boost/algorithm/cxx11/none_of.hpp>
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
/// \fn one_of ( InputIterator first, InputIterator last, Predicate p )
|
||||
/// \return true if the predicate 'p' is true for exactly one item in [first, last).
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param p A predicate for testing the elements of the sequence
|
||||
///
|
||||
template<typename InputIterator, typename Predicate>
|
||||
bool one_of ( InputIterator first, InputIterator last, Predicate p )
|
||||
{
|
||||
InputIterator i = std::find_if (first, last, p);
|
||||
if (i == last)
|
||||
return false; // Didn't occur at all
|
||||
return boost::algorithm::none_of (++i, last, p);
|
||||
}
|
||||
|
||||
/// \fn one_of ( const Range &r, Predicate p )
|
||||
/// \return true if the predicate 'p' is true for exactly one item in the range.
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param p A predicate for testing the elements of the range
|
||||
///
|
||||
template<typename Range, typename Predicate>
|
||||
bool one_of ( const Range &r, Predicate p )
|
||||
{
|
||||
return boost::algorithm::one_of ( boost::begin (r), boost::end (r), p );
|
||||
}
|
||||
|
||||
|
||||
/// \fn one_of_equal ( InputIterator first, InputIterator last, const V &val )
|
||||
/// \return true if the value 'val' exists only once in [first, last).
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param val A value to compare against
|
||||
///
|
||||
template<typename InputIterator, typename V>
|
||||
bool one_of_equal ( InputIterator first, InputIterator last, const V &val )
|
||||
{
|
||||
InputIterator i = std::find (first, last, val); // find first occurrence of 'val'
|
||||
if (i == last)
|
||||
return false; // Didn't occur at all
|
||||
return boost::algorithm::none_of_equal (++i, last, val);
|
||||
}
|
||||
|
||||
/// \fn one_of_equal ( const Range &r, const V &val )
|
||||
/// \return true if the value 'val' exists only once in the range.
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param val A value to compare against
|
||||
///
|
||||
template<typename Range, typename V>
|
||||
bool one_of_equal ( const Range &r, const V &val )
|
||||
{
|
||||
return boost::algorithm::one_of_equal ( boost::begin (r), boost::end (r), val );
|
||||
}
|
||||
|
||||
}} // namespace boost and algorithm
|
||||
|
||||
#endif // BOOST_ALGORITHM_ALL_HPP
|
@@ -1,286 +0,0 @@
|
||||
// Copyright (c) 2010 Nuovation System Designs, LLC
|
||||
// Grant Erickson <gerickson@nuovations.com>
|
||||
//
|
||||
// Reworked somewhat by Marshall Clow; August 2010
|
||||
//
|
||||
// Distributed under the Boost Software License, Version 1.0. (See
|
||||
// accompanying file LICENSE_1_0.txt or copy at
|
||||
// http://www.boost.org/LICENSE_1_0.txt)
|
||||
//
|
||||
// See http://www.boost.org/ for latest version.
|
||||
//
|
||||
|
||||
#ifndef BOOST_ALGORITHM_ORDERED_HPP
|
||||
#define BOOST_ALGORITHM_ORDERED_HPP
|
||||
|
||||
#include <algorithm>
|
||||
#include <functional>
|
||||
#include <iterator>
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
#include <boost/utility/enable_if.hpp>
|
||||
#include <boost/type_traits/is_same.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of iota if it is available
|
||||
using std::is_sorted_until; // Section 25.4.1.5
|
||||
using std::is_sorted; // Section 25.4.1.5
|
||||
#else
|
||||
/// \fn is_sorted_until ( ForwardIterator first, ForwardIterator last, Pred p )
|
||||
/// \return the point in the sequence [first, last) where the elements are unordered
|
||||
/// (according to the comparison predicate 'p').
|
||||
///
|
||||
/// \param first The start of the sequence to be tested.
|
||||
/// \param last One past the end of the sequence
|
||||
/// \param p A binary predicate that returns true if two elements are ordered.
|
||||
///
|
||||
template <typename ForwardIterator, typename Pred>
|
||||
ForwardIterator is_sorted_until ( ForwardIterator first, ForwardIterator last, Pred p )
|
||||
{
|
||||
if ( first == last ) return last; // the empty sequence is ordered
|
||||
ForwardIterator next = first;
|
||||
while ( ++next != last )
|
||||
{
|
||||
if ( !p ( *first, *next ))
|
||||
return next;
|
||||
first = next;
|
||||
}
|
||||
return last;
|
||||
}
|
||||
|
||||
/// \fn is_sorted_until ( ForwardIterator first, ForwardIterator last )
|
||||
/// \return the point in the sequence [first, last) where the elements are unordered
|
||||
///
|
||||
/// \param first The start of the sequence to be tested.
|
||||
/// \param last One past the end of the sequence
|
||||
///
|
||||
template <typename ForwardIterator>
|
||||
ForwardIterator is_sorted_until ( ForwardIterator first, ForwardIterator last )
|
||||
{
|
||||
typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
|
||||
return boost::algorithm::is_sorted_until ( first, last, std::less_equal<value_type>());
|
||||
}
|
||||
|
||||
|
||||
/// \fn is_sorted ( ForwardIterator first, ForwardIterator last, Pred p )
|
||||
/// \return whether or not the entire sequence is sorted
|
||||
///
|
||||
/// \param first The start of the sequence to be tested.
|
||||
/// \param last One past the end of the sequence
|
||||
/// \param p A binary predicate that returns true if two elements are ordered.
|
||||
///
|
||||
template <typename ForwardIterator, typename Pred>
|
||||
bool is_sorted ( ForwardIterator first, ForwardIterator last, Pred p )
|
||||
{
|
||||
return boost::algorithm::is_sorted_until (first, last, p) == last;
|
||||
}
|
||||
|
||||
/// \fn is_sorted ( ForwardIterator first, ForwardIterator last )
|
||||
/// \return whether or not the entire sequence is sorted
|
||||
///
|
||||
/// \param first The start of the sequence to be tested.
|
||||
/// \param last One past the end of the sequence
|
||||
///
|
||||
template <typename ForwardIterator>
|
||||
bool is_sorted ( ForwardIterator first, ForwardIterator last )
|
||||
{
|
||||
return boost::algorithm::is_sorted_until (first, last) == last;
|
||||
}
|
||||
#endif
|
||||
|
||||
///
|
||||
/// -- Range based versions of the C++11 functions
|
||||
///
|
||||
|
||||
/// \fn is_sorted_until ( const R &range, Pred p )
|
||||
/// \return the point in the range R where the elements are unordered
|
||||
/// (according to the comparison predicate 'p').
|
||||
///
|
||||
/// \param range The range to be tested.
|
||||
/// \param p A binary predicate that returns true if two elements are ordered.
|
||||
///
|
||||
template <typename R, typename Pred>
|
||||
typename boost::lazy_disable_if_c<
|
||||
boost::is_same<R, Pred>::value,
|
||||
typename boost::range_iterator<const R>
|
||||
>::type is_sorted_until ( const R &range, Pred p )
|
||||
{
|
||||
return boost::algorithm::is_sorted_until ( boost::begin ( range ), boost::end ( range ), p );
|
||||
}
|
||||
|
||||
|
||||
/// \fn is_sorted_until ( const R &range )
|
||||
/// \return the point in the range R where the elements are unordered
|
||||
///
|
||||
/// \param range The range to be tested.
|
||||
///
|
||||
template <typename R>
|
||||
typename boost::range_iterator<const R>::type is_sorted_until ( const R &range )
|
||||
{
|
||||
return boost::algorithm::is_sorted_until ( boost::begin ( range ), boost::end ( range ));
|
||||
}
|
||||
|
||||
|
||||
/// \fn is_sorted ( const R &range, Pred p )
|
||||
/// \return whether or not the entire range R is sorted
|
||||
/// (according to the comparison predicate 'p').
|
||||
///
|
||||
/// \param range The range to be tested.
|
||||
/// \param p A binary predicate that returns true if two elements are ordered.
|
||||
///
|
||||
template <typename R, typename Pred>
|
||||
bool is_sorted ( const R &range, Pred p )
|
||||
{
|
||||
return boost::algorithm::is_sorted ( boost::begin ( range ), boost::end ( range ), p );
|
||||
}
|
||||
|
||||
|
||||
/// \fn is_sorted ( const R &range )
|
||||
/// \return whether or not the entire range R is sorted
|
||||
///
|
||||
/// \param range The range to be tested.
|
||||
///
|
||||
template <typename R, typename Pred>
|
||||
bool is_sorted ( const R &range )
|
||||
{
|
||||
return boost::algorithm::is_sorted ( boost::begin ( range ), boost::end ( range ));
|
||||
}
|
||||
|
||||
|
||||
///
|
||||
/// -- Range based versions of the C++11 functions
|
||||
///
|
||||
|
||||
/// \fn is_increasing ( ForwardIterator first, ForwardIterator last )
|
||||
/// \return true if the entire sequence is increasing; i.e, each item is greater than or
|
||||
/// equal to the previous one.
|
||||
///
|
||||
/// \param first The start of the sequence to be tested.
|
||||
/// \param last One past the end of the sequence
|
||||
///
|
||||
/// \note This function will return true for sequences that contain items that compare
|
||||
/// equal. If that is not what you intended, you should use is_strictly_increasing instead.
|
||||
template <typename ForwardIterator>
|
||||
bool is_increasing ( ForwardIterator first, ForwardIterator last )
|
||||
{
|
||||
typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
|
||||
return boost::algorithm::is_sorted (first, last, std::less_equal<value_type>());
|
||||
}
|
||||
|
||||
|
||||
/// \fn is_increasing ( const R &range )
|
||||
/// \return true if the entire sequence is increasing; i.e, each item is greater than or
|
||||
/// equal to the previous one.
|
||||
///
|
||||
/// \param range The range to be tested.
|
||||
///
|
||||
/// \note This function will return true for sequences that contain items that compare
|
||||
/// equal. If that is not what you intended, you should use is_strictly_increasing instead.
|
||||
template <typename R>
|
||||
bool is_increasing ( const R &range )
|
||||
{
|
||||
return is_increasing ( boost::begin ( range ), boost::end ( range ));
|
||||
}
|
||||
|
||||
|
||||
|
||||
/// \fn is_decreasing ( ForwardIterator first, ForwardIterator last )
|
||||
/// \return true if the entire sequence is decreasing; i.e, each item is less than
|
||||
/// or equal to the previous one.
|
||||
///
|
||||
/// \param first The start of the sequence to be tested.
|
||||
/// \param last One past the end of the sequence
|
||||
///
|
||||
/// \note This function will return true for sequences that contain items that compare
|
||||
/// equal. If that is not what you intended, you should use is_strictly_decreasing instead.
|
||||
template <typename ForwardIterator>
|
||||
bool is_decreasing ( ForwardIterator first, ForwardIterator last )
|
||||
{
|
||||
typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
|
||||
return boost::algorithm::is_sorted (first, last, std::greater_equal<value_type>());
|
||||
}
|
||||
|
||||
/// \fn is_decreasing ( const R &range )
|
||||
/// \return true if the entire sequence is decreasing; i.e, each item is less than
|
||||
/// or equal to the previous one.
|
||||
///
|
||||
/// \param range The range to be tested.
|
||||
///
|
||||
/// \note This function will return true for sequences that contain items that compare
|
||||
/// equal. If that is not what you intended, you should use is_strictly_decreasing instead.
|
||||
template <typename R>
|
||||
bool is_decreasing ( const R &range )
|
||||
{
|
||||
return is_decreasing ( boost::begin ( range ), boost::end ( range ));
|
||||
}
|
||||
|
||||
|
||||
|
||||
/// \fn is_strictly_increasing ( ForwardIterator first, ForwardIterator last )
|
||||
/// \return true if the entire sequence is strictly increasing; i.e, each item is greater
|
||||
/// than the previous one
|
||||
///
|
||||
/// \param first The start of the sequence to be tested.
|
||||
/// \param last One past the end of the sequence
|
||||
///
|
||||
/// \note This function will return false for sequences that contain items that compare
|
||||
/// equal. If that is not what you intended, you should use is_increasing instead.
|
||||
template <typename ForwardIterator>
|
||||
bool is_strictly_increasing ( ForwardIterator first, ForwardIterator last )
|
||||
{
|
||||
typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
|
||||
return boost::algorithm::is_sorted (first, last, std::less<value_type>());
|
||||
}
|
||||
|
||||
/// \fn is_strictly_increasing ( const R &range )
|
||||
/// \return true if the entire sequence is strictly increasing; i.e, each item is greater
|
||||
/// than the previous one
|
||||
///
|
||||
/// \param range The range to be tested.
|
||||
///
|
||||
/// \note This function will return false for sequences that contain items that compare
|
||||
/// equal. If that is not what you intended, you should use is_increasing instead.
|
||||
template <typename R>
|
||||
bool is_strictly_increasing ( const R &range )
|
||||
{
|
||||
return is_strictly_increasing ( boost::begin ( range ), boost::end ( range ));
|
||||
}
|
||||
|
||||
|
||||
/// \fn is_strictly_decreasing ( ForwardIterator first, ForwardIterator last )
|
||||
/// \return true if the entire sequence is strictly decreasing; i.e, each item is less than
|
||||
/// the previous one
|
||||
///
|
||||
/// \param first The start of the sequence to be tested.
|
||||
/// \param last One past the end of the sequence
|
||||
///
|
||||
/// \note This function will return false for sequences that contain items that compare
|
||||
/// equal. If that is not what you intended, you should use is_decreasing instead.
|
||||
template <typename ForwardIterator>
|
||||
bool is_strictly_decreasing ( ForwardIterator first, ForwardIterator last )
|
||||
{
|
||||
typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
|
||||
return boost::algorithm::is_sorted (first, last, std::greater<value_type>());
|
||||
}
|
||||
|
||||
/// \fn is_strictly_decreasing ( const R &range )
|
||||
/// \return true if the entire sequence is strictly decreasing; i.e, each item is less than
|
||||
/// the previous one
|
||||
///
|
||||
/// \param range The range to be tested.
|
||||
///
|
||||
/// \note This function will return false for sequences that contain items that compare
|
||||
/// equal. If that is not what you intended, you should use is_decreasing instead.
|
||||
template <typename R>
|
||||
bool is_strictly_decreasing ( const R &range )
|
||||
{
|
||||
return is_strictly_decreasing ( boost::begin ( range ), boost::end ( range ));
|
||||
}
|
||||
|
||||
}} // namespace boost
|
||||
|
||||
#endif // BOOST_ALGORITHM_ORDERED_HPP
|
@@ -1,77 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file partition_copy.hpp
|
||||
/// \brief Copy a subset of a sequence to a new sequence
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_PARTITION_COPY_HPP
|
||||
#define BOOST_ALGORITHM_PARTITION_COPY_HPP
|
||||
|
||||
#include <utility> // for make_pair
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of partition_copy if it is available
|
||||
using std::partition_copy; // Section 25.3.13
|
||||
#else
|
||||
/// \fn partition_copy ( InputIterator first, InputIterator last,
|
||||
/// OutputIterator1 out_true, OutputIterator2 out_false, UnaryPredicate p )
|
||||
/// \brief Copies the elements that satisfy the predicate p from the range [first, last)
|
||||
/// to the range beginning at d_first_true, and
|
||||
/// copies the elements that do not satisfy p to the range beginning at d_first_false.
|
||||
///
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param out_true An output iterator to write the elements that satisfy the predicate into
|
||||
/// \param out_false An output iterator to write the elements that do not satisfy the predicate into
|
||||
/// \param p A predicate for dividing the elements of the input sequence.
|
||||
///
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template <typename InputIterator,
|
||||
typename OutputIterator1, typename OutputIterator2, typename UnaryPredicate>
|
||||
std::pair<OutputIterator1, OutputIterator2>
|
||||
partition_copy ( InputIterator first, InputIterator last,
|
||||
OutputIterator1 out_true, OutputIterator2 out_false, UnaryPredicate p )
|
||||
{
|
||||
for ( ; first != last; ++first )
|
||||
if ( p (*first))
|
||||
*out_true++ = *first;
|
||||
else
|
||||
*out_false++ = *first;
|
||||
return std::pair<OutputIterator1, OutputIterator2> ( out_true, out_false );
|
||||
}
|
||||
#endif
|
||||
|
||||
/// \fn partition_copy ( const Range &r,
|
||||
/// OutputIterator1 out_true, OutputIterator2 out_false, UnaryPredicate p )
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param out_true An output iterator to write the elements that satisfy the predicate into
|
||||
/// \param out_false An output iterator to write the elements that do not satisfy the predicate into
|
||||
/// \param p A predicate for dividing the elements of the input sequence.
|
||||
///
|
||||
template <typename Range, typename OutputIterator1, typename OutputIterator2,
|
||||
typename UnaryPredicate>
|
||||
std::pair<OutputIterator1, OutputIterator2>
|
||||
partition_copy ( const Range &r, OutputIterator1 out_true, OutputIterator2 out_false,
|
||||
UnaryPredicate p )
|
||||
{
|
||||
return boost::algorithm::partition_copy
|
||||
(boost::begin(r), boost::end(r), out_true, out_false, p );
|
||||
}
|
||||
|
||||
}} // namespace boost and algorithm
|
||||
|
||||
#endif // BOOST_ALGORITHM_PARTITION_COPY_HPP
|
@@ -1,72 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
*/
|
||||
|
||||
/// \file partition_point.hpp
|
||||
/// \brief Find the partition point in a sequence
|
||||
/// \author Marshall Clow
|
||||
|
||||
#ifndef BOOST_ALGORITHM_PARTITION_POINT_HPP
|
||||
#define BOOST_ALGORITHM_PARTITION_POINT_HPP
|
||||
|
||||
#include <algorithm> // for std::partition_point, if available
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
#if __cplusplus >= 201103L
|
||||
// Use the C++11 versions of iota if it is available
|
||||
using std::partition_point; // Section 25.3.13
|
||||
#else
|
||||
/// \fn partition_point ( ForwardIterator first, ForwardIterator last, Predicate p )
|
||||
/// \brief Given a partitioned range, returns the partition point, i.e, the first element
|
||||
/// that does not satisfy p
|
||||
///
|
||||
/// \param first The start of the input sequence
|
||||
/// \param last One past the end of the input sequence
|
||||
/// \param p The predicate to test the values with
|
||||
/// \note This function is part of the C++2011 standard library.
|
||||
/// We will use the standard one if it is available,
|
||||
/// otherwise we have our own implementation.
|
||||
template <typename ForwardIterator, typename Predicate>
|
||||
ForwardIterator partition_point ( ForwardIterator first, ForwardIterator last, Predicate p )
|
||||
{
|
||||
std::size_t dist = std::distance ( first, last );
|
||||
while ( first != last ) {
|
||||
std::size_t d2 = dist / 2;
|
||||
ForwardIterator ret_val = first;
|
||||
std::advance (ret_val, d2);
|
||||
if (p (*ret_val)) {
|
||||
first = ++ret_val;
|
||||
dist -= d2 + 1;
|
||||
}
|
||||
else {
|
||||
last = ret_val;
|
||||
dist = d2;
|
||||
}
|
||||
}
|
||||
return first;
|
||||
}
|
||||
#endif
|
||||
|
||||
/// \fn partition_point ( Range &r, Predicate p )
|
||||
/// \brief Given a partitioned range, returns the partition point
|
||||
///
|
||||
/// \param r The input range
|
||||
/// \param p The predicate to test the values with
|
||||
///
|
||||
template <typename Range, typename Predicate>
|
||||
typename boost::range_iterator<Range> partition_point ( Range &r, Predicate p )
|
||||
{
|
||||
return boost::algorithm::partition_point (boost::begin(r), boost::end(r), p);
|
||||
}
|
||||
|
||||
|
||||
}}
|
||||
|
||||
#endif // BOOST_ALGORITHM_PARTITION_POINT_HPP
|
@@ -1,268 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#ifndef BOOST_ALGORITHM_BOYER_MOORE_SEARCH_HPP
|
||||
#define BOOST_ALGORITHM_BOYER_MOORE_SEARCH_HPP
|
||||
|
||||
#include <iterator> // for std::iterator_traits
|
||||
|
||||
#include <boost/assert.hpp>
|
||||
#include <boost/static_assert.hpp>
|
||||
|
||||
#include <boost/range/begin.hpp>
|
||||
#include <boost/range/end.hpp>
|
||||
|
||||
#include <boost/utility/enable_if.hpp>
|
||||
#include <boost/type_traits/is_same.hpp>
|
||||
|
||||
#include <boost/algorithm/searching/detail/bm_traits.hpp>
|
||||
#include <boost/algorithm/searching/detail/debugging.hpp>
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
/*
|
||||
A templated version of the boyer-moore searching algorithm.
|
||||
|
||||
References:
|
||||
http://www.cs.utexas.edu/users/moore/best-ideas/string-searching/
|
||||
http://www.cs.utexas.edu/~moore/publications/fstrpos.pdf
|
||||
|
||||
Explanations: boostinspect:noascii (test tool complains)
|
||||
http://en.wikipedia.org/wiki/Boyer–Moore_string_search_algorithm
|
||||
http://www.movsd.com/bm.htm
|
||||
http://www.cs.ucdavis.edu/~gusfield/cs224f09/bnotes.pdf
|
||||
|
||||
The Boyer-Moore search algorithm uses two tables, a "bad character" table
|
||||
to tell how far to skip ahead when it hits a character that is not in the pattern,
|
||||
and a "good character" table to tell how far to skip ahead when it hits a
|
||||
mismatch on a character that _is_ in the pattern.
|
||||
|
||||
Requirements:
|
||||
* Random access iterators
|
||||
* The two iterator types (patIter and corpusIter) must
|
||||
"point to" the same underlying type and be comparable.
|
||||
* Additional requirements may be imposed but the skip table, such as:
|
||||
** Numeric type (array-based skip table)
|
||||
** Hashable type (map-based skip table)
|
||||
*/
|
||||
|
||||
template <typename patIter, typename traits = detail::BM_traits<patIter> >
|
||||
class boyer_moore {
|
||||
typedef typename std::iterator_traits<patIter>::difference_type difference_type;
|
||||
public:
|
||||
boyer_moore ( patIter first, patIter last )
|
||||
: pat_first ( first ), pat_last ( last ),
|
||||
k_pattern_length ( std::distance ( pat_first, pat_last )),
|
||||
skip_ ( k_pattern_length, -1 ),
|
||||
suffix_ ( k_pattern_length + 1 )
|
||||
{
|
||||
this->build_skip_table ( first, last );
|
||||
this->build_suffix_table ( first, last );
|
||||
}
|
||||
|
||||
~boyer_moore () {}
|
||||
|
||||
/// \fn operator ( corpusIter corpus_first, corpusIter corpus_last )
|
||||
/// \brief Searches the corpus for the pattern that was passed into the constructor
|
||||
///
|
||||
/// \param corpus_first The start of the data to search (Random Access Iterator)
|
||||
/// \param corpus_last One past the end of the data to search
|
||||
///
|
||||
template <typename corpusIter>
|
||||
corpusIter operator () ( corpusIter corpus_first, corpusIter corpus_last ) const {
|
||||
BOOST_STATIC_ASSERT (( boost::is_same<
|
||||
typename std::iterator_traits<patIter>::value_type,
|
||||
typename std::iterator_traits<corpusIter>::value_type>::value ));
|
||||
|
||||
if ( corpus_first == corpus_last ) return corpus_last; // if nothing to search, we didn't find it!
|
||||
if ( pat_first == pat_last ) return corpus_first; // empty pattern matches at start
|
||||
|
||||
const difference_type k_corpus_length = std::distance ( corpus_first, corpus_last );
|
||||
// If the pattern is larger than the corpus, we can't find it!
|
||||
if ( k_corpus_length < k_pattern_length )
|
||||
return corpus_last;
|
||||
|
||||
// Do the search
|
||||
return this->do_search ( corpus_first, corpus_last );
|
||||
}
|
||||
|
||||
template <typename Range>
|
||||
typename boost::range_iterator<Range>::type operator () ( Range &r ) const {
|
||||
return (*this) (boost::begin(r), boost::end(r));
|
||||
}
|
||||
|
||||
private:
|
||||
/// \cond DOXYGEN_HIDE
|
||||
patIter pat_first, pat_last;
|
||||
const difference_type k_pattern_length;
|
||||
typename traits::skip_table_t skip_;
|
||||
std::vector <difference_type> suffix_;
|
||||
|
||||
/// \fn operator ( corpusIter corpus_first, corpusIter corpus_last, Pred p )
|
||||
/// \brief Searches the corpus for the pattern that was passed into the constructor
|
||||
///
|
||||
/// \param corpus_first The start of the data to search (Random Access Iterator)
|
||||
/// \param corpus_last One past the end of the data to search
|
||||
/// \param p A predicate used for the search comparisons.
|
||||
///
|
||||
template <typename corpusIter>
|
||||
corpusIter do_search ( corpusIter corpus_first, corpusIter corpus_last ) const {
|
||||
/* ---- Do the matching ---- */
|
||||
corpusIter curPos = corpus_first;
|
||||
const corpusIter lastPos = corpus_last - k_pattern_length;
|
||||
difference_type j, k, m;
|
||||
|
||||
while ( curPos <= lastPos ) {
|
||||
/* while ( std::distance ( curPos, corpus_last ) >= k_pattern_length ) { */
|
||||
// Do we match right where we are?
|
||||
j = k_pattern_length;
|
||||
while ( pat_first [j-1] == curPos [j-1] ) {
|
||||
j--;
|
||||
// We matched - we're done!
|
||||
if ( j == 0 )
|
||||
return curPos;
|
||||
}
|
||||
|
||||
// Since we didn't match, figure out how far to skip forward
|
||||
k = skip_ [ curPos [ j - 1 ]];
|
||||
m = j - k - 1;
|
||||
if ( k < j && m > suffix_ [ j ] )
|
||||
curPos += m;
|
||||
else
|
||||
curPos += suffix_ [ j ];
|
||||
}
|
||||
|
||||
return corpus_last; // We didn't find anything
|
||||
}
|
||||
|
||||
|
||||
void build_skip_table ( patIter first, patIter last ) {
|
||||
for ( std::size_t i = 0; first != last; ++first, ++i )
|
||||
skip_.insert ( *first, i );
|
||||
}
|
||||
|
||||
|
||||
template<typename Iter, typename Container>
|
||||
void compute_bm_prefix ( Iter pat_first, Iter pat_last, Container &prefix ) {
|
||||
const std::size_t count = std::distance ( pat_first, pat_last );
|
||||
BOOST_ASSERT ( count > 0 );
|
||||
BOOST_ASSERT ( prefix.size () == count );
|
||||
|
||||
prefix[0] = 0;
|
||||
std::size_t k = 0;
|
||||
for ( std::size_t i = 1; i < count; ++i ) {
|
||||
BOOST_ASSERT ( k < count );
|
||||
while ( k > 0 && ( pat_first[k] != pat_first[i] )) {
|
||||
BOOST_ASSERT ( k < count );
|
||||
k = prefix [ k - 1 ];
|
||||
}
|
||||
|
||||
if ( pat_first[k] == pat_first[i] )
|
||||
k++;
|
||||
prefix [ i ] = k;
|
||||
}
|
||||
}
|
||||
|
||||
void build_suffix_table ( patIter pat_first, patIter pat_last ) {
|
||||
const std::size_t count = (std::size_t) std::distance ( pat_first, pat_last );
|
||||
|
||||
if ( count > 0 ) { // empty pattern
|
||||
std::vector<typename std::iterator_traits<patIter>::value_type> reversed(count);
|
||||
(void) std::reverse_copy ( pat_first, pat_last, reversed.begin ());
|
||||
|
||||
std::vector<difference_type> prefix (count);
|
||||
compute_bm_prefix ( pat_first, pat_last, prefix );
|
||||
|
||||
std::vector<difference_type> prefix_reversed (count);
|
||||
compute_bm_prefix ( reversed.begin (), reversed.end (), prefix_reversed );
|
||||
|
||||
for ( std::size_t i = 0; i <= count; i++ )
|
||||
suffix_[i] = count - prefix [count-1];
|
||||
|
||||
for ( std::size_t i = 0; i < count; i++ ) {
|
||||
const std::size_t j = count - prefix_reversed[i];
|
||||
const difference_type k = i - prefix_reversed[i] + 1;
|
||||
|
||||
if (suffix_[j] > k)
|
||||
suffix_[j] = k;
|
||||
}
|
||||
}
|
||||
}
|
||||
/// \endcond
|
||||
};
|
||||
|
||||
|
||||
/* Two ranges as inputs gives us four possibilities; with 2,3,3,4 parameters
|
||||
Use a bit of TMP to disambiguate the 3-argument templates */
|
||||
|
||||
/// \fn boyer_moore_search ( corpusIter corpus_first, corpusIter corpus_last,
|
||||
/// patIter pat_first, patIter pat_last )
|
||||
/// \brief Searches the corpus for the pattern.
|
||||
///
|
||||
/// \param corpus_first The start of the data to search (Random Access Iterator)
|
||||
/// \param corpus_last One past the end of the data to search
|
||||
/// \param pat_first The start of the pattern to search for (Random Access Iterator)
|
||||
/// \param pat_last One past the end of the data to search for
|
||||
///
|
||||
template <typename patIter, typename corpusIter>
|
||||
corpusIter boyer_moore_search (
|
||||
corpusIter corpus_first, corpusIter corpus_last,
|
||||
patIter pat_first, patIter pat_last )
|
||||
{
|
||||
boyer_moore<patIter> bm ( pat_first, pat_last );
|
||||
return bm ( corpus_first, corpus_last );
|
||||
}
|
||||
|
||||
template <typename PatternRange, typename corpusIter>
|
||||
corpusIter boyer_moore_search (
|
||||
corpusIter corpus_first, corpusIter corpus_last, const PatternRange &pattern )
|
||||
{
|
||||
typedef typename boost::range_iterator<PatternRange> pattern_iterator;
|
||||
boyer_moore<pattern_iterator> bm ( boost::begin(pattern), boost::end (pattern));
|
||||
return bm ( corpus_first, corpus_last );
|
||||
}
|
||||
|
||||
template <typename patIter, typename CorpusRange>
|
||||
typename boost::lazy_disable_if_c<
|
||||
boost::is_same<CorpusRange, patIter>::value, typename boost::range_iterator<CorpusRange> >
|
||||
::type
|
||||
boyer_moore_search ( CorpusRange &corpus, patIter pat_first, patIter pat_last )
|
||||
{
|
||||
boyer_moore<patIter> bm ( pat_first, pat_last );
|
||||
return bm (boost::begin (corpus), boost::end (corpus));
|
||||
}
|
||||
|
||||
template <typename PatternRange, typename CorpusRange>
|
||||
typename boost::range_iterator<CorpusRange>::type
|
||||
boyer_moore_search ( CorpusRange &corpus, const PatternRange &pattern )
|
||||
{
|
||||
typedef typename boost::range_iterator<PatternRange> pattern_iterator;
|
||||
boyer_moore<pattern_iterator> bm ( boost::begin(pattern), boost::end (pattern));
|
||||
return bm (boost::begin (corpus), boost::end (corpus));
|
||||
}
|
||||
|
||||
|
||||
// Creator functions -- take a pattern range, return an object
|
||||
template <typename Range>
|
||||
boost::algorithm::boyer_moore<typename boost::range_iterator<const Range>::type>
|
||||
make_boyer_moore ( const Range &r ) {
|
||||
return boost::algorithm::boyer_moore
|
||||
<typename boost::range_iterator<const Range>::type> (boost::begin(r), boost::end(r));
|
||||
}
|
||||
|
||||
template <typename Range>
|
||||
boost::algorithm::boyer_moore<typename boost::range_iterator<Range>::type>
|
||||
make_boyer_moore ( Range &r ) {
|
||||
return boost::algorithm::boyer_moore
|
||||
<typename boost::range_iterator<Range>::type> (boost::begin(r), boost::end(r));
|
||||
}
|
||||
|
||||
}}
|
||||
|
||||
#endif // BOOST_ALGORITHM_BOYER_MOORE_SEARCH_HPP
|
@@ -1,141 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#ifndef BOOST_ALGORITHM_BOYER_MOORE_HORSPOOOL_SEARCH_HPP
|
||||
#define BOOST_ALGORITHM_BOYER_MOORE_HORSPOOOL_SEARCH_HPP
|
||||
|
||||
#include <iterator> // for std::iterator_traits
|
||||
|
||||
#include <boost/assert.hpp>
|
||||
#include <boost/static_assert.hpp>
|
||||
#include <boost/type_traits/is_same.hpp>
|
||||
|
||||
#include <boost/algorithm/searching/detail/bm_traits.hpp>
|
||||
#include <boost/algorithm/searching/detail/debugging.hpp>
|
||||
|
||||
// #define BOOST_ALGORITHM_BOYER_MOORE_HORSPOOL_DEBUG_HPP
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
/*
|
||||
A templated version of the boyer-moore-horspool searching algorithm.
|
||||
|
||||
Requirements:
|
||||
* Random access iterators
|
||||
* The two iterator types (patIter and corpusIter) must
|
||||
"point to" the same underlying type.
|
||||
* Additional requirements may be imposed buy the skip table, such as:
|
||||
** Numeric type (array-based skip table)
|
||||
** Hashable type (map-based skip table)
|
||||
|
||||
http://www-igm.univ-mlv.fr/%7Elecroq/string/node18.html
|
||||
|
||||
*/
|
||||
|
||||
template <typename patIter, typename traits = detail::BM_traits<patIter> >
|
||||
class boyer_moore_horspool {
|
||||
typedef typename std::iterator_traits<patIter>::difference_type difference_type;
|
||||
public:
|
||||
boyer_moore_horspool ( patIter first, patIter last )
|
||||
: pat_first ( first ), pat_last ( last ),
|
||||
k_pattern_length ( std::distance ( pat_first, pat_last )),
|
||||
skip_ ( k_pattern_length, k_pattern_length ) {
|
||||
|
||||
// Build the skip table
|
||||
std::size_t i = 0;
|
||||
if ( first != last ) // empty pattern?
|
||||
for ( patIter iter = first; iter != last-1; ++iter, ++i )
|
||||
skip_.insert ( *iter, k_pattern_length - 1 - i );
|
||||
#ifdef BOOST_ALGORITHM_BOYER_MOORE_HORSPOOL_DEBUG_HPP
|
||||
skip_.PrintSkipTable ();
|
||||
#endif
|
||||
}
|
||||
|
||||
~boyer_moore_horspool () {}
|
||||
|
||||
/// \fn operator ( corpusIter corpus_first, corpusIter corpus_last, Pred p )
|
||||
/// \brief Searches the corpus for the pattern that was passed into the constructor
|
||||
///
|
||||
/// \param corpus_first The start of the data to search (Random Access Iterator)
|
||||
/// \param corpus_last One past the end of the data to search
|
||||
/// \param p A predicate used for the search comparisons.
|
||||
///
|
||||
template <typename corpusIter>
|
||||
corpusIter operator () ( corpusIter corpus_first, corpusIter corpus_last ) const {
|
||||
BOOST_STATIC_ASSERT (( boost::is_same<
|
||||
typename std::iterator_traits<patIter>::value_type,
|
||||
typename std::iterator_traits<corpusIter>::value_type>::value ));
|
||||
|
||||
if ( corpus_first == corpus_last ) return corpus_last; // if nothing to search, we didn't find it!
|
||||
if ( pat_first == pat_last ) return corpus_first; // empty pattern matches at start
|
||||
|
||||
const difference_type k_corpus_length = std::distance ( corpus_first, corpus_last );
|
||||
// If the pattern is larger than the corpus, we can't find it!
|
||||
if ( k_corpus_length < k_pattern_length )
|
||||
return corpus_last;
|
||||
|
||||
// Do the search
|
||||
return this->do_search ( corpus_first, corpus_last );
|
||||
}
|
||||
|
||||
private:
|
||||
/// \cond DOXYGEN_HIDE
|
||||
patIter pat_first, pat_last;
|
||||
const difference_type k_pattern_length;
|
||||
typename traits::skip_table_t skip_;
|
||||
|
||||
/// \fn do_search ( corpusIter corpus_first, corpusIter corpus_last )
|
||||
/// \brief Searches the corpus for the pattern that was passed into the constructor
|
||||
///
|
||||
/// \param corpus_first The start of the data to search (Random Access Iterator)
|
||||
/// \param corpus_last One past the end of the data to search
|
||||
/// \param k_corpus_length The length of the corpus to search
|
||||
///
|
||||
template <typename corpusIter>
|
||||
corpusIter do_search ( corpusIter corpus_first, corpusIter corpus_last ) const {
|
||||
corpusIter curPos = corpus_first;
|
||||
const corpusIter lastPos = corpus_last - k_pattern_length;
|
||||
while ( curPos <= lastPos ) {
|
||||
// Do we match right where we are?
|
||||
std::size_t j = k_pattern_length - 1;
|
||||
while ( pat_first [j] == curPos [j] ) {
|
||||
// We matched - we're done!
|
||||
if ( j == 0 )
|
||||
return curPos;
|
||||
j--;
|
||||
}
|
||||
|
||||
curPos += skip_ [ curPos [ k_pattern_length - 1 ]];
|
||||
}
|
||||
|
||||
return corpus_last;
|
||||
}
|
||||
// \endcond
|
||||
};
|
||||
|
||||
/// \fn boyer_moore_horspool_search ( corpusIter corpus_first, corpusIter corpus_last,
|
||||
/// patIter pat_first, patIter pat_last )
|
||||
/// \brief Searches the corpus for the pattern.
|
||||
///
|
||||
/// \param corpus_first The start of the data to search (Random Access Iterator)
|
||||
/// \param corpus_last One past the end of the data to search
|
||||
/// \param pat_first The start of the pattern to search for (Random Access Iterator)
|
||||
/// \param pat_last One past the end of the data to search for
|
||||
///
|
||||
template <typename patIter, typename corpusIter>
|
||||
corpusIter boyer_moore_horspool_search (
|
||||
corpusIter corpus_first, corpusIter corpus_last,
|
||||
patIter pat_first, patIter pat_last ) {
|
||||
boyer_moore_horspool<patIter> bmh ( pat_first, pat_last );
|
||||
return bmh ( corpus_first, corpus_last );
|
||||
}
|
||||
|
||||
}}
|
||||
|
||||
#endif // BOOST_ALGORITHM_BOYER_MOORE_HORSPOOOL_SEARCH_HPP
|
@@ -1,105 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#ifndef BOOST_ALGORITHM_SEARCH_DETAIL_BM_TRAITS_HPP
|
||||
#define BOOST_ALGORITHM_SEARCH_DETAIL_BM_TRAITS_HPP
|
||||
|
||||
#include <climits> // for CHAR_BIT
|
||||
#include <vector>
|
||||
#include <iterator> // for std::iterator_traits
|
||||
|
||||
#include <boost/type_traits/make_unsigned.hpp>
|
||||
#include <boost/type_traits/is_integral.hpp>
|
||||
#include <boost/type_traits/remove_pointer.hpp>
|
||||
#include <boost/type_traits/remove_const.hpp>
|
||||
|
||||
#include <boost/array.hpp>
|
||||
#include <boost/tr1/tr1/unordered_map>
|
||||
|
||||
#include <boost/algorithm/searching/detail/debugging.hpp>
|
||||
|
||||
namespace boost { namespace algorithm { namespace detail {
|
||||
|
||||
//
|
||||
// Default implementations of the skip tables for B-M and B-M-H
|
||||
//
|
||||
template<typename key_type, typename value_type, bool /*useArray*/> class skip_table;
|
||||
|
||||
// General case for data searching other than bytes; use a map
|
||||
template<typename key_type, typename value_type>
|
||||
class skip_table<key_type, value_type, false> {
|
||||
private:
|
||||
typedef std::tr1::unordered_map<key_type, value_type> skip_map;
|
||||
const value_type k_default_value;
|
||||
skip_map skip_;
|
||||
|
||||
public:
|
||||
skip_table ( std::size_t patSize, value_type default_value )
|
||||
: k_default_value ( default_value ), skip_ ( patSize ) {}
|
||||
|
||||
void insert ( key_type key, value_type val ) {
|
||||
skip_ [ key ] = val; // Would skip_.insert (val) be better here?
|
||||
}
|
||||
|
||||
value_type operator [] ( key_type key ) const {
|
||||
typename skip_map::const_iterator it = skip_.find ( key );
|
||||
return it == skip_.end () ? k_default_value : it->second;
|
||||
}
|
||||
|
||||
void PrintSkipTable () const {
|
||||
std::cout << "BM(H) Skip Table <unordered_map>:" << std::endl;
|
||||
for ( typename skip_map::const_iterator it = skip_.begin (); it != skip_.end (); ++it )
|
||||
if ( it->second != k_default_value )
|
||||
std::cout << " " << it->first << ": " << it->second << std::endl;
|
||||
std::cout << std::endl;
|
||||
}
|
||||
};
|
||||
|
||||
|
||||
// Special case small numeric values; use an array
|
||||
template<typename key_type, typename value_type>
|
||||
class skip_table<key_type, value_type, true> {
|
||||
private:
|
||||
typedef typename boost::make_unsigned<key_type>::type unsigned_key_type;
|
||||
typedef boost::array<value_type, 1U << (CHAR_BIT * sizeof(key_type))> skip_map;
|
||||
skip_map skip_;
|
||||
const value_type k_default_value;
|
||||
public:
|
||||
skip_table ( std::size_t patSize, value_type default_value ) : k_default_value ( default_value ) {
|
||||
std::fill_n ( skip_.begin(), skip_.size(), default_value );
|
||||
}
|
||||
|
||||
void insert ( key_type key, value_type val ) {
|
||||
skip_ [ static_cast<unsigned_key_type> ( key ) ] = val;
|
||||
}
|
||||
|
||||
value_type operator [] ( key_type key ) const {
|
||||
return skip_ [ static_cast<unsigned_key_type> ( key ) ];
|
||||
}
|
||||
|
||||
void PrintSkipTable () const {
|
||||
std::cout << "BM(H) Skip Table <boost:array>:" << std::endl;
|
||||
for ( typename skip_map::const_iterator it = skip_.begin (); it != skip_.end (); ++it )
|
||||
if ( *it != k_default_value )
|
||||
std::cout << " " << std::distance (skip_.begin (), it) << ": " << *it << std::endl;
|
||||
std::cout << std::endl;
|
||||
}
|
||||
};
|
||||
|
||||
template<typename Iterator>
|
||||
struct BM_traits {
|
||||
typedef typename std::iterator_traits<Iterator>::difference_type value_type;
|
||||
typedef typename std::iterator_traits<Iterator>::value_type key_type;
|
||||
typedef boost::algorithm::detail::skip_table<key_type, value_type,
|
||||
boost::is_integral<key_type>::value && (sizeof(key_type)==1)> skip_table_t;
|
||||
};
|
||||
|
||||
}}} // namespaces
|
||||
|
||||
#endif // BOOST_ALGORITHM_SEARCH_DETAIL_BM_TRAITS_HPP
|
@@ -1,30 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#ifndef BOOST_ALGORITHM_SEARCH_DETAIL_DEBUG_HPP
|
||||
#define BOOST_ALGORITHM_SEARCH_DETAIL_DEBUG_HPP
|
||||
|
||||
#include <iostream>
|
||||
/// \cond DOXYGEN_HIDE
|
||||
|
||||
namespace boost { namespace algorithm { namespace detail {
|
||||
|
||||
// Debugging support
|
||||
template <typename Iter>
|
||||
void PrintTable ( Iter first, Iter last ) {
|
||||
std::cout << std::distance ( first, last ) << ": { ";
|
||||
for ( Iter iter = first; iter != last; ++iter )
|
||||
std::cout << *iter << " ";
|
||||
std::cout << "}" << std::endl;
|
||||
}
|
||||
|
||||
}}}
|
||||
/// \endcond
|
||||
|
||||
#endif // BOOST_ALGORITHM_SEARCH_DETAIL_DEBUG_HPP
|
@@ -1,200 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#ifndef BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_SEARCH_HPP
|
||||
#define BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_SEARCH_HPP
|
||||
|
||||
#include <vector>
|
||||
#include <iterator> // for std::iterator_traits
|
||||
|
||||
#include <boost/assert.hpp>
|
||||
#include <boost/static_assert.hpp>
|
||||
#include <boost/type_traits/is_same.hpp>
|
||||
|
||||
#include <boost/algorithm/searching/detail/debugging.hpp>
|
||||
|
||||
// #define BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_DEBUG
|
||||
|
||||
namespace boost { namespace algorithm {
|
||||
|
||||
// #define NEW_KMP
|
||||
|
||||
/*
|
||||
A templated version of the Knuth-Morris-Pratt searching algorithm.
|
||||
|
||||
Requirements:
|
||||
* Random-access iterators
|
||||
* The two iterator types (I1 and I2) must "point to" the same underlying type.
|
||||
|
||||
http://en.wikipedia.org/wiki/Knuth–Morris–Pratt_algorithm
|
||||
http://www.inf.fh-flensburg.de/lang/algorithmen/pattern/kmpen.htm
|
||||
*/
|
||||
|
||||
template <typename patIter>
|
||||
class knuth_morris_pratt {
|
||||
typedef typename std::iterator_traits<patIter>::difference_type difference_type;
|
||||
public:
|
||||
knuth_morris_pratt ( patIter first, patIter last )
|
||||
: pat_first ( first ), pat_last ( last ),
|
||||
k_pattern_length ( std::distance ( pat_first, pat_last )),
|
||||
skip_ ( k_pattern_length + 1 ) {
|
||||
#ifdef NEW_KMP
|
||||
preKmp ( pat_first, pat_last );
|
||||
#else
|
||||
init_skip_table ( pat_first, pat_last );
|
||||
#endif
|
||||
#ifdef BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_DEBUG
|
||||
detail::PrintTable ( skip_.begin (), skip_.end ());
|
||||
#endif
|
||||
}
|
||||
|
||||
~knuth_morris_pratt () {}
|
||||
|
||||
/// \fn operator ( corpusIter corpus_first, corpusIter corpus_last, Pred p )
|
||||
/// \brief Searches the corpus for the pattern that was passed into the constructor
|
||||
///
|
||||
/// \param corpus_first The start of the data to search (Random Access Iterator)
|
||||
/// \param corpus_last One past the end of the data to search
|
||||
/// \param p A predicate used for the search comparisons.
|
||||
///
|
||||
template <typename corpusIter>
|
||||
corpusIter operator () ( corpusIter corpus_first, corpusIter corpus_last ) const {
|
||||
BOOST_STATIC_ASSERT (( boost::is_same<
|
||||
typename std::iterator_traits<patIter>::value_type,
|
||||
typename std::iterator_traits<corpusIter>::value_type>::value ));
|
||||
if ( corpus_first == corpus_last ) return corpus_last; // if nothing to search, we didn't find it!
|
||||
if ( pat_first == pat_last ) return corpus_first; // empty pattern matches at start
|
||||
|
||||
const difference_type k_corpus_length = std::distance ( corpus_first, corpus_last );
|
||||
// If the pattern is larger than the corpus, we can't find it!
|
||||
if ( k_corpus_length < k_pattern_length )
|
||||
return corpus_last;
|
||||
|
||||
return do_search ( corpus_first, corpus_last, k_corpus_length );
|
||||
}
|
||||
|
||||
private:
|
||||
/// \cond DOXYGEN_HIDE
|
||||
patIter pat_first, pat_last;
|
||||
const difference_type k_pattern_length;
|
||||
std::vector <difference_type> skip_;
|
||||
|
||||
/// \fn operator ( corpusIter corpus_first, corpusIter corpus_last, Pred p )
|
||||
/// \brief Searches the corpus for the pattern that was passed into the constructor
|
||||
///
|
||||
/// \param corpus_first The start of the data to search (Random Access Iterator)
|
||||
/// \param corpus_last One past the end of the data to search
|
||||
/// \param p A predicate used for the search comparisons.
|
||||
///
|
||||
template <typename corpusIter>
|
||||
corpusIter do_search ( corpusIter corpus_first, corpusIter corpus_last,
|
||||
difference_type k_corpus_length ) const {
|
||||
difference_type match_start = 0; // position in the corpus that we're matching
|
||||
|
||||
#ifdef NEW_KMP
|
||||
int patternIdx = 0;
|
||||
while ( match_start < k_corpus_length ) {
|
||||
while ( patternIdx > -1 && pat_first[patternIdx] != corpus_first [match_start] )
|
||||
patternIdx = skip_ [patternIdx]; //<--- Shifting the pattern on mismatch
|
||||
|
||||
patternIdx++;
|
||||
match_start++; //<--- corpus is always increased by 1
|
||||
|
||||
if ( patternIdx >= (int) k_pattern_length )
|
||||
return corpus_first + match_start - patternIdx;
|
||||
}
|
||||
|
||||
#else
|
||||
// At this point, we know:
|
||||
// k_pattern_length <= k_corpus_length
|
||||
// for all elements of skip, it holds -1 .. k_pattern_length
|
||||
//
|
||||
// In the loop, we have the following invariants
|
||||
// idx is in the range 0 .. k_pattern_length
|
||||
// match_start is in the range 0 .. k_corpus_length - k_pattern_length + 1
|
||||
|
||||
const difference_type last_match = k_corpus_length - k_pattern_length;
|
||||
difference_type idx = 0; // position in the pattern we're comparing
|
||||
|
||||
while ( match_start <= last_match ) {
|
||||
while ( pat_first [ idx ] == corpus_first [ match_start + idx ] ) {
|
||||
if ( ++idx == k_pattern_length )
|
||||
return corpus_first + match_start;
|
||||
}
|
||||
// Figure out where to start searching again
|
||||
// assert ( idx - skip_ [ idx ] > 0 ); // we're always moving forward
|
||||
match_start += idx - skip_ [ idx ];
|
||||
idx = skip_ [ idx ] >= 0 ? skip_ [ idx ] : 0;
|
||||
// assert ( idx >= 0 && idx < k_pattern_length );
|
||||
}
|
||||
#endif
|
||||
|
||||
// We didn't find anything
|
||||
return corpus_last;
|
||||
}
|
||||
|
||||
|
||||
void preKmp ( patIter first, patIter last ) {
|
||||
const /*std::size_t*/ int count = std::distance ( first, last );
|
||||
|
||||
int i, j;
|
||||
|
||||
i = 0;
|
||||
j = skip_[0] = -1;
|
||||
while (i < count) {
|
||||
while (j > -1 && first[i] != first[j])
|
||||
j = skip_[j];
|
||||
i++;
|
||||
j++;
|
||||
if (first[i] == first[j])
|
||||
skip_[i] = skip_[j];
|
||||
else
|
||||
skip_[i] = j;
|
||||
}
|
||||
}
|
||||
|
||||
|
||||
void init_skip_table ( patIter first, patIter last ) {
|
||||
const difference_type count = std::distance ( first, last );
|
||||
|
||||
int j;
|
||||
skip_ [ 0 ] = -1;
|
||||
for ( int i = 1; i <= count; ++i ) {
|
||||
j = skip_ [ i - 1 ];
|
||||
while ( j >= 0 ) {
|
||||
if ( first [ j ] == first [ i - 1 ] )
|
||||
break;
|
||||
j = skip_ [ j ];
|
||||
}
|
||||
skip_ [ i ] = j + 1;
|
||||
}
|
||||
}
|
||||
// \endcond
|
||||
};
|
||||
|
||||
|
||||
/// \fn knuth_morris_pratt_search ( corpusIter corpus_first, corpusIter corpus_last,
|
||||
/// patIter pat_first, patIter pat_last )
|
||||
/// \brief Searches the corpus for the pattern.
|
||||
///
|
||||
/// \param corpus_first The start of the data to search (Random Access Iterator)
|
||||
/// \param corpus_last One past the end of the data to search
|
||||
/// \param pat_first The start of the pattern to search for (Random Access Iterator)
|
||||
/// \param pat_last One past the end of the data to search for
|
||||
///
|
||||
template <typename patIter, typename corpusIter>
|
||||
corpusIter knuth_morris_pratt_search (
|
||||
corpusIter corpus_first, corpusIter corpus_last,
|
||||
patIter pat_first, patIter pat_last ) {
|
||||
knuth_morris_pratt<patIter> kmp ( pat_first, pat_last );
|
||||
return kmp ( corpus_first, corpus_last );
|
||||
}
|
||||
}}
|
||||
|
||||
#endif // BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_SEARCH_HPP
|
@@ -15,8 +15,6 @@
|
||||
#include <locale>
|
||||
#include <functional>
|
||||
|
||||
#include <boost/type_traits/make_unsigned.hpp>
|
||||
|
||||
namespace boost {
|
||||
namespace algorithm {
|
||||
namespace detail {
|
||||
@@ -39,7 +37,7 @@ namespace boost {
|
||||
CharT operator ()( CharT Ch ) const
|
||||
{
|
||||
#if defined(__BORLANDC__) && (__BORLANDC__ >= 0x560) && (__BORLANDC__ <= 0x564) && !defined(_USE_OLD_RW_STL)
|
||||
return std::tolower( static_cast<typename boost::make_unsigned <CharT>::type> ( Ch ));
|
||||
return std::tolower( Ch);
|
||||
#else
|
||||
return std::tolower<CharT>( Ch, *m_Loc );
|
||||
#endif
|
||||
@@ -59,7 +57,7 @@ namespace boost {
|
||||
CharT operator ()( CharT Ch ) const
|
||||
{
|
||||
#if defined(__BORLANDC__) && (__BORLANDC__ >= 0x560) && (__BORLANDC__ <= 0x564) && !defined(_USE_OLD_RW_STL)
|
||||
return std::toupper( static_cast<typename boost::make_unsigned <CharT>::type> ( Ch ));
|
||||
return std::toupper( Ch);
|
||||
#else
|
||||
return std::toupper<CharT>( Ch, *m_Loc );
|
||||
#endif
|
||||
|
@@ -126,7 +126,7 @@ namespace boost {
|
||||
}
|
||||
|
||||
// Use fixed storage
|
||||
::std::memcpy(DestStorage, SrcStorage, sizeof(set_value_type)*m_Size);
|
||||
::memcpy(DestStorage, SrcStorage, sizeof(set_value_type)*m_Size);
|
||||
}
|
||||
|
||||
// Destructor
|
||||
@@ -206,7 +206,7 @@ namespace boost {
|
||||
}
|
||||
|
||||
// Copy the data
|
||||
::std::memcpy(DestStorage, SrcStorage, sizeof(set_value_type)*m_Size);
|
||||
::memcpy(DestStorage, SrcStorage, sizeof(set_value_type)*m_Size);
|
||||
|
||||
return *this;
|
||||
}
|
||||
|
@@ -87,31 +87,6 @@ namespace boost {
|
||||
}
|
||||
};
|
||||
|
||||
// dissect format functor ----------------------------------------------------//
|
||||
|
||||
// dissect format functor
|
||||
template<typename FinderT>
|
||||
struct dissect_formatF
|
||||
{
|
||||
public:
|
||||
// Construction
|
||||
dissect_formatF(FinderT Finder) :
|
||||
m_Finder(Finder) {}
|
||||
|
||||
// Operation
|
||||
template<typename RangeT>
|
||||
inline iterator_range<
|
||||
BOOST_STRING_TYPENAME range_const_iterator<RangeT>::type>
|
||||
operator()(const RangeT& Replace) const
|
||||
{
|
||||
return m_Finder(::boost::begin(Replace), ::boost::end(Replace));
|
||||
}
|
||||
|
||||
private:
|
||||
FinderT m_Finder;
|
||||
};
|
||||
|
||||
|
||||
} // namespace detail
|
||||
} // namespace algorithm
|
||||
} // namespace boost
|
||||
|
@@ -36,7 +36,7 @@ namespace boost {
|
||||
|
||||
//! Constant formatter
|
||||
/*!
|
||||
Constructs a \c const_formatter. Const formatter always returns
|
||||
Construct the \c const_formatter. Const formatter always returns
|
||||
the same value, regardless of the parameter.
|
||||
|
||||
\param Format A predefined value used as a result for formating
|
||||
@@ -55,7 +55,7 @@ namespace boost {
|
||||
|
||||
//! Identity formatter
|
||||
/*!
|
||||
Constructs an \c identity_formatter. Identity formatter always returns
|
||||
Construct the \c identity_formatter. Identity formatter always returns
|
||||
the parameter.
|
||||
|
||||
\return An instance of the \c identity_formatter object.
|
||||
@@ -73,7 +73,7 @@ namespace boost {
|
||||
|
||||
//! Empty formatter
|
||||
/*!
|
||||
Constructs an \c empty_formatter. Empty formatter always returns an empty
|
||||
Construct the \c empty_formatter. Empty formatter always returns an empty
|
||||
sequence.
|
||||
|
||||
\param Input container used to select a correct value_type for the
|
||||
@@ -89,22 +89,6 @@ namespace boost {
|
||||
BOOST_STRING_TYPENAME range_value<RangeT>::type>();
|
||||
}
|
||||
|
||||
//! Empty formatter
|
||||
/*!
|
||||
Constructs a \c dissect_formatter. Dissect formatter uses a specified finder
|
||||
to extract a portion of the formatted sequence. The first finder's match is returned
|
||||
as a result
|
||||
|
||||
\param Finder a finder used to select a portion of the formated sequence
|
||||
\return An instance of the \c dissect_formatter object.
|
||||
*/
|
||||
template<typename FinderT>
|
||||
inline detail::dissect_formatF< FinderT >
|
||||
dissect_formatter(const FinderT& Finder)
|
||||
{
|
||||
return detail::dissect_formatF<FinderT>(Finder);
|
||||
}
|
||||
|
||||
|
||||
} // namespace algorithm
|
||||
|
||||
@@ -112,7 +96,6 @@ namespace boost {
|
||||
using algorithm::const_formatter;
|
||||
using algorithm::identity_formatter;
|
||||
using algorithm::empty_formatter;
|
||||
using algorithm::dissect_formatter;
|
||||
|
||||
} // namespace boost
|
||||
|
||||
|
@@ -1,217 +0,0 @@
|
||||
// Boost string_algo library trim.hpp header file ---------------------------//
|
||||
|
||||
// Copyright Pavol Droba 2002-2003.
|
||||
//
|
||||
// Distributed under the Boost Software License, Version 1.0.
|
||||
// (See accompanying file LICENSE_1_0.txt or copy at
|
||||
// http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
// See http://www.boost.org/ for updates, documentation, and revision history.
|
||||
|
||||
#ifndef BOOST_STRING_TRIM_ALL_HPP
|
||||
#define BOOST_STRING_TRIM_ALL_HPP
|
||||
|
||||
#include <boost/algorithm/string/config.hpp>
|
||||
|
||||
#include <boost/algorithm/string/trim.hpp>
|
||||
#include <boost/algorithm/string/classification.hpp>
|
||||
#include <boost/algorithm/string/find_format.hpp>
|
||||
#include <boost/algorithm/string/formatter.hpp>
|
||||
#include <boost/algorithm/string/finder.hpp>
|
||||
#include <locale>
|
||||
|
||||
/*! \file
|
||||
Defines trim_all algorithms.
|
||||
|
||||
Just like \c trim, \c trim_all removes all trailing and leading spaces from a
|
||||
sequence (string). In addition, spaces in the middle of the sequence are truncated
|
||||
to just one character. Space is recognized using given locales.
|
||||
|
||||
\c trim_fill acts as trim_all, but the spaces in the middle are replaces with
|
||||
a user-define sequence of character.
|
||||
|
||||
Parametric (\c _if) variants use a predicate (functor) to select which characters
|
||||
are to be trimmed..
|
||||
Functions take a selection predicate as a parameter, which is used to determine
|
||||
whether a character is a space. Common predicates are provided in classification.hpp header.
|
||||
|
||||
*/
|
||||
|
||||
namespace boost {
|
||||
namespace algorithm {
|
||||
|
||||
// multi line trim ----------------------------------------------- //
|
||||
|
||||
//! Trim All - parametric
|
||||
/*!
|
||||
Remove all leading and trailing spaces from the input and
|
||||
compress all other spaces to a single character.
|
||||
The result is a trimmed copy of the input
|
||||
|
||||
\param Input An input sequence
|
||||
\param IsSpace An unary predicate identifying spaces
|
||||
\return A trimmed copy of the input
|
||||
*/
|
||||
template<typename SequenceT, typename PredicateT>
|
||||
inline SequenceT trim_all_copy_if(const SequenceT& Input, PredicateT IsSpace)
|
||||
{
|
||||
return
|
||||
::boost::find_format_all_copy(
|
||||
::boost::trim_copy_if(Input, IsSpace),
|
||||
::boost::token_finder(IsSpace, ::boost::token_compress_on),
|
||||
::boost::dissect_formatter(::boost::head_finder(1)));
|
||||
}
|
||||
|
||||
|
||||
//! Trim All
|
||||
/*!
|
||||
Remove all leading and trailing spaces from the input and
|
||||
compress all other spaces to a single character.
|
||||
The input sequence is modified in-place.
|
||||
|
||||
\param Input An input sequence
|
||||
\param IsSpace An unary predicate identifying spaces
|
||||
*/
|
||||
template<typename SequenceT, typename PredicateT>
|
||||
inline void trim_all_if(SequenceT& Input, PredicateT IsSpace)
|
||||
{
|
||||
::boost::trim_if(Input, IsSpace);
|
||||
::boost::find_format_all(
|
||||
Input,
|
||||
::boost::token_finder(IsSpace, ::boost::token_compress_on),
|
||||
::boost::dissect_formatter(::boost::head_finder(1)));
|
||||
}
|
||||
|
||||
|
||||
//! Trim All
|
||||
/*!
|
||||
Remove all leading and trailing spaces from the input and
|
||||
compress all other spaces to a single character.
|
||||
The result is a trimmed copy of the input
|
||||
|
||||
\param Input An input sequence
|
||||
\param Loc A locale used for 'space' classification
|
||||
\return A trimmed copy of the input
|
||||
*/
|
||||
template<typename SequenceT>
|
||||
inline SequenceT trim_all_copy(const SequenceT& Input, const std::locale& Loc =std::locale())
|
||||
{
|
||||
return trim_all_copy_if(Input, ::boost::is_space(Loc));
|
||||
}
|
||||
|
||||
|
||||
//! Trim All
|
||||
/*!
|
||||
Remove all leading and trailing spaces from the input and
|
||||
compress all other spaces to a single character.
|
||||
The input sequence is modified in-place.
|
||||
|
||||
\param Input An input sequence
|
||||
\param Loc A locale used for 'space' classification
|
||||
\return A trimmed copy of the input
|
||||
*/
|
||||
template<typename SequenceT>
|
||||
inline void trim_all(SequenceT& Input, const std::locale& Loc =std::locale())
|
||||
{
|
||||
trim_all_if(Input, ::boost::is_space(Loc));
|
||||
}
|
||||
|
||||
|
||||
//! Trim Fill - parametric
|
||||
/*!
|
||||
Remove all leading and trailing spaces from the input and
|
||||
replace all every block of consecutive spaces with a fill string
|
||||
defined by user.
|
||||
The result is a trimmed copy of the input
|
||||
|
||||
\param Input An input sequence
|
||||
\param Fill A string used to fill the inner spaces
|
||||
\param IsSpace An unary predicate identifying spaces
|
||||
\return A trimmed copy of the input
|
||||
*/
|
||||
template<typename SequenceT, typename RangeT, typename PredicateT>
|
||||
inline SequenceT trim_fill_copy_if(const SequenceT& Input, const RangeT& Fill, PredicateT IsSpace)
|
||||
{
|
||||
return
|
||||
::boost::find_format_all_copy(
|
||||
::boost::trim_copy_if(Input, IsSpace),
|
||||
::boost::token_finder(IsSpace, ::boost::token_compress_on),
|
||||
::boost::const_formatter(::boost::as_literal(Fill)));
|
||||
}
|
||||
|
||||
|
||||
//! Trim Fill
|
||||
/*!
|
||||
Remove all leading and trailing spaces from the input and
|
||||
replace all every block of consecutive spaces with a fill string
|
||||
defined by user.
|
||||
The input sequence is modified in-place.
|
||||
|
||||
\param Input An input sequence
|
||||
\param Fill A string used to fill the inner spaces
|
||||
\param IsSpace An unary predicate identifying spaces
|
||||
*/
|
||||
template<typename SequenceT, typename RangeT, typename PredicateT>
|
||||
inline void trim_fill_if(SequenceT& Input, const RangeT& Fill, PredicateT IsSpace)
|
||||
{
|
||||
::boost::trim_if(Input, IsSpace);
|
||||
::boost::find_format_all(
|
||||
Input,
|
||||
::boost::token_finder(IsSpace, ::boost::token_compress_on),
|
||||
::boost::const_formatter(::boost::as_literal(Fill)));
|
||||
}
|
||||
|
||||
|
||||
//! Trim Fill
|
||||
/*!
|
||||
Remove all leading and trailing spaces from the input and
|
||||
replace all every block of consecutive spaces with a fill string
|
||||
defined by user.
|
||||
The result is a trimmed copy of the input
|
||||
|
||||
\param Input An input sequence
|
||||
\param Fill A string used to fill the inner spaces
|
||||
\param Loc A locale used for 'space' classification
|
||||
\return A trimmed copy of the input
|
||||
*/
|
||||
template<typename SequenceT, typename RangeT>
|
||||
inline SequenceT trim_fill_copy(const SequenceT& Input, const RangeT& Fill, const std::locale& Loc =std::locale())
|
||||
{
|
||||
return trim_fill_copy_if(Input, Fill, ::boost::is_space(Loc));
|
||||
}
|
||||
|
||||
|
||||
//! Trim Fill
|
||||
/*!
|
||||
Remove all leading and trailing spaces from the input and
|
||||
replace all every block of consecutive spaces with a fill string
|
||||
defined by user.
|
||||
The input sequence is modified in-place.
|
||||
|
||||
\param Input An input sequence
|
||||
\param Fill A string used to fill the inner spaces
|
||||
\param Loc A locale used for 'space' classification
|
||||
\return A trimmed copy of the input
|
||||
*/
|
||||
template<typename SequenceT, typename RangeT>
|
||||
inline void trim_fill(SequenceT& Input, const RangeT& Fill, const std::locale& Loc =std::locale())
|
||||
{
|
||||
trim_fill_if(Input, Fill, ::boost::is_space(Loc));
|
||||
}
|
||||
|
||||
|
||||
} // namespace algorithm
|
||||
|
||||
// pull names to the boost namespace
|
||||
using algorithm::trim_all;
|
||||
using algorithm::trim_all_if;
|
||||
using algorithm::trim_all_copy;
|
||||
using algorithm::trim_all_copy_if;
|
||||
using algorithm::trim_fill;
|
||||
using algorithm::trim_fill_if;
|
||||
using algorithm::trim_fill_copy;
|
||||
using algorithm::trim_fill_copy_if;
|
||||
|
||||
} // namespace boost
|
||||
|
||||
#endif // BOOST_STRING_TRIM_ALL_HPP
|
@@ -338,7 +338,7 @@ most</i> instead of <i>exactly</i> in the odd case.
|
||||
<b>Rationale:</b></h3>
|
||||
|
||||
<a name="two_headers">
|
||||
<h4><b>Why not a single header <tt><boost/algorithm/minmax.hpp></tt>?</b></h4>
|
||||
<h4><b>Why not a single header <tt>&boost/algorithm/minmax.hpp></tt>?</b></h4>
|
||||
<p>This was the design originally proposed and approved in the formal
|
||||
review. As the need for Boost.tuple became clear (due to the limitations
|
||||
of <tt>std::pair</tt>), it became also annoying to require another
|
||||
|
@@ -43,7 +43,6 @@ doxygen autodoc
|
||||
[ glob ../../../../boost/algorithm/string/formatter.hpp ]
|
||||
[ glob ../../../../boost/algorithm/string/regex.hpp ]
|
||||
[ glob ../../../../boost/algorithm/string/regex_find_format.hpp ]
|
||||
[ glob ../../../../boost/algorithm/string/trim_all.hpp ]
|
||||
:
|
||||
<doxygen:param>HIDE_UNDOC_MEMBERS=YES
|
||||
<doxygen:param>EXTRACT_PRIVATE=NO
|
||||
|
@@ -737,20 +737,6 @@
|
||||
<functionname>is_xdigit()</functionname>
|
||||
</entry>
|
||||
</row>
|
||||
<row>
|
||||
<entry>is_any_of</entry>
|
||||
<entry>Recognize any of a sequence of characters</entry>
|
||||
<entry>
|
||||
<functionname>is_any_of()</functionname>
|
||||
</entry>
|
||||
</row>
|
||||
<row>
|
||||
<entry>is_from_range</entry>
|
||||
<entry>Recognize characters inside a min..max range</entry>
|
||||
<entry>
|
||||
<functionname>is_from_range()</functionname>
|
||||
</entry>
|
||||
</row>
|
||||
</tbody>
|
||||
</tgroup>
|
||||
</table>
|
||||
|
@@ -11,9 +11,6 @@
|
||||
#include <boost/algorithm/string/erase.hpp>
|
||||
#include <boost/algorithm/string/std/list_traits.hpp>
|
||||
#include <boost/algorithm/string/std/string_traits.hpp>
|
||||
#include <boost/algorithm/string/finder.hpp>
|
||||
#include <boost/algorithm/string/formatter.hpp>
|
||||
#include <boost/algorithm/string/classification.hpp>
|
||||
|
||||
// Include unit test framework
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
@@ -288,23 +285,6 @@ void collection_comp_test()
|
||||
}
|
||||
}
|
||||
|
||||
void dissect_format_test()
|
||||
{
|
||||
BOOST_CHECK(
|
||||
find_format_all_copy(
|
||||
string("aBc123Abc"),
|
||||
first_finder("abc", is_iequal()),
|
||||
dissect_formatter(token_finder(is_upper())))=="B123A");
|
||||
|
||||
|
||||
BOOST_CHECK(
|
||||
find_format_all_copy(
|
||||
string("abc 123 abc"),
|
||||
token_finder(is_space(), token_compress_on),
|
||||
dissect_formatter(head_finder(1)))=="abc 123 abc");
|
||||
|
||||
}
|
||||
|
||||
// test main
|
||||
int test_main( int, char*[] )
|
||||
{
|
||||
@@ -317,7 +297,6 @@ int test_main( int, char*[] )
|
||||
replace_tail_test();
|
||||
replace_range_test();
|
||||
collection_comp_test();
|
||||
dissect_format_test();
|
||||
|
||||
return 0;
|
||||
}
|
||||
|
@@ -8,7 +8,6 @@
|
||||
// See http://www.boost.org for updates, documentation, and revision history.
|
||||
|
||||
#include <boost/algorithm/string/trim.hpp>
|
||||
#include <boost/algorithm/string/trim_all.hpp>
|
||||
|
||||
// Include unit test framework
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
@@ -110,95 +109,10 @@ void trim_test()
|
||||
BOOST_CHECK( trim_copy_if( string("<>abc<>"), is_any_of( "<<>>" ) )=="abc" );
|
||||
}
|
||||
|
||||
void trim_all_test()
|
||||
{
|
||||
string str1(" 1x x x x1 ");
|
||||
string str2("+---...2x+--x--+x-+-x2...---+");
|
||||
string str3(" ");
|
||||
|
||||
// *** value passing tests *** //
|
||||
|
||||
// general string test
|
||||
BOOST_CHECK( trim_all_copy( str1 )=="1x x x x1" ) ;
|
||||
BOOST_CHECK( trim_all_copy_if( str2, is_punct() )=="2x+x-x-x2" ) ;
|
||||
|
||||
// spaces-only string test
|
||||
BOOST_CHECK( trim_all_copy( str3 )=="" );
|
||||
|
||||
// empty string check
|
||||
BOOST_CHECK( trim_all_copy( string("") )=="" );
|
||||
|
||||
// general string test
|
||||
trim_all( str1 );
|
||||
BOOST_CHECK( str1=="1x x x x1" ) ;
|
||||
trim_all_if( str2, is_punct() );
|
||||
BOOST_CHECK( str2=="2x+x-x-x2" ) ;
|
||||
|
||||
// spaces-only string test
|
||||
str3 = " "; trim_all( str3 );
|
||||
BOOST_CHECK( str3=="" );
|
||||
|
||||
// empty string check
|
||||
str3 = ""; trim_all( str3 );
|
||||
BOOST_CHECK( str3=="" );
|
||||
BOOST_CHECK( str3=="" );
|
||||
|
||||
// *** non-standard predicate tests *** //
|
||||
BOOST_CHECK(
|
||||
trim_all_copy_if(
|
||||
string("123abc127deb456"),
|
||||
is_classified(std::ctype_base::digit) )=="abc1deb" );
|
||||
BOOST_CHECK( trim_all_copy_if( string("<>abc<>def<>"), is_any_of( "<<>>" ) )=="abc<def" );
|
||||
}
|
||||
|
||||
void trim_fill_test()
|
||||
{
|
||||
string str1(" 1x x x x1 ");
|
||||
string str2("+---...2x+--x--+x-+-x2...---+");
|
||||
string str3(" ");
|
||||
|
||||
// *** value passing tests *** //
|
||||
|
||||
// general string test
|
||||
BOOST_CHECK( trim_fill_copy( str1, "-" )=="1x-x-x-x1" ) ;
|
||||
BOOST_CHECK( trim_fill_copy_if( str2, " ", is_punct() )=="2x x x x2" ) ;
|
||||
|
||||
// spaces-only string test
|
||||
BOOST_CHECK( trim_fill_copy( str3, " " )=="" );
|
||||
|
||||
// empty string check
|
||||
BOOST_CHECK( trim_fill_copy( string(""), " " )=="" );
|
||||
|
||||
// general string test
|
||||
trim_fill( str1, "-" );
|
||||
BOOST_CHECK( str1=="1x-x-x-x1" ) ;
|
||||
trim_fill_if( str2, "", is_punct() );
|
||||
BOOST_CHECK( str2=="2xxxx2" ) ;
|
||||
|
||||
// spaces-only string test
|
||||
str3 = " "; trim_fill( str3, "" );
|
||||
BOOST_CHECK( str3=="" );
|
||||
|
||||
// empty string check
|
||||
str3 = ""; trim_fill( str3, "" );
|
||||
BOOST_CHECK( str3=="" );
|
||||
BOOST_CHECK( str3=="" );
|
||||
|
||||
// *** non-standard predicate tests *** //
|
||||
BOOST_CHECK(
|
||||
trim_fill_copy_if(
|
||||
string("123abc127deb456"),
|
||||
"+",
|
||||
is_classified(std::ctype_base::digit) )=="abc+deb" );
|
||||
BOOST_CHECK( trim_fill_copy_if( string("<>abc<>def<>"), "-", is_any_of( "<<>>" ) )=="abc-def" );
|
||||
}
|
||||
|
||||
// test main
|
||||
int test_main( int, char*[] )
|
||||
{
|
||||
trim_test();
|
||||
trim_all_test();
|
||||
trim_fill_test();
|
||||
|
||||
|
||||
return 0;
|
||||
}
|
||||
|
@@ -1,44 +0,0 @@
|
||||
# Boost algorithm library test suite Jamfile ----------------------------
|
||||
#
|
||||
# Copyright Marshall Clow 2010-2012. Use, modification and
|
||||
# distribution is subject to the Boost Software License, Version
|
||||
# 1.0. (See accompanying file LICENSE_1_0.txt or copy at
|
||||
# http://www.boost.org/LICENSE_1_0.txt)
|
||||
#
|
||||
# See http://www.boost.org for updates, documentation, and revision history.
|
||||
|
||||
import testing ;
|
||||
|
||||
{
|
||||
test-suite algorithm:
|
||||
# Search tests
|
||||
: [ run empty_search_test.cpp : : : : empty_search_test ]
|
||||
[ run search_test1.cpp : : : : search_test1 ]
|
||||
[ run search_test2.cpp : : : : search_test2 ]
|
||||
[ run search_test3.cpp : : : : search_test3 ]
|
||||
[ compile-fail search_fail1.cpp : : : : ]
|
||||
[ compile-fail search_fail2.cpp : : : : ]
|
||||
[ compile-fail search_fail3.cpp : : : : ]
|
||||
|
||||
# Clamp tests
|
||||
[ run clamp_test.cpp : : : : clamp_test ]
|
||||
|
||||
# Cxx11 tests
|
||||
[ run all_of_test.cpp : : : : all_of_test ]
|
||||
[ run any_of_test.cpp : : : : any_of_test ]
|
||||
[ run none_of_test.cpp : : : : none_of_test ]
|
||||
[ run one_of_test.cpp : : : : one_of_test ]
|
||||
|
||||
[ run ordered_test.cpp : : : : ordered_test ]
|
||||
[ run find_if_not_test1.cpp : : : : find_if_not_test1 ]
|
||||
[ run copy_n_test1.cpp : : : : copy_n_test1 ]
|
||||
[ run iota_test1.cpp : : : : iota_test1 ]
|
||||
|
||||
[ run is_permutation_test1.cpp : : : : is_permutation_test1 ]
|
||||
[ run partition_point_test1.cpp : : : : partition_point_test1 ]
|
||||
[ run is_partitioned_test1.cpp : : : : is_partitioned_test1 ]
|
||||
[ run partition_copy_test1.cpp : : : : partition_copy_test1 ]
|
||||
|
||||
;
|
||||
}
|
||||
|
@@ -1,86 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/all_of.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <functional>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
template<typename T>
|
||||
struct is_ : public std::unary_function<T, bool> {
|
||||
is_ ( T v ) : val_ ( v ) {}
|
||||
~is_ () {}
|
||||
bool operator () ( T comp ) const { return val_ == comp; }
|
||||
private:
|
||||
is_ (); // need a value
|
||||
|
||||
T val_;
|
||||
};
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
|
||||
void test_all ()
|
||||
{
|
||||
// Note: The literal values here are tested against directly, careful if you change them:
|
||||
int some_numbers[] = { 1, 1, 1, 18, 10 };
|
||||
std::vector<int> vi(some_numbers, some_numbers + 5);
|
||||
std::list<int> li(vi.begin(), vi.end ());
|
||||
|
||||
int some_letters[] = { 'a', 'q', 'n', 'y', 'n' };
|
||||
std::vector<char> vc(some_letters, some_letters + 5);
|
||||
|
||||
|
||||
BOOST_CHECK (!ba::all_of_equal ( vi, 1 ));
|
||||
BOOST_CHECK (!ba::all_of ( vi, is_<int> ( 1 )));
|
||||
BOOST_CHECK (!ba::all_of_equal ( vi.begin(), vi.end(), 1 ));
|
||||
BOOST_CHECK (!ba::all_of ( vi.begin(), vi.end(), is_<int> ( 1 )));
|
||||
|
||||
BOOST_CHECK (!ba::all_of_equal ( vi, 0 ));
|
||||
BOOST_CHECK (!ba::all_of ( vi, is_<int> ( 0 )));
|
||||
BOOST_CHECK (!ba::all_of_equal ( vi.begin(), vi.end(), 0 ));
|
||||
BOOST_CHECK (!ba::all_of ( vi.begin(), vi.end(), is_<int> ( 0 )));
|
||||
|
||||
BOOST_CHECK ( ba::all_of_equal ( vi.end(), vi.end(), 0 ));
|
||||
BOOST_CHECK ( ba::all_of ( vi.end(), vi.end(), is_<int> ( 0 )));
|
||||
|
||||
BOOST_CHECK ( ba::all_of_equal ( vi.begin(), vi.begin () + 3, 1 ));
|
||||
BOOST_CHECK ( ba::all_of ( vi.begin(), vi.begin () + 3, is_<int> ( 1 )));
|
||||
|
||||
BOOST_CHECK ( ba::all_of_equal ( vc.begin() + 1, vc.begin() + 2, 'q' ));
|
||||
BOOST_CHECK ( ba::all_of ( vc.begin() + 1, vc.begin() + 2, is_<char> ( 'q' )));
|
||||
|
||||
BOOST_CHECK (!ba::all_of_equal ( vc, '!' ));
|
||||
BOOST_CHECK (!ba::all_of ( vc, is_<char> ( '!' )));
|
||||
|
||||
BOOST_CHECK ( ba::all_of_equal ( vi.begin(), vi.begin(), 1 ));
|
||||
BOOST_CHECK ( ba::all_of_equal ( vc.begin(), vc.begin(), 'a' ));
|
||||
BOOST_CHECK ( ba::all_of ( vi.begin(), vi.begin(), is_<int> ( 1 )));
|
||||
BOOST_CHECK ( ba::all_of ( vc.begin(), vc.begin(), is_<char> ( 'a' )));
|
||||
|
||||
BOOST_CHECK (!ba::all_of_equal ( li, 1 ));
|
||||
BOOST_CHECK (!ba::all_of ( li, is_<int> ( 1 )));
|
||||
BOOST_CHECK (!ba::all_of_equal ( li.begin(), li.end(), 1 ));
|
||||
BOOST_CHECK (!ba::all_of ( li.begin(), li.end(), is_<int> ( 1 )));
|
||||
|
||||
std::list<int>::iterator l_iter = li.begin ();
|
||||
l_iter++; l_iter++; l_iter++;
|
||||
BOOST_CHECK ( ba::all_of_equal ( li.begin(), l_iter, 1 ));
|
||||
BOOST_CHECK ( ba::all_of ( li.begin(), l_iter, is_<int> ( 1 )));
|
||||
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_all ();
|
||||
return 0;
|
||||
}
|
@@ -1,105 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/any_of.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <functional>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
template<typename T>
|
||||
struct is_ : public std::unary_function<T, bool> {
|
||||
is_ ( T v ) : val_ ( v ) {}
|
||||
~is_ () {}
|
||||
bool operator () ( T comp ) const { return val_ == comp; }
|
||||
private:
|
||||
is_ (); // need a value
|
||||
|
||||
T val_;
|
||||
};
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
|
||||
void test_any ()
|
||||
{
|
||||
// Note: The literal values here are tested against directly, careful if you change them:
|
||||
int some_numbers[] = { 1, 5, 0, 18, 10 };
|
||||
std::vector<int> vi(some_numbers, some_numbers + 5);
|
||||
std::list<int> li(vi.begin(), vi.end ());
|
||||
|
||||
int some_letters[] = { 'a', 'q', 'n', 'y', 'n' };
|
||||
std::vector<char> vc(some_letters, some_letters + 5);
|
||||
|
||||
BOOST_CHECK ( ba::any_of_equal ( vi, 1 ));
|
||||
BOOST_CHECK ( ba::any_of ( vi, is_<int> ( 1 )));
|
||||
BOOST_CHECK ( ba::any_of_equal ( vi.begin(), vi.end(), 1 ));
|
||||
BOOST_CHECK ( ba::any_of ( vi.begin(), vi.end(), is_<int> ( 1 )));
|
||||
|
||||
BOOST_CHECK (!ba::any_of_equal ( vi, 9 ));
|
||||
BOOST_CHECK (!ba::any_of ( vi, is_<int> ( 9 )));
|
||||
BOOST_CHECK (!ba::any_of_equal ( vi.begin(), vi.end(), 9 ));
|
||||
BOOST_CHECK (!ba::any_of ( vi.begin(), vi.end(), is_<int> ( 9 )));
|
||||
|
||||
BOOST_CHECK ( ba::any_of_equal ( vi, 10 ));
|
||||
BOOST_CHECK ( ba::any_of ( vi, is_<int> ( 10 )));
|
||||
BOOST_CHECK (!ba::any_of_equal ( vi, 4 ));
|
||||
BOOST_CHECK (!ba::any_of ( vi, is_<int> ( 4 )));
|
||||
|
||||
BOOST_CHECK (!ba::any_of_equal ( vi.end(), vi.end(), 0 ));
|
||||
BOOST_CHECK (!ba::any_of ( vi.end(), vi.end(), is_<int> ( 0 )));
|
||||
|
||||
// 5 is not in { 0, 18, 10 }, but 10 is
|
||||
BOOST_CHECK ( ba::any_of_equal ( vi.begin() + 2, vi.end(), 10 ));
|
||||
BOOST_CHECK ( ba::any_of ( vi.begin() + 2, vi.end(), is_<int> ( 10 )));
|
||||
|
||||
BOOST_CHECK (!ba::any_of_equal ( vi.begin() + 2, vi.end(), 5 ));
|
||||
BOOST_CHECK (!ba::any_of ( vi.begin() + 2, vi.end(), is_<int> ( 5 )));
|
||||
|
||||
// 18 is not in { 1, 5, 0 }, but 5 is
|
||||
BOOST_CHECK ( ba::any_of_equal ( vi.begin(), vi.begin() + 3, 5 ));
|
||||
BOOST_CHECK ( ba::any_of ( vi.begin(), vi.begin() + 3, is_<int> ( 5 )));
|
||||
|
||||
BOOST_CHECK (!ba::any_of_equal ( vi.begin(), vi.begin() + 3, 18 ));
|
||||
BOOST_CHECK (!ba::any_of ( vi.begin(), vi.begin() + 3, is_<int> ( 18 )));
|
||||
|
||||
BOOST_CHECK ( ba::any_of_equal ( vc, 'q' ));
|
||||
BOOST_CHECK ( ba::any_of ( vc, is_<char> ( 'q' )));
|
||||
|
||||
BOOST_CHECK (!ba::any_of_equal ( vc, '!' ));
|
||||
BOOST_CHECK (!ba::any_of ( vc, is_<char> ( '!' )));
|
||||
|
||||
BOOST_CHECK ( ba::any_of_equal ( vc, 'n' ));
|
||||
BOOST_CHECK ( ba::any_of ( vc, is_<char> ( 'n' )));
|
||||
|
||||
BOOST_CHECK (!ba::any_of_equal ( vi.begin(), vi.begin(), 1 ));
|
||||
BOOST_CHECK (!ba::any_of_equal ( vc.begin(), vc.begin(), 'a' ));
|
||||
BOOST_CHECK (!ba::any_of ( vi.begin(), vi.begin(), is_<int> ( 1 )));
|
||||
BOOST_CHECK (!ba::any_of ( vc.begin(), vc.begin(), is_<char> ( 'a' )));
|
||||
|
||||
BOOST_CHECK ( ba::any_of_equal ( li, 1 ));
|
||||
BOOST_CHECK ( ba::any_of ( li, is_<int> ( 1 )));
|
||||
BOOST_CHECK ( ba::any_of_equal ( li.begin(), li.end(), 1 ));
|
||||
BOOST_CHECK ( ba::any_of ( li.begin(), li.end(), is_<int> ( 1 )));
|
||||
|
||||
std::list<int>::iterator l_iter = li.begin ();
|
||||
l_iter++; l_iter++; l_iter++;
|
||||
BOOST_CHECK ( ba::any_of_equal ( li.begin(), l_iter, 5 ));
|
||||
BOOST_CHECK ( ba::any_of ( li.begin(), l_iter, is_<int> ( 5 )));
|
||||
BOOST_CHECK (!ba::any_of_equal ( li.begin(), l_iter, 18 ));
|
||||
BOOST_CHECK (!ba::any_of ( li.begin(), l_iter, is_<int> ( 18 )));
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_any ();
|
||||
return 0;
|
||||
}
|
@@ -1,218 +0,0 @@
|
||||
// (C) Copyright Jesse Williamson 2009
|
||||
// Use, modification and distribution are subject to the
|
||||
// Boost Software License, Version 1.0. (See accompanying file
|
||||
// LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
#include <iostream>
|
||||
#include <vector>
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/clamp.hpp>
|
||||
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
|
||||
bool intGreater ( int lhs, int rhs ) { return lhs > rhs; }
|
||||
bool doubleGreater ( double lhs, double rhs ) { return lhs > rhs; }
|
||||
|
||||
class custom {
|
||||
public:
|
||||
custom ( int x ) : v(x) {}
|
||||
custom ( const custom &rhs ) : v(rhs.v) {}
|
||||
~custom () {}
|
||||
custom & operator = ( const custom &rhs ) { v = rhs.v; return *this; }
|
||||
|
||||
bool operator < ( const custom &rhs ) const { return v < rhs.v; }
|
||||
bool operator == ( const custom &rhs ) const { return v == rhs.v; } // need this for the test
|
||||
|
||||
std::ostream & print ( std::ostream &os ) const { return os << v; }
|
||||
|
||||
int v;
|
||||
};
|
||||
|
||||
std::ostream & operator << ( std::ostream & os, const custom &x ) { return x.print ( os ); }
|
||||
|
||||
bool customLess ( const custom &lhs, const custom &rhs ) { return lhs.v < rhs.v; }
|
||||
|
||||
void test_ints()
|
||||
{
|
||||
|
||||
// Inside the range, equal to the endpoints, and outside the endpoints.
|
||||
BOOST_CHECK_EQUAL ( 3, ba::clamp ( 3, 1, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 1, ba::clamp ( 1, 1, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 1, ba::clamp ( 0, 1, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 10, ba::clamp ( 10, 1, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 10, ba::clamp ( 11, 1, 10 ));
|
||||
|
||||
BOOST_CHECK_EQUAL ( 3, ba::clamp ( 3, 10, 1, intGreater ));
|
||||
BOOST_CHECK_EQUAL ( 1, ba::clamp ( 1, 10, 1, intGreater ));
|
||||
BOOST_CHECK_EQUAL ( 1, ba::clamp ( 0, 10, 1, intGreater ));
|
||||
BOOST_CHECK_EQUAL ( 10, ba::clamp ( 10, 10, 1, intGreater ));
|
||||
BOOST_CHECK_EQUAL ( 10, ba::clamp ( 11, 10, 1, intGreater ));
|
||||
|
||||
// Negative numbers
|
||||
BOOST_CHECK_EQUAL ( -3, ba::clamp ( -3, -10, -1 ));
|
||||
BOOST_CHECK_EQUAL ( -1, ba::clamp ( -1, -10, -1 ));
|
||||
BOOST_CHECK_EQUAL ( -1, ba::clamp ( 0, -10, -1 ));
|
||||
BOOST_CHECK_EQUAL ( -10, ba::clamp ( -10, -10, -1 ));
|
||||
BOOST_CHECK_EQUAL ( -10, ba::clamp ( -11, -10, -1 ));
|
||||
|
||||
// Mixed positive and negative numbers
|
||||
BOOST_CHECK_EQUAL ( 5, ba::clamp ( 5, -10, 10 ));
|
||||
BOOST_CHECK_EQUAL ( -10, ba::clamp ( -10, -10, 10 ));
|
||||
BOOST_CHECK_EQUAL ( -10, ba::clamp ( -15, -10, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 10, ba::clamp ( 10, -10, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 10, ba::clamp ( 15, -10, 10 ));
|
||||
|
||||
// Unsigned
|
||||
BOOST_CHECK_EQUAL ( 5U, ba::clamp ( 5U, 1U, 10U ));
|
||||
BOOST_CHECK_EQUAL ( 1U, ba::clamp ( 1U, 1U, 10U ));
|
||||
BOOST_CHECK_EQUAL ( 1U, ba::clamp ( 0U, 1U, 10U ));
|
||||
BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 10U, 1U, 10U ));
|
||||
BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 15U, 1U, 10U ));
|
||||
|
||||
// Mixed (1)
|
||||
BOOST_CHECK_EQUAL ( 5U, ba::clamp ( 5U, 1, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 1U, ba::clamp ( 1U, 1, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 1U, ba::clamp ( 0U, 1, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 10U, 1, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 15U, 1, 10 ));
|
||||
|
||||
// Mixed (3)
|
||||
BOOST_CHECK_EQUAL ( 5U, ba::clamp ( 5U, 1, 10. ));
|
||||
BOOST_CHECK_EQUAL ( 1U, ba::clamp ( 1U, 1, 10. ));
|
||||
BOOST_CHECK_EQUAL ( 1U, ba::clamp ( 0U, 1, 10. ));
|
||||
BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 10U, 1, 10. ));
|
||||
BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 15U, 1, 10. ));
|
||||
|
||||
short foo = 50;
|
||||
BOOST_CHECK_EQUAL ( 56, ba::clamp ( foo, 56.9, 129 ));
|
||||
BOOST_CHECK_EQUAL ( 24910, ba::clamp ( foo, 12345678, 123456999 ));
|
||||
}
|
||||
|
||||
|
||||
void test_floats()
|
||||
{
|
||||
|
||||
// Inside the range, equal to the endpoints, and outside the endpoints.
|
||||
BOOST_CHECK_EQUAL ( 3.0, ba::clamp ( 3.0, 1.0, 10.0 ));
|
||||
BOOST_CHECK_EQUAL ( 1.0, ba::clamp ( 1.0, 1.0, 10.0 ));
|
||||
BOOST_CHECK_EQUAL ( 1.0, ba::clamp ( 0.0, 1.0, 10.0 ));
|
||||
BOOST_CHECK_EQUAL ( 10.0, ba::clamp ( 10.0, 1.0, 10.0 ));
|
||||
BOOST_CHECK_EQUAL ( 10.0, ba::clamp ( 11.0, 1.0, 10.0 ));
|
||||
|
||||
BOOST_CHECK_EQUAL ( 3.0, ba::clamp ( 3.0, 10.0, 1.0, doubleGreater ));
|
||||
BOOST_CHECK_EQUAL ( 1.0, ba::clamp ( 1.0, 10.0, 1.0, doubleGreater ));
|
||||
BOOST_CHECK_EQUAL ( 1.0, ba::clamp ( 0.0, 10.0, 1.0, doubleGreater ));
|
||||
BOOST_CHECK_EQUAL ( 10.0, ba::clamp ( 10.0, 10.0, 1.0, doubleGreater ));
|
||||
BOOST_CHECK_EQUAL ( 10.0, ba::clamp ( 11.0, 10.0, 1.0, doubleGreater ));
|
||||
|
||||
// Negative numbers
|
||||
BOOST_CHECK_EQUAL ( -3.f, ba::clamp ( -3.f, -10.f, -1.f ));
|
||||
BOOST_CHECK_EQUAL ( -1.f, ba::clamp ( -1.f, -10.f, -1.f ));
|
||||
BOOST_CHECK_EQUAL ( -1.f, ba::clamp ( 0.f, -10.f, -1.f ));
|
||||
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -10.f, -10.f, -1.f ));
|
||||
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -11.f, -10.f, -1.f ));
|
||||
|
||||
// Mixed positive and negative numbers
|
||||
BOOST_CHECK_EQUAL ( 5.f, ba::clamp ( 5.f, -10.f, 10.f ));
|
||||
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -10.f, -10.f, 10.f ));
|
||||
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -15.f, -10.f, 10.f ));
|
||||
BOOST_CHECK_EQUAL ( 10.f, ba::clamp ( 10.f, -10.f, 10.f ));
|
||||
BOOST_CHECK_EQUAL ( 10.f, ba::clamp ( 15.f, -10.f, 10.f ));
|
||||
|
||||
// Mixed (1)
|
||||
BOOST_CHECK_EQUAL ( 5.f, ba::clamp ( 5.f, -10., 10. ));
|
||||
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -10.f, -10., 10. ));
|
||||
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -15.f, -10., 10. ));
|
||||
BOOST_CHECK_EQUAL ( 10.f, ba::clamp ( 10.f, -10., 10. ));
|
||||
BOOST_CHECK_EQUAL ( 10.f, ba::clamp ( 15.f, -10., 10. ));
|
||||
|
||||
// Mixed (2)
|
||||
BOOST_CHECK_EQUAL ( 5.f, ba::clamp ( 5.f, -10, 10 ));
|
||||
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -10.f, -10, 10 ));
|
||||
BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -15.f, -10, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 10.f, ba::clamp ( 10.f, -10, 10 ));
|
||||
BOOST_CHECK_EQUAL ( 10.f, ba::clamp ( 15.f, -10, 10 ));
|
||||
}
|
||||
|
||||
void test_custom()
|
||||
{
|
||||
|
||||
// Inside the range, equal to the endpoints, and outside the endpoints.
|
||||
BOOST_CHECK_EQUAL ( custom( 3), ba::clamp ( custom( 3), custom(1), custom(10)));
|
||||
BOOST_CHECK_EQUAL ( custom( 1), ba::clamp ( custom( 1), custom(1), custom(10)));
|
||||
BOOST_CHECK_EQUAL ( custom( 1), ba::clamp ( custom( 0), custom(1), custom(10)));
|
||||
BOOST_CHECK_EQUAL ( custom(10), ba::clamp ( custom(10), custom(1), custom(10)));
|
||||
BOOST_CHECK_EQUAL ( custom(10), ba::clamp ( custom(11), custom(1), custom(10)));
|
||||
|
||||
BOOST_CHECK_EQUAL ( custom( 3), ba::clamp ( custom( 3), custom(1), custom(10), customLess ));
|
||||
BOOST_CHECK_EQUAL ( custom( 1), ba::clamp ( custom( 1), custom(1), custom(10), customLess ));
|
||||
BOOST_CHECK_EQUAL ( custom( 1), ba::clamp ( custom( 0), custom(1), custom(10), customLess ));
|
||||
BOOST_CHECK_EQUAL ( custom(10), ba::clamp ( custom(10), custom(1), custom(10), customLess ));
|
||||
BOOST_CHECK_EQUAL ( custom(10), ba::clamp ( custom(11), custom(1), custom(10), customLess ));
|
||||
|
||||
// Fail!!
|
||||
// BOOST_CHECK_EQUAL ( custom(1), ba::clamp ( custom(11), custom(1), custom(10)));
|
||||
}
|
||||
|
||||
#define elementsof(v) (sizeof (v) / sizeof (v[0]))
|
||||
#define a_begin(v) (&v[0])
|
||||
#define a_end(v) (v + elementsof (v))
|
||||
#define a_range(v) v
|
||||
#define b_e(v) a_begin(v),a_end(v)
|
||||
|
||||
void test_int_range ()
|
||||
{
|
||||
int inputs [] = { 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 19, 99, 999, -1, -3, -99, 234234 };
|
||||
int outputs [] = { 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10, 10, -1, -1, -1, 10 };
|
||||
std::vector<int> results;
|
||||
std::vector<int> in_v;
|
||||
|
||||
std::copy ( a_begin(inputs), a_end(inputs), std::back_inserter ( in_v ));
|
||||
|
||||
ba::clamp_range ( a_begin(inputs), a_end(inputs), std::back_inserter ( results ), -1, 10 );
|
||||
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
|
||||
results.clear ();
|
||||
ba::clamp_range ( in_v.begin (), in_v.end (), std::back_inserter ( results ), -1, 10 );
|
||||
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
|
||||
results.clear ();
|
||||
|
||||
ba::clamp_range ( a_begin(inputs), a_end(inputs), std::back_inserter ( results ), 10, -1, intGreater );
|
||||
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
|
||||
results.clear ();
|
||||
ba::clamp_range ( in_v.begin (), in_v.end (), std::back_inserter ( results ), 10, -1, intGreater );
|
||||
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
|
||||
results.clear ();
|
||||
|
||||
ba::clamp_range ( a_range(inputs), std::back_inserter ( results ), -1, 10 );
|
||||
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
|
||||
results.clear ();
|
||||
ba::clamp_range ( in_v, std::back_inserter ( results ), -1, 10 );
|
||||
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
|
||||
results.clear ();
|
||||
|
||||
ba::clamp_range ( a_range(inputs), std::back_inserter ( results ), 10, -1, intGreater );
|
||||
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
|
||||
results.clear ();
|
||||
ba::clamp_range ( in_v, std::back_inserter ( results ), 10, -1, intGreater );
|
||||
BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
|
||||
results.clear ();
|
||||
|
||||
int junk[elementsof(inputs)];
|
||||
ba::clamp_range ( inputs, junk, 10, -1, intGreater );
|
||||
BOOST_CHECK ( std::equal ( b_e(junk), outputs ));
|
||||
}
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_ints ();
|
||||
test_floats ();
|
||||
test_custom ();
|
||||
|
||||
test_int_range ();
|
||||
// test_float_range ();
|
||||
// test_custom_range ();
|
||||
return 0;
|
||||
}
|
@@ -1,85 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/copy_n.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <string>
|
||||
#include <iostream>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
// namespace ba = boost;
|
||||
|
||||
template <typename Container>
|
||||
void test_sequence ( Container const &c ) {
|
||||
|
||||
typedef typename Container::value_type value_type;
|
||||
std::vector<value_type> v;
|
||||
|
||||
// Copy zero elements
|
||||
v.clear ();
|
||||
ba::copy_n ( c.begin (), 0, back_inserter ( v ));
|
||||
BOOST_CHECK ( v.size () == 0 );
|
||||
ba::copy_n ( c.begin (), 0U, back_inserter ( v ));
|
||||
BOOST_CHECK ( v.size () == 0 );
|
||||
|
||||
if ( c.size () > 0 ) {
|
||||
// Just one element
|
||||
v.clear ();
|
||||
ba::copy_n ( c.begin (), 1, back_inserter ( v ));
|
||||
BOOST_CHECK ( v.size () == 1 );
|
||||
BOOST_CHECK ( v[0] == *c.begin ());
|
||||
|
||||
v.clear ();
|
||||
ba::copy_n ( c.begin (), 1U, back_inserter ( v ));
|
||||
BOOST_CHECK ( v.size () == 1 );
|
||||
BOOST_CHECK ( v[0] == *c.begin ());
|
||||
|
||||
// Half the elements
|
||||
v.clear ();
|
||||
ba::copy_n ( c.begin (), c.size () / 2, back_inserter ( v ));
|
||||
BOOST_CHECK ( v.size () == c.size () / 2);
|
||||
BOOST_CHECK ( std::equal ( v.begin (), v.end (), c.begin ()));
|
||||
|
||||
// Half the elements + 1
|
||||
v.clear ();
|
||||
ba::copy_n ( c.begin (), c.size () / 2 + 1, back_inserter ( v ));
|
||||
BOOST_CHECK ( v.size () == c.size () / 2 + 1 );
|
||||
BOOST_CHECK ( std::equal ( v.begin (), v.end (), c.begin ()));
|
||||
|
||||
// All the elements
|
||||
v.clear ();
|
||||
ba::copy_n ( c.begin (), c.size (), back_inserter ( v ));
|
||||
BOOST_CHECK ( v.size () == c.size ());
|
||||
BOOST_CHECK ( std::equal ( v.begin (), v.end (), c.begin ()));
|
||||
}
|
||||
}
|
||||
|
||||
|
||||
void test_sequence1 () {
|
||||
std::vector<int> v;
|
||||
for ( int i = 5; i < 15; ++i )
|
||||
v.push_back ( i );
|
||||
test_sequence ( v );
|
||||
|
||||
std::list<int> l;
|
||||
for ( int i = 25; i > 15; --i )
|
||||
l.push_back ( i );
|
||||
test_sequence ( l );
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_sequence1 ();
|
||||
return 0;
|
||||
}
|
@@ -1,83 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <string>
|
||||
|
||||
#include <boost/algorithm/searching/boyer_moore.hpp>
|
||||
#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
|
||||
#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
|
||||
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
int test_main( int argc, char *argv [] )
|
||||
{
|
||||
const std::string cs;
|
||||
std::string estr;
|
||||
std::string str ( "abc" );
|
||||
|
||||
// empty corpus, empty pattern
|
||||
BOOST_CHECK (
|
||||
boost::algorithm::boyer_moore_search (
|
||||
cs.begin (), cs.end (), estr.begin (), estr.end ())
|
||||
== cs.begin ()
|
||||
);
|
||||
|
||||
BOOST_CHECK (
|
||||
boost::algorithm::boyer_moore_horspool_search (
|
||||
cs.begin (), cs.end (), estr.begin (), estr.end ())
|
||||
== cs.begin ()
|
||||
);
|
||||
|
||||
BOOST_CHECK (
|
||||
boost::algorithm::knuth_morris_pratt_search (
|
||||
cs.begin (), cs.end (), estr.begin (), estr.end ())
|
||||
== cs.begin ()
|
||||
);
|
||||
|
||||
// empty corpus, non-empty pattern
|
||||
BOOST_CHECK (
|
||||
boost::algorithm::boyer_moore_search (
|
||||
estr.begin (), estr.end (), str.begin (), str.end ())
|
||||
== estr.end ()
|
||||
);
|
||||
|
||||
BOOST_CHECK (
|
||||
boost::algorithm::boyer_moore_horspool_search (
|
||||
estr.begin (), estr.end (), str.begin (), str.end ())
|
||||
== estr.end ()
|
||||
);
|
||||
|
||||
BOOST_CHECK (
|
||||
boost::algorithm::knuth_morris_pratt_search (
|
||||
estr.begin (), estr.end (), str.begin (), str.end ())
|
||||
== estr.end ()
|
||||
);
|
||||
|
||||
// non-empty corpus, empty pattern
|
||||
BOOST_CHECK (
|
||||
boost::algorithm::boyer_moore_search (
|
||||
str.begin (), str.end (), estr.begin (), estr.end ())
|
||||
== str.begin ()
|
||||
);
|
||||
|
||||
BOOST_CHECK (
|
||||
boost::algorithm::boyer_moore_horspool_search (
|
||||
str.begin (), str.end (), estr.begin (), estr.end ())
|
||||
== str.begin ()
|
||||
);
|
||||
|
||||
BOOST_CHECK (
|
||||
boost::algorithm::knuth_morris_pratt_search (
|
||||
str.begin (), str.end (), estr.begin (), estr.end ())
|
||||
== str.begin ()
|
||||
);
|
||||
|
||||
(void) argv; (void) argc;
|
||||
return 0;
|
||||
}
|
@@ -1,90 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <iostream>
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/find_if_not.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <string>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
// namespace ba = boost;
|
||||
|
||||
template <typename Container>
|
||||
typename Container::iterator offset_to_iter ( Container &v, int offset ) {
|
||||
typename Container::iterator retval;
|
||||
|
||||
if ( offset >= 0 ) {
|
||||
retval = v.begin ();
|
||||
std::advance ( retval, offset );
|
||||
}
|
||||
else {
|
||||
retval = v.end ();
|
||||
std::advance ( retval, offset + 1 );
|
||||
}
|
||||
return retval;
|
||||
}
|
||||
|
||||
template <typename Container, typename Predicate>
|
||||
void test_sequence ( Container &v, Predicate comp, int expected ) {
|
||||
typename Container::iterator res, exp;
|
||||
|
||||
res = ba::find_if_not ( v.begin (), v.end (), comp );
|
||||
exp = offset_to_iter ( v, expected );
|
||||
std::cout << "Expected(1): " << std::distance ( v.begin (), exp )
|
||||
<< ", got: " << std::distance ( v.begin (), res ) << std::endl;
|
||||
BOOST_CHECK ( exp == res );
|
||||
}
|
||||
|
||||
template <typename T>
|
||||
struct less_than {
|
||||
public:
|
||||
less_than ( T foo ) : val ( foo ) {}
|
||||
less_than ( const less_than &rhs ) : val ( rhs.val ) {}
|
||||
|
||||
bool operator () ( const T &v ) const { return v < val; }
|
||||
private:
|
||||
less_than ();
|
||||
less_than operator = ( const less_than &rhs );
|
||||
T val;
|
||||
};
|
||||
|
||||
|
||||
void test_sequence1 () {
|
||||
std::vector<int> v;
|
||||
|
||||
v.clear ();
|
||||
for ( int i = 5; i < 15; ++i )
|
||||
v.push_back ( i );
|
||||
test_sequence ( v, less_than<int>(3), 0 ); // no elements
|
||||
test_sequence ( v, less_than<int>(6), 1 ); // only the first element
|
||||
test_sequence ( v, less_than<int>(10), 5 );
|
||||
test_sequence ( v, less_than<int>(99), -1 ); // all elements satisfy
|
||||
|
||||
// With bidirectional iterators.
|
||||
std::list<int> l;
|
||||
for ( int i = 5; i < 15; ++i )
|
||||
l.push_back ( i );
|
||||
test_sequence ( l, less_than<int>(3), 0 ); // no elements
|
||||
test_sequence ( l, less_than<int>(6), 1 ); // only the first element
|
||||
test_sequence ( l, less_than<int>(10), 5 );
|
||||
test_sequence ( l, less_than<int>(99), -1 ); // all elements satisfy
|
||||
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_sequence1 ();
|
||||
return 0;
|
||||
}
|
@@ -1,79 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/iota.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <iostream>
|
||||
#include <string>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
// Test to make sure a sequence is "correctly formed"; i.e, ascending by one
|
||||
template <typename Iterator, typename T>
|
||||
bool test_iota_results ( Iterator first, Iterator last, T initial_value ) {
|
||||
if ( first == last ) return true;
|
||||
if ( initial_value != *first ) return false;
|
||||
Iterator prev = first;
|
||||
while ( ++first != last ) {
|
||||
if (( *first - *prev ) != 1 )
|
||||
return false;
|
||||
prev = first;
|
||||
}
|
||||
return true;
|
||||
}
|
||||
|
||||
template <typename Range, typename T>
|
||||
bool test_iota_results ( const Range &r, T initial_value ) {
|
||||
return test_iota_results (boost::begin (r), boost::end (r), initial_value );
|
||||
}
|
||||
|
||||
|
||||
void test_ints () {
|
||||
std::vector<int> v;
|
||||
std::list<int> l;
|
||||
|
||||
v.clear (); v.reserve ( 10 );
|
||||
boost::algorithm::iota ( v.begin (), v.end (), 23 );
|
||||
BOOST_CHECK ( test_iota_results ( v.begin (), v.end (), 23 ));
|
||||
|
||||
v.clear (); v.reserve ( 19 );
|
||||
boost::algorithm::iota ( v, 18 );
|
||||
BOOST_CHECK ( test_iota_results ( v, 18 ));
|
||||
|
||||
v.clear ();
|
||||
boost::algorithm::iota_n ( std::back_inserter(v), 99, 20 );
|
||||
BOOST_CHECK ( test_iota_results ( v, 99 ));
|
||||
|
||||
/*
|
||||
l.clear (); l.reserve ( 5 );
|
||||
boost::algorithm::iota ( l.begin (), l.end (), 123 );
|
||||
BOOST_CHECK ( test_iota_results ( l.begin (), l.end (), 123 ));
|
||||
|
||||
l.clear (); l.reserve ( 9 );
|
||||
boost::algorithm::iota ( l.begin (), l.end (), 87 );
|
||||
BOOST_CHECK ( test_iota_results ( l.begin (), l.end (), 87 ));
|
||||
*/
|
||||
|
||||
l.clear ();
|
||||
boost::algorithm::iota_n ( std::back_inserter(l), 99, 20 );
|
||||
BOOST_CHECK ( test_iota_results ( l, 99 ));
|
||||
|
||||
l.clear ();
|
||||
boost::algorithm::iota_n ( std::front_inserter(l), 123, 20 );
|
||||
BOOST_CHECK ( test_iota_results ( l.rbegin (), l.rend (), 123 ));
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_ints ();
|
||||
return 0;
|
||||
}
|
@@ -1,63 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <iostream>
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/is_partitioned.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <string>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
// namespace ba = boost;
|
||||
|
||||
template <typename T>
|
||||
struct less_than {
|
||||
public:
|
||||
less_than ( T foo ) : val ( foo ) {}
|
||||
less_than ( const less_than &rhs ) : val ( rhs.val ) {}
|
||||
|
||||
bool operator () ( const T &v ) const { return v < val; }
|
||||
private:
|
||||
less_than ();
|
||||
less_than operator = ( const less_than &rhs );
|
||||
T val;
|
||||
};
|
||||
|
||||
|
||||
void test_sequence1 () {
|
||||
std::vector<int> v;
|
||||
|
||||
v.clear ();
|
||||
for ( int i = 5; i < 15; ++i )
|
||||
v.push_back ( i );
|
||||
BOOST_CHECK ( ba::is_partitioned ( v, less_than<int>(3))); // no elements
|
||||
BOOST_CHECK ( ba::is_partitioned ( v, less_than<int>(6))); // only the first element
|
||||
BOOST_CHECK ( ba::is_partitioned ( v, less_than<int>(10))); // in the middle somewhere
|
||||
BOOST_CHECK ( ba::is_partitioned ( v, less_than<int>(99))); // all elements satisfy
|
||||
|
||||
// With bidirectional iterators.
|
||||
std::list<int> l;
|
||||
for ( int i = 5; i < 15; ++i )
|
||||
l.push_back ( i );
|
||||
BOOST_CHECK ( ba::is_partitioned ( l.begin (), l.end (), less_than<int>(3))); // no elements
|
||||
BOOST_CHECK ( ba::is_partitioned ( l.begin (), l.end (), less_than<int>(6))); // only the first element
|
||||
BOOST_CHECK ( ba::is_partitioned ( l.begin (), l.end (), less_than<int>(10))); // in the middle somewhere
|
||||
BOOST_CHECK ( ba::is_partitioned ( l.begin (), l.end (), less_than<int>(99))); // all elements satisfy
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_sequence1 ();
|
||||
return 0;
|
||||
}
|
@@ -1,49 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <iostream>
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/is_permutation.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <string>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
// namespace ba = boost;
|
||||
|
||||
void test_sequence1 () {
|
||||
std::vector<int> v, v1;
|
||||
|
||||
v.clear ();
|
||||
for ( std::size_t i = 5; i < 15; ++i )
|
||||
v.push_back ( i );
|
||||
v1 = v;
|
||||
BOOST_CHECK ( ba::is_permutation ( v.begin (), v.end (), v.begin ())); // better be a permutation of itself!
|
||||
BOOST_CHECK ( ba::is_permutation ( v.begin (), v.end (), v1.begin ()));
|
||||
|
||||
// With bidirectional iterators.
|
||||
std::list<int> l;
|
||||
std::copy ( v.begin (), v.end (), std::back_inserter ( l ));
|
||||
BOOST_CHECK ( ba::is_permutation ( l.begin (), l.end (), l.begin ())); // better be a permutation of itself!
|
||||
BOOST_CHECK ( ba::is_permutation ( l.begin (), l.end (), v1.begin ()));
|
||||
for ( std::size_t i = 0; i < l.size (); ++i ) {
|
||||
l.push_back ( *l.begin ()); l.pop_front (); // rotation
|
||||
BOOST_CHECK ( ba::is_permutation ( l.begin (), l.end (), v1.begin ()));
|
||||
}
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_sequence1 ();
|
||||
return 0;
|
||||
}
|
@@ -1,96 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/none_of.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <functional>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
template<typename T>
|
||||
struct is_ : public std::unary_function<T, bool> {
|
||||
is_ ( T v ) : val_ ( v ) {}
|
||||
~is_ () {}
|
||||
bool operator () ( T comp ) const { return val_ == comp; }
|
||||
private:
|
||||
is_ (); // need a value
|
||||
|
||||
T val_;
|
||||
};
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
|
||||
void test_none()
|
||||
{
|
||||
// Note: The literal values here are tested against directly, careful if you change them:
|
||||
int some_numbers[] = { 1, 5, 0, 18, 1 };
|
||||
std::vector<int> vi(some_numbers, some_numbers + 5);
|
||||
std::list<int> li(vi.begin(), vi.end ());
|
||||
|
||||
int some_letters[] = { 'a', 'q', 'n', 'y', 'n' };
|
||||
std::vector<char> vc(some_letters, some_letters + 5);
|
||||
|
||||
BOOST_CHECK ( ba::none_of_equal ( vi, 100 ));
|
||||
BOOST_CHECK ( ba::none_of ( vi, is_<int> ( 100 )));
|
||||
BOOST_CHECK ( ba::none_of_equal ( vi.begin(), vi.end(), 100 ));
|
||||
BOOST_CHECK ( ba::none_of ( vi.begin(), vi.end(), is_<int> ( 100 )));
|
||||
|
||||
BOOST_CHECK (!ba::none_of_equal ( vi, 1 ));
|
||||
BOOST_CHECK (!ba::none_of ( vi, is_<int> ( 1 )));
|
||||
BOOST_CHECK (!ba::none_of_equal ( vi.begin(), vi.end(), 1 ));
|
||||
BOOST_CHECK (!ba::none_of ( vi.begin(), vi.end(), is_<int> ( 1 )));
|
||||
|
||||
BOOST_CHECK ( ba::none_of_equal ( vi.end(), vi.end(), 0 ));
|
||||
BOOST_CHECK ( ba::none_of ( vi.end(), vi.end(), is_<int> ( 0 )));
|
||||
|
||||
// 5 is not in { 0, 18, 1 }, but 1 is
|
||||
BOOST_CHECK ( ba::none_of_equal ( vi.begin() + 2, vi.end(), 5 ));
|
||||
BOOST_CHECK ( ba::none_of ( vi.begin() + 2, vi.end(), is_<int> ( 5 )));
|
||||
BOOST_CHECK (!ba::none_of_equal ( vi.begin() + 2, vi.end(), 1 ));
|
||||
BOOST_CHECK (!ba::none_of ( vi.begin() + 2, vi.end(), is_<int> ( 1 )));
|
||||
|
||||
// 18 is not in { 1, 5, 0 }, but 5 is
|
||||
BOOST_CHECK ( ba::none_of_equal ( vi.begin(), vi.begin() + 3, 18 ));
|
||||
BOOST_CHECK ( ba::none_of ( vi.begin(), vi.begin() + 3, is_<int> ( 18 )));
|
||||
BOOST_CHECK (!ba::none_of_equal ( vi.begin(), vi.begin() + 3, 5 ));
|
||||
BOOST_CHECK (!ba::none_of ( vi.begin(), vi.begin() + 3, is_<int> ( 5 )));
|
||||
|
||||
BOOST_CHECK ( ba::none_of_equal ( vc, 'z' ));
|
||||
BOOST_CHECK ( ba::none_of ( vc, is_<char> ( 'z' )));
|
||||
|
||||
BOOST_CHECK (!ba::none_of_equal ( vc, 'a' ));
|
||||
BOOST_CHECK (!ba::none_of ( vc, is_<char> ( 'a' )));
|
||||
|
||||
BOOST_CHECK (!ba::none_of_equal ( vc, 'n' ));
|
||||
BOOST_CHECK (!ba::none_of ( vc, is_<char> ( 'n' )));
|
||||
|
||||
BOOST_CHECK ( ba::none_of_equal ( vi.begin(), vi.begin(), 1 ));
|
||||
BOOST_CHECK ( ba::none_of_equal ( vc.begin(), vc.begin(), 'a' ));
|
||||
BOOST_CHECK ( ba::none_of ( vi.begin(), vi.begin(), is_<int> ( 1 )));
|
||||
BOOST_CHECK ( ba::none_of ( vc.begin(), vc.begin(), is_<char> ( 'a' )));
|
||||
|
||||
BOOST_CHECK ( ba::none_of_equal ( li, 100 ));
|
||||
BOOST_CHECK ( ba::none_of ( li, is_<int> ( 100 )));
|
||||
BOOST_CHECK ( ba::none_of_equal ( li.begin(), li.end(), 100 ));
|
||||
BOOST_CHECK ( ba::none_of ( li.begin(), li.end(), is_<int> ( 100 )));
|
||||
|
||||
std::list<int>::iterator l_iter = li.begin ();
|
||||
l_iter++; l_iter++; l_iter++;
|
||||
BOOST_CHECK ( ba::none_of_equal ( li.begin(), l_iter, 18 ));
|
||||
BOOST_CHECK ( ba::none_of ( li.begin(), l_iter, is_<int> ( 18 )));
|
||||
BOOST_CHECK (!ba::none_of ( li.begin(), l_iter, is_<int> ( 5 )));
|
||||
}
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_none();
|
||||
return 0;
|
||||
}
|
@@ -1,101 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2008-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/one_of.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <functional>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
template<typename T>
|
||||
struct is_ : public std::unary_function<T, bool> {
|
||||
is_ ( T v ) : val_ ( v ) {}
|
||||
~is_ () {}
|
||||
bool operator () ( T comp ) const { return val_ == comp; }
|
||||
private:
|
||||
is_ (); // need a value
|
||||
|
||||
T val_;
|
||||
};
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
|
||||
void test_one ()
|
||||
{
|
||||
// Note: The literal values here are tested against directly, careful if you change them:
|
||||
int some_numbers[] = { 1, 1, 2, 3, 5 };
|
||||
std::vector<int> vi(some_numbers, some_numbers + 5);
|
||||
std::list<int> li(vi.begin(), vi.end ());
|
||||
|
||||
int some_letters[] = { 'a', 'q', 'n', 'y', 'n' };
|
||||
std::vector<char> vc(some_letters, some_letters + 5);
|
||||
|
||||
BOOST_CHECK (!ba::one_of_equal ( vi, 1 ));
|
||||
BOOST_CHECK (!ba::one_of ( vi, is_<int> ( 1 )));
|
||||
BOOST_CHECK (!ba::one_of_equal ( vi.begin(), vi.end(), 1 ));
|
||||
BOOST_CHECK (!ba::one_of ( vi.begin(), vi.end(), is_<int> ( 1 )));
|
||||
|
||||
BOOST_CHECK (!ba::one_of_equal ( vi, 0 ));
|
||||
BOOST_CHECK (!ba::one_of ( vi, is_<int> ( 0 )));
|
||||
BOOST_CHECK (!ba::one_of_equal ( vi.begin(), vi.end(), 0 ));
|
||||
BOOST_CHECK (!ba::one_of ( vi.begin(), vi.end(), is_<int> ( 0 )));
|
||||
|
||||
BOOST_CHECK ( ba::one_of_equal ( vi, 2 ));
|
||||
BOOST_CHECK ( ba::one_of ( vi, is_<int> ( 2 )));
|
||||
BOOST_CHECK ( ba::one_of_equal ( vi.begin(), vi.end(), 2 ));
|
||||
BOOST_CHECK ( ba::one_of ( vi.begin(), vi.end(), is_<int> ( 2 )));
|
||||
|
||||
// Check for a match at the end
|
||||
BOOST_CHECK ( ba::one_of_equal ( vi, 5 ));
|
||||
BOOST_CHECK ( ba::one_of ( vi, is_<int> ( 5 )));
|
||||
BOOST_CHECK ( ba::one_of_equal ( vi.begin(), vi.end(), 5 ));
|
||||
BOOST_CHECK ( ba::one_of ( vi.begin(), vi.end(), is_<int> ( 5 )));
|
||||
|
||||
BOOST_CHECK ( ba::one_of_equal ( vi.begin() + 1, vi.end(), 1 ));
|
||||
BOOST_CHECK ( ba::one_of ( vi.begin() + 1, vi.end(), is_<int> ( 1 )));
|
||||
|
||||
BOOST_CHECK ( ba::one_of_equal ( vc.begin() + 1, vc.begin() + 2, 'q' ));
|
||||
BOOST_CHECK ( ba::one_of ( vc.begin() + 1, vc.begin() + 2, is_<char> ( 'q' )));
|
||||
|
||||
BOOST_CHECK (!ba::one_of_equal ( vc, '!' ));
|
||||
BOOST_CHECK (!ba::one_of ( vc, is_<char> ( '!' )));
|
||||
|
||||
BOOST_CHECK (!ba::one_of_equal ( vc, 'n' ));
|
||||
BOOST_CHECK (!ba::one_of ( vc, is_<char> ( 'n' )));
|
||||
|
||||
// Empty range check
|
||||
BOOST_CHECK (!ba::one_of_equal ( vi.begin(), vi.begin(), 1 ));
|
||||
BOOST_CHECK (!ba::one_of_equal ( vc.begin(), vc.begin(), 'a' ));
|
||||
BOOST_CHECK (!ba::one_of ( vi.begin(), vi.begin(), is_<int> ( 1 )));
|
||||
BOOST_CHECK (!ba::one_of ( vc.begin(), vc.begin(), is_<char> ( 'a' )));
|
||||
|
||||
BOOST_CHECK (!ba::one_of_equal ( li, 1 ));
|
||||
BOOST_CHECK (!ba::one_of ( li, is_<int> ( 1 )));
|
||||
BOOST_CHECK (!ba::one_of_equal ( li.begin(), li.end(), 1 ));
|
||||
BOOST_CHECK (!ba::one_of ( li.begin(), li.end(), is_<int> ( 1 )));
|
||||
|
||||
std::list<int>::iterator l_iter = li.begin ();
|
||||
l_iter++; l_iter++; l_iter++;
|
||||
BOOST_CHECK (!ba::one_of_equal ( li.begin(), l_iter, 1 ));
|
||||
BOOST_CHECK (!ba::one_of ( li.begin(), l_iter, is_<int> ( 1 )));
|
||||
BOOST_CHECK ( ba::one_of_equal ( li.begin(), l_iter, 2 ));
|
||||
BOOST_CHECK ( ba::one_of ( li.begin(), l_iter, is_<int> ( 2 )));
|
||||
BOOST_CHECK (!ba::one_of_equal ( li.begin(), l_iter, 3 ));
|
||||
BOOST_CHECK (!ba::one_of ( li.begin(), l_iter, is_<int> ( 3 )));
|
||||
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_one ();
|
||||
return 0;
|
||||
}
|
@@ -1,127 +0,0 @@
|
||||
// Copyright (c) 2010 Nuovation System Designs, LLC
|
||||
// Grant Erickson <gerickson@nuovations.com>
|
||||
//
|
||||
// Reworked by Marshall Clow; August 2010
|
||||
//
|
||||
// Distributed under the Boost Software License, Version 1.0. (See
|
||||
// accompanying file LICENSE_1_0.txt or copy at
|
||||
// http://www.boost.org/LICENSE_1_0.txt)
|
||||
//
|
||||
// See http://www.boost.org/ for latest version.
|
||||
|
||||
#include <algorithm>
|
||||
#include <iostream>
|
||||
|
||||
#include <boost/algorithm/cxx11/ordered.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
using namespace boost;
|
||||
|
||||
/* Preprocessor Defines */
|
||||
|
||||
#define elementsof(v) (sizeof (v) / sizeof (v[0]))
|
||||
#define a_begin(v) (&v[0])
|
||||
#define a_end(v) (v + elementsof (v))
|
||||
#define a_range(v) v
|
||||
#define b_e(v) a_begin(v),a_end(v)
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
|
||||
static void
|
||||
test_ordered(void)
|
||||
{
|
||||
const int strictlyIncreasingValues[] = { 1, 2, 3, 4, 5 };
|
||||
const int strictlyDecreasingValues[] = { 9, 8, 7, 6, 5 };
|
||||
const int increasingValues[] = { 1, 2, 2, 2, 5 };
|
||||
const int decreasingValues[] = { 9, 7, 7, 7, 5 };
|
||||
const int randomValues[] = { 3, 6, 1, 2, 7 };
|
||||
const int constantValues[] = { 7, 7, 7, 7, 7 };
|
||||
int nonConstantArray[] = { 7, 7, 7, 7, 7 };
|
||||
const int inOrderUntilTheEnd [] = { 0, 1, 2, 3, 4, 5, 6, 7, 6 };
|
||||
|
||||
// Test a strictly increasing sequence
|
||||
BOOST_CHECK ( ba::is_strictly_increasing (b_e(strictlyIncreasingValues)));
|
||||
BOOST_CHECK ( ba::is_increasing (b_e(strictlyIncreasingValues)));
|
||||
BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(strictlyIncreasingValues)));
|
||||
BOOST_CHECK ( !ba::is_decreasing (b_e(strictlyIncreasingValues)));
|
||||
|
||||
BOOST_CHECK ( ba::is_strictly_increasing (a_range(strictlyIncreasingValues)));
|
||||
BOOST_CHECK ( ba::is_increasing (a_range(strictlyIncreasingValues)));
|
||||
BOOST_CHECK ( !ba::is_strictly_decreasing (a_range(strictlyIncreasingValues)));
|
||||
BOOST_CHECK ( !ba::is_decreasing (a_range(strictlyIncreasingValues)));
|
||||
|
||||
// Test a strictly decreasing sequence
|
||||
BOOST_CHECK ( !ba::is_strictly_increasing (b_e(strictlyDecreasingValues)));
|
||||
BOOST_CHECK ( !ba::is_increasing (b_e(strictlyDecreasingValues)));
|
||||
BOOST_CHECK ( ba::is_strictly_decreasing (b_e(strictlyDecreasingValues)));
|
||||
BOOST_CHECK ( ba::is_decreasing (b_e(strictlyDecreasingValues)));
|
||||
|
||||
// Test an increasing sequence
|
||||
BOOST_CHECK ( !ba::is_strictly_increasing (b_e(increasingValues)));
|
||||
BOOST_CHECK ( ba::is_increasing (b_e(increasingValues)));
|
||||
BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(increasingValues)));
|
||||
BOOST_CHECK ( !ba::is_decreasing (b_e(increasingValues)));
|
||||
|
||||
// Test a decreasing sequence
|
||||
BOOST_CHECK ( !ba::is_strictly_increasing (b_e(decreasingValues)));
|
||||
BOOST_CHECK ( !ba::is_increasing (b_e(decreasingValues)));
|
||||
BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(decreasingValues)));
|
||||
BOOST_CHECK ( ba::is_decreasing (b_e(decreasingValues)));
|
||||
|
||||
// Test a random sequence
|
||||
BOOST_CHECK ( !ba::is_strictly_increasing (b_e(randomValues)));
|
||||
BOOST_CHECK ( !ba::is_increasing (b_e(randomValues)));
|
||||
BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(randomValues)));
|
||||
BOOST_CHECK ( !ba::is_decreasing (b_e(randomValues)));
|
||||
|
||||
// Test a constant sequence
|
||||
BOOST_CHECK ( !ba::is_strictly_increasing (b_e(constantValues)));
|
||||
BOOST_CHECK ( ba::is_increasing (b_e(constantValues)));
|
||||
BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(constantValues)));
|
||||
BOOST_CHECK ( ba::is_decreasing (b_e(constantValues)));
|
||||
|
||||
// Test an empty sequence
|
||||
BOOST_CHECK ( ba::is_strictly_increasing (strictlyIncreasingValues, strictlyIncreasingValues));
|
||||
BOOST_CHECK ( ba::is_increasing (strictlyIncreasingValues, strictlyIncreasingValues));
|
||||
BOOST_CHECK ( ba::is_strictly_decreasing (strictlyIncreasingValues, strictlyIncreasingValues));
|
||||
BOOST_CHECK ( ba::is_decreasing (strictlyIncreasingValues, strictlyIncreasingValues));
|
||||
|
||||
// Test a one-element sequence
|
||||
BOOST_CHECK ( ba::is_strictly_increasing (strictlyIncreasingValues, strictlyIncreasingValues+1));
|
||||
BOOST_CHECK ( ba::is_increasing (strictlyIncreasingValues, strictlyIncreasingValues+1));
|
||||
BOOST_CHECK ( ba::is_strictly_decreasing (strictlyIncreasingValues, strictlyIncreasingValues+1));
|
||||
BOOST_CHECK ( ba::is_decreasing (strictlyIncreasingValues, strictlyIncreasingValues+1));
|
||||
|
||||
// Test a two-element sequence
|
||||
BOOST_CHECK ( ba::is_strictly_increasing (strictlyIncreasingValues, strictlyIncreasingValues+2));
|
||||
BOOST_CHECK ( ba::is_increasing (strictlyIncreasingValues, strictlyIncreasingValues+2));
|
||||
BOOST_CHECK ( !ba::is_strictly_decreasing (strictlyIncreasingValues, strictlyIncreasingValues+2));
|
||||
BOOST_CHECK ( !ba::is_decreasing (strictlyIncreasingValues, strictlyIncreasingValues+2));
|
||||
|
||||
// Test underlying routines
|
||||
BOOST_CHECK ( ba::is_sorted_until ( b_e(strictlyIncreasingValues), std::less<int>()) == a_end(strictlyIncreasingValues));
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_range(strictlyIncreasingValues), std::less<int>()) == boost::end(strictlyIncreasingValues));
|
||||
|
||||
BOOST_CHECK ( ba::is_sorted_until ( b_e(nonConstantArray), std::less<int>()) != a_end(nonConstantArray));
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_range(nonConstantArray), std::less<int>()) != boost::end(nonConstantArray));
|
||||
|
||||
BOOST_CHECK ( ba::is_sorted_until ( b_e(randomValues), std::less<int>()) == &randomValues[2] );
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_range(randomValues), std::less<int>()) == &randomValues[2] );
|
||||
|
||||
BOOST_CHECK ( ba::is_sorted_until ( b_e(randomValues), std::less<int>()) == &randomValues[2] );
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_range(randomValues), std::less<int>()) == &randomValues[2] );
|
||||
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_range(inOrderUntilTheEnd), std::less<int>()) == &inOrderUntilTheEnd[8] );
|
||||
|
||||
// For zero and one element collections, the comparison predicate should never be called
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_begin(randomValues), a_begin(randomValues), std::equal_to<int>()) == a_begin(randomValues));
|
||||
BOOST_CHECK ( ba::is_sorted_until ( a_begin(randomValues), a_begin(randomValues) + 1, std::equal_to<int>()) == a_begin(randomValues) + 1);
|
||||
|
||||
}
|
||||
|
||||
int test_main( int, char * [] )
|
||||
{
|
||||
test_ordered ();
|
||||
|
||||
return 0;
|
||||
}
|
@@ -1,87 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <iostream>
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/partition_copy.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <boost/algorithm/cxx11/all_of.hpp>
|
||||
#include <boost/algorithm/cxx11/none_of.hpp>
|
||||
#include <string>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
// namespace ba = boost;
|
||||
|
||||
template <typename Container, typename Predicate>
|
||||
void test_sequence ( const Container &c, Predicate comp ) {
|
||||
std::vector<typename Container::value_type> v1, v2;
|
||||
|
||||
v1.clear (); v2.clear ();
|
||||
ba::partition_copy ( c.begin (), c.end (),
|
||||
std::back_inserter (v1), std::back_inserter (v2), comp );
|
||||
// std::cout << "Sizes(1): " << c.size () << " -> { " << v1.size () << ", " << v2.size () << " }" << std::endl;
|
||||
BOOST_CHECK ( v1.size () + v2.size () == c.size ());
|
||||
BOOST_CHECK ( ba::all_of ( v1.begin (), v1.end (), comp ));
|
||||
BOOST_CHECK ( ba::none_of ( v2.begin (), v2.end (), comp ));
|
||||
|
||||
v1.clear (); v2.clear ();
|
||||
ba::partition_copy ( c, std::back_inserter (v1), std::back_inserter ( v2 ), comp );
|
||||
// std::cout << "Sizes(2): " << c.size () << " -> { " << v1.size () << ", " << v2.size () << " }" << std::endl;
|
||||
BOOST_CHECK ( v1.size () + v2.size () == c.size ());
|
||||
BOOST_CHECK ( ba::all_of ( v1, comp ));
|
||||
BOOST_CHECK ( ba::none_of ( v2, comp ));
|
||||
}
|
||||
|
||||
template <typename T>
|
||||
struct less_than {
|
||||
public:
|
||||
less_than ( T foo ) : val ( foo ) {}
|
||||
less_than ( const less_than &rhs ) : val ( rhs.val ) {}
|
||||
|
||||
bool operator () ( const T &v ) const { return v < val; }
|
||||
private:
|
||||
less_than ();
|
||||
less_than operator = ( const less_than &rhs );
|
||||
T val;
|
||||
};
|
||||
|
||||
bool is_even ( int v ) { return v % 2 == 0; }
|
||||
|
||||
void test_sequence1 () {
|
||||
std::vector<int> v;
|
||||
|
||||
v.clear ();
|
||||
for ( int i = 5; i < 15; ++i )
|
||||
v.push_back ( i );
|
||||
test_sequence ( v, less_than<int>(3)); // no elements
|
||||
test_sequence ( v, less_than<int>(6)); // only the first element
|
||||
test_sequence ( v, less_than<int>(10));
|
||||
test_sequence ( v, less_than<int>(99)); // all elements satisfy
|
||||
|
||||
// With bidirectional iterators.
|
||||
std::list<int> l;
|
||||
for ( int i = 5; i < 16; ++i )
|
||||
l.push_back ( i );
|
||||
test_sequence ( l, less_than<int>(3)); // no elements
|
||||
test_sequence ( l, less_than<int>(6)); // only the first element
|
||||
test_sequence ( l, less_than<int>(10));
|
||||
test_sequence ( l, less_than<int>(99)); // all elements satisfy
|
||||
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_sequence1 ();
|
||||
return 0;
|
||||
}
|
@@ -1,98 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2011-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <iostream>
|
||||
|
||||
#include <boost/config.hpp>
|
||||
#include <boost/algorithm/cxx11/partition_point.hpp>
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <string>
|
||||
#include <vector>
|
||||
#include <list>
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
// namespace ba = boost;
|
||||
|
||||
template <typename Container>
|
||||
typename Container::iterator offset_to_iter ( Container &v, int offset ) {
|
||||
typename Container::iterator retval;
|
||||
|
||||
if ( offset >= 0 ) {
|
||||
retval = v.begin ();
|
||||
std::advance ( retval, offset );
|
||||
}
|
||||
else {
|
||||
retval = v.end ();
|
||||
std::advance ( retval, offset + 1 );
|
||||
}
|
||||
return retval;
|
||||
}
|
||||
|
||||
template <typename Container, typename Predicate>
|
||||
void test_sequence ( Container &v, Predicate comp, int expected ) {
|
||||
typename Container::iterator res, exp;
|
||||
|
||||
res = ba::partition_point ( v.begin (), v.end (), comp );
|
||||
exp = offset_to_iter ( v, expected );
|
||||
std::cout << "Expected(1): " << std::distance ( v.begin (), exp )
|
||||
<< ", got: " << std::distance ( v.begin (), res ) << std::endl;
|
||||
BOOST_CHECK ( exp == res );
|
||||
|
||||
// Duplicate the last element; this checks for any even/odd problems
|
||||
v.push_back ( * v.rbegin ());
|
||||
res = ba::partition_point ( v.begin (), v.end (), comp );
|
||||
exp = offset_to_iter ( v, expected );
|
||||
std::cout << "Expected(2): " << std::distance ( v.begin (), exp )
|
||||
<< ", got: " << std::distance ( v.begin (), res ) << std::endl;
|
||||
BOOST_CHECK ( exp == res );
|
||||
}
|
||||
|
||||
template <typename T>
|
||||
struct less_than {
|
||||
public:
|
||||
less_than ( T foo ) : val ( foo ) {}
|
||||
less_than ( const less_than &rhs ) : val ( rhs.val ) {}
|
||||
|
||||
bool operator () ( const T &v ) const { return v < val; }
|
||||
private:
|
||||
less_than ();
|
||||
less_than operator = ( const less_than &rhs );
|
||||
T val;
|
||||
};
|
||||
|
||||
|
||||
void test_sequence1 () {
|
||||
std::vector<int> v;
|
||||
|
||||
v.clear ();
|
||||
for ( int i = 5; i < 15; ++i )
|
||||
v.push_back ( i );
|
||||
test_sequence ( v, less_than<int>(3), 0 ); // no elements
|
||||
test_sequence ( v, less_than<int>(6), 1 ); // only the first element
|
||||
test_sequence ( v, less_than<int>(10), 5 );
|
||||
test_sequence ( v, less_than<int>(99), -1 ); // all elements satisfy
|
||||
|
||||
// With bidirectional iterators.
|
||||
std::list<int> l;
|
||||
for ( int i = 5; i < 15; ++i )
|
||||
l.push_back ( i );
|
||||
test_sequence ( l, less_than<int>(3), 0 ); // no elements
|
||||
test_sequence ( l, less_than<int>(6), 1 ); // only the first element
|
||||
test_sequence ( l, less_than<int>(10), 5 );
|
||||
test_sequence ( l, less_than<int>(99), -1 ); // all elements satisfy
|
||||
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
test_sequence1 ();
|
||||
return 0;
|
||||
}
|
@@ -1,26 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <vector>
|
||||
#include <boost/algorithm/searching/boyer_moore.hpp>
|
||||
|
||||
int main( int argc, char *argv [] )
|
||||
{
|
||||
std::vector<char> cv;
|
||||
std::vector<int> iv;
|
||||
|
||||
// Should fail to compile because the underlying types are different
|
||||
// They are (almost certainly) different sizes
|
||||
(void) boost::algorithm::boyer_moore_search (
|
||||
cv.begin (), cv.end (), iv.begin (), iv.end ());
|
||||
|
||||
|
||||
(void) argv; (void) argc;
|
||||
return 0;
|
||||
}
|
@@ -1,27 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <vector>
|
||||
#include <boost/cstdint.hpp>
|
||||
#include <boost/algorithm/searching/boyer_moore.hpp>
|
||||
|
||||
int main( int argc, char *argv [] )
|
||||
{
|
||||
std::vector<boost::uint8_t> cv;
|
||||
std::vector<boost:: int8_t> iv;
|
||||
|
||||
// Should fail to compile because the underlying types are different
|
||||
// They are the same size, but one is signed, and the other is not.
|
||||
(void) boost::algorithm::boyer_moore_search (
|
||||
cv.begin (), cv.end (), iv.begin (), iv.end ());
|
||||
|
||||
|
||||
(void) argv; (void) argc;
|
||||
return 0;
|
||||
}
|
@@ -1,20 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <vector>
|
||||
#include <boost/algorithm/searching/boyer_moore.hpp>
|
||||
|
||||
int main( int argc, char *argv [] )
|
||||
{
|
||||
// Should fail to compile because the search objects are not default-constructible
|
||||
boost::algorithm::boyer_moore<std::vector<char>::iterator> bm;
|
||||
|
||||
(void) argv; (void) argc;
|
||||
return 0;
|
||||
}
|
@@ -1,272 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/algorithm/searching/boyer_moore.hpp>
|
||||
#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
|
||||
#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
|
||||
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <iostream>
|
||||
#include <string>
|
||||
#include <vector>
|
||||
|
||||
|
||||
namespace ba = boost::algorithm;
|
||||
|
||||
template <typename Iter>
|
||||
std::string make_str ( Iter first, std::size_t len ) {
|
||||
std::string retVal ( len + 2, '\'' );
|
||||
std::copy ( first, first+len, retVal.begin () + 1);
|
||||
return retVal;
|
||||
}
|
||||
|
||||
namespace {
|
||||
|
||||
// Check using iterators
|
||||
template<typename Container>
|
||||
void check_one_iter ( const Container &haystack, const std::string &needle, int expected ) {
|
||||
typedef typename Container::const_iterator iter_type;
|
||||
typedef std::string::const_iterator pattern_type;
|
||||
|
||||
iter_type hBeg = haystack.begin ();
|
||||
iter_type hEnd = haystack.end ();
|
||||
pattern_type nBeg = needle.begin ();
|
||||
pattern_type nEnd = needle.end ();
|
||||
|
||||
iter_type it0 = std::search (hBeg, hEnd, nBeg, nEnd);
|
||||
iter_type it1 = ba::boyer_moore_search (hBeg, hEnd, nBeg, nEnd);
|
||||
iter_type it1r = ba::boyer_moore_search (haystack, nBeg, nEnd);
|
||||
iter_type it2 = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd);
|
||||
iter_type it3 = ba::knuth_morris_pratt_search (hBeg, hEnd, nBeg, nEnd);
|
||||
const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
|
||||
|
||||
std::cout << "(Iterators) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
|
||||
try {
|
||||
if ( it0 != it1 ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between std::search and boyer-moore search" ));
|
||||
}
|
||||
|
||||
if ( it1 != it1r ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between iterator and range boyer_moore search" ));
|
||||
}
|
||||
|
||||
if ( it1 != it2 ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
|
||||
}
|
||||
|
||||
if ( it1 != it3 )
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
|
||||
|
||||
}
|
||||
|
||||
catch ( ... ) {
|
||||
std::cout << "Searching for: " << needle << std::endl;
|
||||
std::cout << "Expected: " << expected << "\n";
|
||||
std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n";
|
||||
std::cout << " bm: " << std::distance ( hBeg, it1 ) << "\n";
|
||||
std::cout << " bm(r): " << std::distance ( hBeg, it1r ) << "\n";
|
||||
std::cout << " bmh: " << std::distance ( hBeg, it2 ) << "\n";
|
||||
std::cout << " kpm: " << std::distance ( hBeg, it3 )<< "\n";
|
||||
std::cout << std::flush;
|
||||
throw ;
|
||||
}
|
||||
|
||||
BOOST_CHECK_EQUAL ( dist, expected );
|
||||
}
|
||||
|
||||
// Check using pointers
|
||||
// We're assuming that the container implements contiguous storage here.
|
||||
template<typename Container>
|
||||
void check_one_pointer ( const Container &haystack, const std::string &needle, int expected ) {
|
||||
typedef const typename Container::value_type *ptr_type;
|
||||
ptr_type hBeg = haystack.size () == 0 ? NULL : &*haystack.begin ();
|
||||
ptr_type hEnd = hBeg + haystack.size ();
|
||||
ptr_type nBeg = needle.size () == 0 ? NULL : &*needle.begin ();
|
||||
ptr_type nEnd = nBeg + needle.size ();
|
||||
|
||||
ptr_type it0 = std::search (hBeg, hEnd, nBeg, nEnd);
|
||||
ptr_type it1 = ba::boyer_moore_search (hBeg, hEnd, nBeg, nEnd);
|
||||
ptr_type it2 = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd);
|
||||
ptr_type it3 = ba::knuth_morris_pratt_search (hBeg, hEnd, nBeg, nEnd);
|
||||
const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
|
||||
|
||||
std::cout << "(Pointers) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
|
||||
try {
|
||||
if ( it0 != it1 ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between std::search and boyer-moore search" ));
|
||||
}
|
||||
|
||||
if ( it1 != it2 ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
|
||||
}
|
||||
|
||||
if ( it1 != it3 )
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
|
||||
|
||||
}
|
||||
|
||||
catch ( ... ) {
|
||||
std::cout << "Searching for: " << needle << std::endl;
|
||||
std::cout << "Expected: " << expected << "\n";
|
||||
std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n";
|
||||
std::cout << " bm: " << std::distance ( hBeg, it1 ) << "\n";
|
||||
std::cout << " bmh: " << std::distance ( hBeg, it2 ) << "\n";
|
||||
std::cout << " kpm: " << std::distance ( hBeg, it3 )<< "\n";
|
||||
std::cout << std::flush;
|
||||
throw ;
|
||||
}
|
||||
|
||||
BOOST_CHECK_EQUAL ( dist, expected );
|
||||
}
|
||||
|
||||
// Check using objects
|
||||
template<typename Container>
|
||||
void check_one_object ( const Container &haystack, const std::string &needle, int expected ) {
|
||||
typedef typename Container::const_iterator iter_type;
|
||||
typedef std::string::const_iterator pattern_type;
|
||||
|
||||
iter_type hBeg = haystack.begin ();
|
||||
iter_type hEnd = haystack.end ();
|
||||
pattern_type nBeg = needle.begin ();
|
||||
pattern_type nEnd = needle.end ();
|
||||
|
||||
ba::boyer_moore<pattern_type> bm_r = ba::make_boyer_moore ( needle );
|
||||
ba::boyer_moore<pattern_type> bm ( nBeg, nEnd );
|
||||
ba::boyer_moore_horspool<pattern_type> bmh ( nBeg, nEnd );
|
||||
ba::knuth_morris_pratt<pattern_type> kmp ( nBeg, nEnd );
|
||||
|
||||
iter_type it0 = std::search (hBeg, hEnd, nBeg, nEnd);
|
||||
iter_type it1 = bm (hBeg, hEnd);
|
||||
iter_type it1r = bm (haystack);
|
||||
iter_type rt1 = bm_r (hBeg, hEnd);
|
||||
iter_type rt1r = bm_r (haystack);
|
||||
iter_type it2 = bmh (hBeg, hEnd);
|
||||
iter_type it3 = kmp (hBeg, hEnd);
|
||||
const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
|
||||
|
||||
std::cout << "(Objects) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
|
||||
try {
|
||||
if ( it0 != it1 ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between std::search and boyer-moore search" ));
|
||||
}
|
||||
|
||||
if ( it1 != it1r ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between iterator and range boyer_moore search(1)" ));
|
||||
}
|
||||
|
||||
if ( it1 != rt1 ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between iterator and range boyer_moore search(2)" ));
|
||||
}
|
||||
|
||||
if ( rt1 != rt1r ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between iterator and range boyer_moore search(3)" ));
|
||||
}
|
||||
|
||||
if ( it1 != it2 ) {
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
|
||||
}
|
||||
|
||||
if ( it1 != it3 )
|
||||
throw std::runtime_error (
|
||||
std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
|
||||
|
||||
}
|
||||
|
||||
catch ( ... ) {
|
||||
std::cout << "Searching for: " << needle << std::endl;
|
||||
std::cout << "Expected: " << expected << "\n";
|
||||
std::cout << " std: " << std::distance ( hBeg, it0 ) << "\n";
|
||||
std::cout << " bm: " << std::distance ( hBeg, it1 ) << "\n";
|
||||
std::cout << " bm(r1): " << std::distance ( hBeg, it1r ) << "\n";
|
||||
std::cout << " bm(r2): " << std::distance ( hBeg, rt1 ) << "\n";
|
||||
std::cout << " bm(r3): " << std::distance ( hBeg, rt1r ) << "\n";
|
||||
std::cout << " bmh: " << std::distance ( hBeg, it2 ) << "\n";
|
||||
std::cout << " kpm: " << std::distance ( hBeg, it3 )<< "\n";
|
||||
std::cout << std::flush;
|
||||
throw ;
|
||||
}
|
||||
|
||||
BOOST_CHECK_EQUAL ( dist, expected );
|
||||
}
|
||||
|
||||
|
||||
template<typename Container>
|
||||
void check_one ( const Container &haystack, const std::string &needle, int expected ) {
|
||||
check_one_iter ( haystack, needle, expected );
|
||||
check_one_pointer ( haystack, needle, expected );
|
||||
check_one_object ( haystack, needle, expected );
|
||||
}
|
||||
}
|
||||
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
std::string haystack1 ( "NOW AN FOWE\220ER ANNMAN THE ANPANMANEND" );
|
||||
std::string needle1 ( "ANPANMAN" );
|
||||
std::string needle2 ( "MAN THE" );
|
||||
std::string needle3 ( "WE\220ER" );
|
||||
std::string needle4 ( "NOW " ); // At the beginning
|
||||
std::string needle5 ( "NEND" ); // At the end
|
||||
std::string needle6 ( "NOT FOUND" ); // Nowhere
|
||||
std::string needle7 ( "NOT FO\340ND" ); // Nowhere
|
||||
|
||||
std::string haystack2 ( "ABC ABCDAB ABCDABCDABDE" );
|
||||
std::string needle11 ( "ABCDABD" );
|
||||
|
||||
std::string haystack3 ( "abra abracad abracadabra" );
|
||||
std::string needle12 ( "abracadabra" );
|
||||
|
||||
std::string needle13 ( "" );
|
||||
std::string haystack4 ( "" );
|
||||
|
||||
check_one ( haystack1, needle1, 26 );
|
||||
check_one ( haystack1, needle2, 18 );
|
||||
check_one ( haystack1, needle3, 9 );
|
||||
check_one ( haystack1, needle4, 0 );
|
||||
check_one ( haystack1, needle5, 33 );
|
||||
check_one ( haystack1, needle6, -1 );
|
||||
check_one ( haystack1, needle7, -1 );
|
||||
|
||||
check_one ( needle1, haystack1, -1 ); // cant find long pattern in short corpus
|
||||
check_one ( haystack1, haystack1, 0 ); // find something in itself
|
||||
check_one ( haystack2, haystack2, 0 ); // find something in itself
|
||||
|
||||
check_one ( haystack2, needle11, 15 );
|
||||
check_one ( haystack3, needle12, 13 );
|
||||
|
||||
check_one ( haystack1, needle13, 0 ); // find the empty string
|
||||
check_one ( haystack4, needle1, -1 ); // can't find in an empty haystack
|
||||
|
||||
// Mikhail Levin <svarneticist@gmail.com> found a problem, and this was the test
|
||||
// that triggered it.
|
||||
|
||||
const std::string mikhail_pattern =
|
||||
"GATACACCTACCTTCACCAGTTACTCTATGCACTAGGTGCGCCAGGCCCATGCACAAGGGCTTGAGTGGATGGGAAGGA"
|
||||
"TGTGCCCTAGTGATGGCAGCATAAGCTACGCAGAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACATCCACGAG"
|
||||
"CACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCCATGTATTACTGTGGGAGAGATGTCTGGAGTGGT"
|
||||
"TATTATTGCCCCGGTAATATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACG"
|
||||
;
|
||||
const std::string mikhail_corpus = std::string (8, 'a') + mikhail_pattern;
|
||||
|
||||
check_one ( mikhail_corpus, mikhail_pattern, 8 );
|
||||
return 0;
|
||||
}
|
@@ -1,145 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/algorithm/searching/boyer_moore.hpp>
|
||||
#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
|
||||
#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
|
||||
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <iostream>
|
||||
#include <algorithm>
|
||||
#include <vector>
|
||||
|
||||
typedef std::vector<char> vec;
|
||||
#define NUM_TRIES 100
|
||||
|
||||
#define runOne(call, refDiff) { \
|
||||
std::clock_t bTime, eTime; \
|
||||
bTime = std::clock (); \
|
||||
for ( i = 0; i < NUM_TRIES; ++i ) { \
|
||||
res = boost::algorithm::call \
|
||||
( haystack.begin (), haystack.end (), \
|
||||
needle.begin (), needle.end ()); \
|
||||
if ( res != exp ) { \
|
||||
std::cout << "On run # " << i << " expected " \
|
||||
<< exp - haystack.begin () << " got " \
|
||||
<< res - haystack.begin () << std::endl; \
|
||||
throw std::runtime_error \
|
||||
( "Unexpected result from " #call ); \
|
||||
} \
|
||||
} \
|
||||
eTime = std::clock (); \
|
||||
printRes ( #call, eTime - bTime, refDiff ); }
|
||||
|
||||
#define runObject(obj, refDiff) { \
|
||||
std::clock_t bTime, eTime; \
|
||||
bTime = std::clock (); \
|
||||
boost::algorithm::obj <vec::const_iterator> \
|
||||
s_o ( needle.begin (), needle.end ()); \
|
||||
for ( i = 0; i < NUM_TRIES; ++i ) { \
|
||||
res = s_o ( haystack.begin (), haystack.end ()); \
|
||||
if ( res != exp ) { \
|
||||
std::cout << "On run # " << i << " expected " \
|
||||
<< exp - haystack.begin () << " got " \
|
||||
<< res - haystack.begin () << std::endl; \
|
||||
throw std::runtime_error \
|
||||
( "Unexpected result from " #obj " object" ); \
|
||||
} \
|
||||
} \
|
||||
eTime = std::clock (); \
|
||||
printRes ( #obj " object", eTime - bTime, refDiff ); }
|
||||
|
||||
|
||||
|
||||
namespace {
|
||||
|
||||
vec ReadFromFile ( const char *name ) {
|
||||
std::ifstream in ( name, std::ios_base::binary | std::ios_base::in );
|
||||
vec retVal;
|
||||
std::istream_iterator<char, char> begin(in);
|
||||
std::istream_iterator<char, char> end;
|
||||
|
||||
std::copy ( begin, end, std::back_inserter ( retVal ));
|
||||
return retVal;
|
||||
}
|
||||
|
||||
void printRes ( const char *prompt, unsigned long diff, unsigned long stdDiff ) {
|
||||
std::cout
|
||||
<< std::setw(34) << prompt << " "
|
||||
<< std::setw(6) << ( 1.0 * diff) / CLOCKS_PER_SEC << " seconds\t"
|
||||
<< std::setw(5) << (100.0 * diff) / stdDiff << "% \t"
|
||||
<< std::setw(12) << diff;
|
||||
if ( diff > stdDiff )
|
||||
std::cout << " !!";
|
||||
std::cout << std::endl;
|
||||
}
|
||||
|
||||
void check_one ( const vec &haystack, const vec &needle, int expected ) {
|
||||
std::size_t i;
|
||||
std::clock_t sTime;
|
||||
unsigned long stdDiff;
|
||||
|
||||
vec::const_iterator res;
|
||||
vec::const_iterator exp; // the expected result
|
||||
|
||||
if ( expected >= 0 )
|
||||
exp = haystack.begin () + expected;
|
||||
else if ( expected == -1 )
|
||||
exp = haystack.end (); // we didn't find it!
|
||||
else if ( expected == -2 )
|
||||
exp = std::search ( haystack.begin (), haystack.end (), needle.begin (), needle.end ());
|
||||
else
|
||||
throw std::logic_error ( "Expected must be -2, -1, or >= 0" );
|
||||
|
||||
std::cout << "Pattern is " << needle.size () << " entries long" << std::endl;
|
||||
std::cout << "Corpus is " << haystack.size () << " entries long" << std::endl;
|
||||
|
||||
// First, the std library search
|
||||
sTime = std::clock ();
|
||||
for ( i = 0; i < NUM_TRIES; ++i ) {
|
||||
res = std::search ( haystack.begin (), haystack.end (), needle.begin (), needle.end ());
|
||||
if ( res != exp ) {
|
||||
std::cout << "On run # " << i << " expected " << exp - haystack.begin () << " got " << res - haystack.begin () << std::endl;
|
||||
throw std::runtime_error ( "Unexpected result from std::search" );
|
||||
}
|
||||
}
|
||||
stdDiff = std::clock () - sTime;
|
||||
printRes ( "std::search", stdDiff, stdDiff );
|
||||
|
||||
runOne ( boyer_moore_search, stdDiff );
|
||||
runObject ( boyer_moore, stdDiff );
|
||||
runOne ( boyer_moore_horspool_search, stdDiff );
|
||||
runObject ( boyer_moore_horspool, stdDiff );
|
||||
runOne ( knuth_morris_pratt_search, stdDiff );
|
||||
runObject ( knuth_morris_pratt, stdDiff );
|
||||
}
|
||||
}
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
vec c1 = ReadFromFile ( "search_test_data/0001.corpus" );
|
||||
vec p1b = ReadFromFile ( "search_test_data/0001b.pat" );
|
||||
vec p1e = ReadFromFile ( "search_test_data/0001e.pat" );
|
||||
vec p1n = ReadFromFile ( "search_test_data/0001n.pat" );
|
||||
vec p1f = ReadFromFile ( "search_test_data/0001f.pat" );
|
||||
|
||||
std::cout << std::ios::fixed << std::setprecision(4);
|
||||
// std::cout << "Corpus is " << c1.size () << " entries long\n";
|
||||
std::cout << "--- Beginning ---" << std::endl;
|
||||
check_one ( c1, p1b, 0 ); // Find it at position zero
|
||||
std::cout << "---- Middle -----" << std::endl;
|
||||
check_one ( c1, p1f, -2 ); // Don't know answer
|
||||
std::cout << "------ End ------" << std::endl;
|
||||
check_one ( c1, p1e, c1.size() - p1e.size ());
|
||||
std::cout << "--- Not found ---" << std::endl;
|
||||
check_one ( c1, p1n, -1 ); // Not found
|
||||
|
||||
return 0;
|
||||
}
|
@@ -1,145 +0,0 @@
|
||||
/*
|
||||
Copyright (c) Marshall Clow 2010-2012.
|
||||
|
||||
Distributed under the Boost Software License, Version 1.0. (See accompanying
|
||||
file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
|
||||
|
||||
For more information, see http://www.boost.org
|
||||
*/
|
||||
|
||||
#include <boost/algorithm/searching/boyer_moore.hpp>
|
||||
#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
|
||||
#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
|
||||
|
||||
#include <boost/test/included/test_exec_monitor.hpp>
|
||||
|
||||
#include <iostream>
|
||||
#include <algorithm>
|
||||
#include <vector>
|
||||
#include <string>
|
||||
|
||||
typedef std::vector<std::string> vec;
|
||||
#define NUM_TRIES 100
|
||||
|
||||
#define runOne(call, refDiff) { \
|
||||
std::clock_t bTime, eTime; \
|
||||
bTime = std::clock (); \
|
||||
for ( i = 0; i < NUM_TRIES; ++i ) { \
|
||||
res = boost::algorithm::call \
|
||||
( haystack.begin (), haystack.end (), \
|
||||
needle.begin (), needle.end ()); \
|
||||
if ( res != exp ) { \
|
||||
std::cout << "On run # " << i << " expected " \
|
||||
<< exp - haystack.begin () << " got " \
|
||||
<< res - haystack.begin () << std::endl; \
|
||||
throw std::runtime_error \
|
||||
( "Unexpected result from " #call ); \
|
||||
} \
|
||||
} \
|
||||
eTime = std::clock (); \
|
||||
printRes ( #call, eTime - bTime, refDiff ); }
|
||||
|
||||
#define runObject(obj, refDiff) { \
|
||||
std::clock_t bTime, eTime; \
|
||||
bTime = std::clock (); \
|
||||
boost::algorithm::obj <vec::const_iterator> \
|
||||
s_o ( needle.begin (), needle.end ()); \
|
||||
for ( i = 0; i < NUM_TRIES; ++i ) { \
|
||||
res = s_o ( haystack.begin (), haystack.end ()); \
|
||||
if ( res != exp ) { \
|
||||
std::cout << "On run # " << i << " expected " \
|
||||
<< exp - haystack.begin () << " got " \
|
||||
<< res - haystack.begin () << std::endl; \
|
||||
throw std::runtime_error \
|
||||
( "Unexpected result from " #obj " object" ); \
|
||||
} \
|
||||
} \
|
||||
eTime = std::clock (); \
|
||||
printRes ( #obj " object", eTime - bTime, refDiff ); }
|
||||
|
||||
|
||||
namespace {
|
||||
|
||||
vec ReadFromFile ( const char *name ) {
|
||||
std::ifstream in ( name, std::ios_base::binary | std::ios_base::in );
|
||||
std::string temp;
|
||||
vec retVal;
|
||||
while ( std::getline ( in, temp ))
|
||||
retVal.push_back ( temp );
|
||||
|
||||
return retVal;
|
||||
}
|
||||
|
||||
void printRes ( const char *prompt, unsigned long diff, unsigned long stdDiff ) {
|
||||
std::cout
|
||||
<< std::setw(34) << prompt << " "
|
||||
<< std::setw(6) << ( 1.0 * diff) / CLOCKS_PER_SEC << " seconds\t"
|
||||
<< std::setw(5) << (100.0 * diff) / stdDiff << "% \t"
|
||||
<< std::setw(12) << diff;
|
||||
if ( diff > stdDiff )
|
||||
std::cout << " !!";
|
||||
std::cout << std::endl;
|
||||
}
|
||||
|
||||
void check_one ( const vec &haystack, const vec &needle, int expected ) {
|
||||
std::size_t i;
|
||||
std::clock_t sTime;
|
||||
unsigned long stdDiff;
|
||||
|
||||
vec::const_iterator res;
|
||||
vec::const_iterator exp; // the expected result
|
||||
|
||||
if ( expected >= 0 )
|
||||
exp = haystack.begin () + expected;
|
||||
else if ( expected == -1 )
|
||||
exp = haystack.end (); // we didn't find it1
|
||||
else if ( expected == -2 )
|
||||
exp = std::search ( haystack.begin (), haystack.end (), needle.begin (), needle.end ());
|
||||
else
|
||||
throw std::logic_error ( "Expected must be -2, -1, or >= 0" );
|
||||
|
||||
std::cout << "Pattern is " << needle.size () << " entries long" << std::endl;
|
||||
std::cout << "Corpus is " << haystack.size () << " entries long" << std::endl;
|
||||
|
||||
// First, the std library search
|
||||
sTime = std::clock ();
|
||||
for ( i = 0; i < NUM_TRIES; ++i ) {
|
||||
res = std::search ( haystack.begin (), haystack.end (), needle.begin (), needle.end ());
|
||||
if ( res != exp ) {
|
||||
std::cout << "On run # " << i << " expected " << exp - haystack.begin () << " got " << res - haystack.begin () << std::endl;
|
||||
throw std::runtime_error ( "Unexpected result from std::search" );
|
||||
}
|
||||
}
|
||||
stdDiff = std::clock () - sTime;
|
||||
printRes ( "std::search", stdDiff, stdDiff );
|
||||
|
||||
runOne ( boyer_moore_search, stdDiff );
|
||||
runObject ( boyer_moore, stdDiff );
|
||||
runOne ( boyer_moore_horspool_search, stdDiff );
|
||||
runObject ( boyer_moore_horspool, stdDiff );
|
||||
runOne ( knuth_morris_pratt_search, stdDiff );
|
||||
runObject ( knuth_morris_pratt, stdDiff );
|
||||
}
|
||||
}
|
||||
|
||||
int test_main( int , char* [] )
|
||||
{
|
||||
vec c1 = ReadFromFile ( "search_test_data/0001.corpus" );
|
||||
vec p1b = ReadFromFile ( "search_test_data/0002b.pat" );
|
||||
vec p1e = ReadFromFile ( "search_test_data/0002e.pat" );
|
||||
vec p1n = ReadFromFile ( "search_test_data/0002n.pat" );
|
||||
vec p1f = ReadFromFile ( "search_test_data/0002f.pat" );
|
||||
|
||||
std::cout << std::ios::fixed << std::setprecision(4);
|
||||
// std::cout << "Corpus is " << c1.size () << " entries long\n";
|
||||
std::cout << "--- Beginning ---" << std::endl;
|
||||
check_one ( c1, p1b, 0 ); // Find it at position zero
|
||||
std::cout << "---- Middle -----" << std::endl;
|
||||
check_one ( c1, p1f, -2 ); // Don't know answer
|
||||
std::cout << "------ End ------" << std::endl;
|
||||
check_one ( c1, p1e, c1.size() - p1e.size ());
|
||||
std::cout << "--- Not found ---" << std::endl;
|
||||
check_one ( c1, p1n, -1 ); // Not found
|
||||
|
||||
return 0;
|
||||
}
|
File diff suppressed because it is too large
Load Diff
@@ -1,2 +0,0 @@
|
||||
TU0AKgAfhPqScHN4dnZ2e3p5e3h7eXl4dnd1dnV3enp5dnd3dHV1dHNzd3l3eHh5
|
||||
eXZ4dXd2dHNwcHFwcXBxc3h0dHN1eHVzcXV1dXV2c3h5dHV3eHVwcHF
|
@@ -1,2 +0,0 @@
|
||||
iBJbmMuLCBhbGwg
|
||||
cmlnaHRzIHJlc2VydmVkLgAAAAA=
|
@@ -1,2 +0,0 @@
|
||||
q/y9PZ3uHj5ufo6UJDQ0NFQz8+RUZBQEBAOzo6Ozs4Nz06Ojs4Ojo9PT47Ojk0
|
||||
Nzc7OjQ6NzU6OjgxMzg1OjY2NjU3NTU1Nzc3NTU1NzU
|
@@ -1,2 +0,0 @@
|
||||
TIzMjIyMjM0MjM1nTQzNTc3MzY1NDU2NzQ2MjEwMjU1MTQ2NzU0NDI1
|
||||
NDMyMzQxMzQ0NDU1MjU2NTc5NzU1NDc4ODY1
|
@@ -1,170 +0,0 @@
|
||||
TU0AKgAfhPqScHN4dnZ2e3p5e3h7eXl4dnd1dnV3enp5dnd3dHV1dHNzd3l3eHh5
|
||||
eXZ4dXd2dHNwcHFwcXBxc3h0dHN1eHVzcXV1dXV2c3h5dHV3eHVwcHF1d3V0dXJy
|
||||
cXNzcHBwcHJyc3R0dXl7eHJycnF1dHV2d3h4eHV0cnRycXN1dXN0c3R0c3R0cXJx
|
||||
cHNxb3B0c29scHFybm9sbGpscXJ1c3NycXN0cHFvb3JzdHBycG9vb29vb29ubXBt
|
||||
bG9vcW5tbGptb3Fwb3Bwb25vbXFtbGtvbGlrbnBuamxsbW1rbW1vbm1ub3Btamxw
|
||||
bWpsbG9xcG5ua2tpamhqZ2hnam5saWhsbG1nZmZnZ2lnamtxa2ppZWZmZWlrZ2hp
|
||||
Z2hraWRmZ2psa2pmZWVkZmplZWZiYF1gZGVlYmJiY2RhY2NiYVxdW1xgXl9iZV9d
|
||||
X11hXF5gZWJhYF5dXWFmYl9hXl5gXmBhZGFhYV1cYWFiX2FgXFxgYF5iYmNiYWRk
|
||||
YWFjYGFgXl9jYmVlZGZiYV1cXFtbW1pYV1dVV1VWVlFQT1FRUVBRTkxLSktNTVFP
|
||||
UU1RUVBSUlBPUlNTUVRWWFpcVldXWldXVVhYVlpbWV1dX1tbW11fYWFdXV5iY2Rg
|
||||
YFxeYmNmZGJgYFxdYmdjYWFhYGJoZGReXF9gX2BhYWJhXltdXVtaXGJlYV5gYF9f
|
||||
XVxcX2JiYWJkZmNjZGNhYmFcW15dXmBgX1xdYF5fXF5eX15bWV1dXl9eWlldXGJf
|
||||
XmFgXVpcXF1dXlpdXl9dXWRlYF5cXFtfYF1eYl1hX1xbXV1ZV1hZWltbW1peW1lb
|
||||
XlteW1xeXlxbXVpYW11dY19fW1xfX2NhXV5hZWNfX2FjZGJlZmVoaWtlY2FkXl5f
|
||||
YWJjX19fX15dXWBjYmJeWlteXVlaXmBeXF1fXVxdXFtaW19dXFtfWllZWVxeXlxb
|
||||
XV9eW1xcXF5cW1paVVdbWVteW1pbWlZeYV1ZV1tYVlVWV1hbWVhcWVhVWlhbWFtX
|
||||
V1ZWWFtXVlZaVlRVVVdVVldWVlNRU1NTUVNXVVlZWVZVVFNWVlRTU1JVV1ZWVFRU
|
||||
UVFVWVpZWlZWWFpYWllcXVpYWFdWWFxbWFlYWVhVVVRVV1dZWllYV1lcXVpcWVhY
|
||||
V1VbW1tVVVdaXFpXVlZZW1leW1lWWFdaXVpXWlZXW1xdXFxgX1xYXVxcXFhaW1tb
|
||||
WlxcWltdWldXVldXWVZVUVJVWFlcW1tcWVpgXF9hX11aWVpdXFxeXFtbX19aW1lb
|
||||
W1paWlxdXVpaXVxeX1xdX2JjYV9gYl9cW1xbWFpeXl1gYGBgYFtdY2JhYmBgYGBe
|
||||
YGJkY2NjYmNjYGNiY2JgX19hYV1gX2BgX19hZWRiZWJjZWVgYmFiZGRmaWdmYWJj
|
||||
YmJjZGFhY2FhY2RkZmVmY2FhYWVnaWVjZGNhY2RlZWZqZ2doZ2RjZGRmaGVlZmZm
|
||||
Z2dnaGhoZ2hmY2VmZWZjZWNlaWdlZmVoZ2hpamlra2hram1samtqZWpuc2tpa21u
|
||||
bmtraWtqYWNmZmZmZGVpZ2p0kMLk8vv+/////////5drcHZ1dnd7fHt6end0c3V1
|
||||
dnR0d3l3d3Z3fH16dnV2d3h0d3l2d3h4dXZ3d3d3dnBucW5vb3BxdHR3d3Jzd3Vz
|
||||
dndzc3V6eHVyc3JydXZxc3Z1d3V0eHZ1c3Bvc3V0dnR0dXR0dHd4dnRxc3J0c3d3
|
||||
dXNycXd1dnVzcHJ0d3h0dHFwcXFzc3N0dXFxcXFwcHFwcnFycHJwcHJzc3Fwc3Nx
|
||||
cnRyc29ucHJ0cnBwb29ub3Fwc3R0cnJubnBycG1ucHBxcXBuc3FwbGpoamlsb3By
|
||||
c25qaW1tcW1qbXFua25xb21vcG9tbG5qa2doaW1sbGpqamxsaWpmZ2VlZ2tqZ2Zn
|
||||
amVoa2tvZ2ttamxpamlmZmdoZ2dnZ2traWZmaGlpa2loaGdmZ2ZoZmRnZ2ZmZ2Vl
|
||||
ZmJiZWBhYmBhZGBhX2BfXVxfYmJkZF5dY2JjYWNhY2BgXl5gXl5dXl5cXFxgZGVh
|
||||
Xl5eXlxeXl5iYl9fYF9iYWFhZWRkY2RgX2BhX19gY2VlZWRkZF1gYV9bWV1dWVxX
|
||||
WldXVlZVU1BQUE5QUU9SUU5NUE9OTk9NT1FRUk5PUVRUUVJSVFVYWVpXVldVVlRV
|
||||
V1dZXl9bW1pYWVhaXl9gXl5bYGJhYWFhX19jZGZmZGJgYF9eX19fYWRmX2RgYWBe
|
||||
XmFhYWNhYmBeXV5eW1xdYF5dX2NiX19hX11dYmVoY2RlZWFeYF5fXV5hYGFgYF9i
|
||||
Y19dXl5dYGNgXFZbXlxZWVxhYl5gYF9cXV1cXFxdX19gYVxZW11dX2NjXF5eXF5e
|
||||
Xl9eYGJfXl9eW1xcX11ZW1xdW15eW11gXl1dW11cX15dXl1cXF5iX2BgYV9iYmJf
|
||||
XF1mY2NiamZiYWNiY2JiYmVpbGdkYGBmY2VoY11dXFxcX15iYmFiYmBeW19hX19h
|
||||
XV5aYlxZWlxcW1xcW2BfW1hZXF5cXVtcXlxbWldYW1xcXVpYWFlYWllbW1paWFpe
|
||||
XFtYWFdUU1ZVWFhVWFteWFdYW1pYVlhVU1RVWVZXVVdXVVFSU1ZWVFNSVVtSUlJT
|
||||
UlNUVVVWVVVWVVJWVVVTVldXXFlXVVlbVVNUWVtXWVtVVVZVWltZWltYVVVZWVlY
|
||||
V1ZXWVVUV1dXWl1dW1tcX1lZWl5cXVtcWVVXXFxZXVxZVVRUWVlcWVZWWFhaWFtd
|
||||
WV5YVlZZWVxbXFxdXFtbXl5dXVtbWV5dYF9cXl9eXF9iXl5bWlhbWltZWFpgXlpa
|
||||
W15iXF1jYVtcYGBfXVpbXFxcWlxbXFtZXFxaWllaXl1aW11gXV5fX19fX19hXl5f
|
||||
YGFgYWBhXmBiXlxfXFtcXmBgYmJkYWJgYmNgYGJiYWBfX19jZWBeYWJgYFxcY2Vj
|
||||
ZGJfX2JiYWNmY2RjYmFhYWFjYWNpZmNjZ2ZkZGBiYmVmZ2VjYmNlZV9iZWhlZWJi
|
||||
Y2JmZWdoZWVoZmdrZ2VmZmhmZGRkZ2VmZmVkZmppZmVnaGhqamhiZmZnaWdnamZm
|
||||
ZmtubGtpZWhna21rZmRpaWVlZ2l0bGtrbG1obmdmamZnaGVkZGNobYekwePx+///
|
||||
////////l2pzdnh3fHt8enp5fnl2d3Vyc3d5eXd1d3d3eXx+eHp3eHR0d3d6enl1
|
||||
dHNzc3d1dXNwcHJ0c3Byc3V3eXVycnZ5enl3dnh3dnJxdHZ3dXh8eHl1dXZ3dnZ1
|
||||
dHV0ent2dXl3dXV1d3h3dnZ3enV0d3d0dXN3dXZ1dnd3d3h6eHZzc3JwcnN0dHJy
|
||||
cXFub3FycW9vcHBvbGxsbXFzcHF1c3N0dHR0c3Bvc3N1cnFvcW9tbXFzcm5ub3Bw
|
||||
b21ucXBxcXBvc3Bvbm5sa25sbW1vbnJ0b2trbWpqbGtsbnFxcG9vbm1xbm5tbGpp
|
||||
amtqbm1rbW9sa21taWhoZmlqaGlramxqaWdraGdqaWluam9ua2psamhkZmxpaWpq
|
||||
aWVlZWdnaGZjY2RpZmZnZmZmZ2ZnZGFhZWNgZGJhY11dXV5hXF9lZGRiY2JhYV5f
|
||||
YGZgYF5fYWJgYmBgX15gZF9eYF1gYlxeYV5fYV5eYF5gYWJkX2JhZGNlZGJjYmFh
|
||||
YWNgY2VhZGZkY2JgYWBjY15fXFtaWllaXFlYVlNRUVNTUU5PUlNSVlRPU09PUVJS
|
||||
U1FNT1JVUk9RU1NRU1NSVFRWVllWWFtXWFhaWlpeXl1hYV9cXV5fXl9gXmFgYGBh
|
||||
ZmJjYmJjYV9fX19dYWFiZmRiYWBeX2FcW15fYWBfXmNkX11cXF1cXVxfYl9hYWJd
|
||||
X2BhY2JjX2BkZGFgYWFfYWFgYF9eX2JiZGVjY19dYF9eXV1eXF9hXmBeXF1fXV9b
|
||||
XGFhY2FkX11dW1peXl9hYWJgX19jYV5dYGFgYGBdWV5cXV9hYGBcX2BhYF5gZWBb
|
||||
X19dXWBeXl1eYWNhXl1eYGFhYGFgYWFhZGNiZGZoZWdnZWNgXWFhX2NlY2NjYGBl
|
||||
Y2NjY11bXl9eXmBiYGFgXF9kYF5iYF9iYl9cW15aWV5fXFtaWVpdW1xfYGBfXV5d
|
||||
XFtcWlhXVlZWWFhYV1ZWV1daWlhbWlpcXFhaWFdYVldYWFlZWWFYWltYWVhSVFdV
|
||||
VlpWV1RYV1VTVFRYVVRWU1RUVVhWVVRUVFZXVFVXV1VWV1ZYV1lcbltbWV5ZWlpX
|
||||
V1VSWFtfW1laXV5bWFpZWlpYWVhYW1hYV1daWVlZV15dWlxgXVpZWV1hXFpbW1dY
|
||||
WlpZVldXWlpWVlZXWlhaWVlZWVpZW1xbWltcWVhaXVxdWVxZWVtaX2BfXFlaWVte
|
||||
XV5dXV9eXF9bW1xbXl9hXFdcXlxbWVpbXFpcWF1gXV9gYF9aW11cX15dX19gXFtY
|
||||
WVtZW1tdXWBiYWBfXV5cXV5dX15eXV1iZWRhYWFiYF9eYmBeXV5dYWBdXWBlY2Fh
|
||||
YWRfYF9hY2RhZGJjZGZjYmJfYV5fZGJkYWBgYGBjY2RlaGNhY2BjYF9eYWJgY2Vk
|
||||
Y2JlZWRhYmRlY2FjY2RjY2RjY2NjYWBkY2NjZGVjYWRnaGhramtqZmdnZmhoZ2pn
|
||||
aGhoZmhpa2lpaGhoZ2hlZmdqaGZsbWhpamlqamppa21qaGhmaGxqZWVra25sbW5p
|
||||
aWhraWprbW1pZ2ZoZ2hsfKXG4/D7//////////+UbnR5e3t6eHmAfH58eHZ2dHd2
|
||||
d3x3dHZ2dnl4eHt8fHh4dXVydXR3eXd2dXR4d3Z1dXZ1dnhydHd5d3ZzdHV4dXR2
|
||||
eX13dnV2dHN1eXh4eHd3dnd2d3Z3dXZ3dXZ3eXh5dnR4eHV2eHt8e3l1d3d1dndz
|
||||
dXV2d3Z1eHh0dXR2d3V0dnNxcXFvb29yc3FucnJycW9ycnBvbG5ycXF0cnNyc3Nz
|
||||
cnFydHFvcHFycnNucXJvb3FzcHBxc3NxcG1ucG9wb3NxcXJwa2xtbXFwbnJtbnFv
|
||||
b25uamtqbG1scHJwa25tbXBycG9tbW5vbnBvb2xtb2xxbmtsbGtpamtrbGtnamlq
|
||||
a2pnaGhmZmptaGhoaGxqaGhpaGhpaWlpZmVkZWdoZ2lmY2RgYmhmamdlamdhYWNg
|
||||
X2BgYmNhYV1eYWFmZGRkZF9cXWBgX19fY2NdYWFiYWJhXl5kYWJhXF5eX19hYmZi
|
||||
Xl1gYmJiYV5iY2FhYmRhX2BlYWFiY2FfYWJhYmRjZGJeYmNmZGBhYmFaWVpaXFtZ
|
||||
V1ZUU1NSVVVXWVNSUE5NT1JPTk1NT09OUlVOTk1PU1NRU1JTVFRRU1NWV1dXWlhb
|
||||
W19bX11cX15fXFpeXV1dXV9fX15hYGBhZWJhX2FhYGBeXmFmZmJhYV9fYWFeXl1b
|
||||
XFxcXWJgYGFgXV5eW1peX2BgYF5iY2RiYV9gYmFhX2BhYmNiYWBhYWJfYWFfYF1f
|
||||
YWBgY19fXV5kYVlcX2FgYF1eW11gX15dXGBgX11hXltbW1teX2FdX15cW11cXF1e
|
||||
X2BfYGRmW1tfYFxeYWNiX15dXmBcXF5gX2RfW2BjYmFhY19bWl9hXl9hYmBeYWVk
|
||||
YmRiYmNjY2NjY2FjZGNgZGJjYmBfX19eYmJeXl1eXF5gXV1dXV1cXFtbW15fXV1e
|
||||
XlxdW1xeXmBbWVpYVltgYF5dXV1eWVlbW1xZVlZVWFhcXl1aWllWWllbXVxbWFha
|
||||
WFpbW1lZVldXVVZdV1daW1hYV1hVV1hTV1VUWFlXVVNVVVJSVVVWVlJWVlZWVFRW
|
||||
U1VVUlVUV1RWUlJYVldXVFdcXVlYV1JQVVlTVVZXV1ZTU1dYV1VUWV5bV1RWV1pY
|
||||
WFlbWldZWlpaWFdZXVlcXlpcXFlcWltfW1hZWltZXVteWFRSV1hZWlpZWFhXWFla
|
||||
WFheWVtZV1laW1tcWFlcXF1eXVtYWlpbXF1dX1xbWltcXl5hYVtZWl5ZWVxeXV5d
|
||||
XltaVlhaWVxcW1pbXV5eXlxdXV9eWllbW1tfXlxeXWBeXGFeXl5gX2BfXlxgY2Ji
|
||||
YWFhZWJgXWBfYV9dXl1cX2BeXl9eXFtcX19gX15hY2NgY2NnZWFjY2FkZGJjZGJi
|
||||
Y2BhYmNkY2NhYWJjZWJiYGJkY2BhZWVmYmRkZmVmZGNiX2FkZGNkZGJjZWRlZGJi
|
||||
YmRjYmhjYGJmaGlmY2NnZWhlaWtramhmZmZqZGhpaGZnZmRnaGloZGhqbW9tamdp
|
||||
bGtubGlsbmxpbW9wbGtra3ZoZGdpamhnZmhpaGhtbW1ra21qaGt+psnk8Pr+////
|
||||
/////3ZnbnV6fHh2eHp7fHx6d3h3dXV6eHd5dXNzc3h5eXl1d3d3d3h2dnd0dXR0
|
||||
d3h5eXh6dnV1cXR1dHV1dHR2d3h3d3p4enp5c3Z3dXV0dXl4dXV4eXt5dnZ0dnp5
|
||||
eHZ4dnd1dnNzdHJ4fHx8eX16eXh2dnR0dHV2eHV0eXRycnB0cnNwc3dzb3FvcXNv
|
||||
b3Fyc3Bxc3JwbmxucXJycnRzcXBwdHV1dnVzdHJvcnFycnZxcXFxcXJwb3BvcXRw
|
||||
bXFvbXBubGpwcXFtbG5ub25xcW9rbG1tbGxta2xrcnRxcm5qaWxra25wb3Byc3Zw
|
||||
b2xsbWtub21ra2xpam5tbG9ybGxrampramlpbHVza21maGxqaGhnaWxrbHBsa2tp
|
||||
amhnZ2ZmZWViYGNjZmRjZWRoZ2VhX2JjY2JiYGFhYGBfY2dnY2FiY2BiX19fX2Fh
|
||||
YWJgY2JjYGFgYV9dXF5fYFxfYWJkYmJeX2BiYmFiYGFkZGJfX19iZGlhYGBkZGJj
|
||||
YmRlZWRhYWBhYmBcXV1dXVxbW1xbW1ZXVFBXVFNUUFRUUk5RVldQT1FPTkxMT1JR
|
||||
UFFRUFBRU1NRUFBRU1RRUlRVUlNWWFhaWV1eW1tdX2BgXllYXV1bXWBgZWNgYV9g
|
||||
X2JfX2JlY2VmZ2RmZWZiYl9fX19hX2BeW15hYF9dW15gYWRiXVlbXF9hYmNjZWBm
|
||||
YmFdY2RkYWFhXV9gZGFhY2JeY2FeXmFgXl9iYl5dYGFcX15dYF5dXVpZXGBfXl1d
|
||||
W19gYF9cXF1cXl1bX2JeXl9aW11cXF5fYGBhY2ReYF9dYWFjYmFfXlxcXVtdXlpe
|
||||
X19lY2NgYWBeYmJdXl1hY2JiYl5fYGBhYmRkZGJjY2JjYmJiYGFiYmBfXV5eXV1g
|
||||
Y2VgX1xbW1teXVpZW15fXVxeXVteW1lZW1pcXFxfW1tZWmBeWl1eXV1eXlxYWlxc
|
||||
WlhZWFlYWFdbWltdWVlZXFlaW1xaWFdYXFtaWFhYVVZZWVhYWVdWVVZZWFxXW1lU
|
||||
WVhVU1dXU1JVVVZYWVlaWllYWVZWVldWV1hWVlhXXllYV1ZYVlZVW1lYWFRUU1RX
|
||||
VlZYWVlYWFhTWFZYW1xaW1lYWVtZVVZXWVpXWltZXFxaWFpXWV9fWltYVVhdWlla
|
||||
WltZV1hYWVxbV1hWWFxbWl1cWlddWVlbW11aV1daXFlZW1xbWlpeW1pdW1lXW11e
|
||||
W1tbXFhaXl1bX19cW1tcXF5cXF1aV15eWlpbWl5cXlxcWltcXFxbWlpcXFxdXV1i
|
||||
X1tcX11gX2BhYWNhYF1eYmJfXmFnZWBeX2JeX2FfX2FjYWNeX2BfYmRkYWBfXl1f
|
||||
YmNgX2BiYGFhYmNmZmZlZmRjZGVlZWZkYF9kZGNfXl9gX2BjZWVlYmJhZGJlZGJl
|
||||
Y2JkZmRjY2ZnZGVkaGZlamJiYGRlZGNhY2hoZGNiaGVpZmtpZmBkZ2plYmRnaWdl
|
||||
ZWdpZGZnaGdkZGlta2pqaGlnZ2RoamlmZ2pta2lqa2tqbG1sbGtqZmtsamhqbGlr
|
||||
aGloa2dnbmpwZ2lra3uly+Hv+P7/////////cHR9e3x6d3Z3eX16eXh3d3p6dnh3
|
||||
e3l0dnVxc3Z3dnd5dHV2eXh1c3N0d3Z4eXl8fXyAenl4c3RzcnJ2enZ2dnV0dnl+
|
||||
e3d0c3V2dXR4eHh2dnZ1eHZ2dHh4d3V3dXR1dnZ1dHR0dHd3eX97eXl2d3R1dnd2
|
||||
dnd5c3JzdXJ1c3Z3dXZ2eXRwc3FycHBwbnBvbnB3dXV1c3RwcW9ydXJzcnR3eHZ1
|
||||
eHR0dXRzb29wc3FwbXBtb21ubWxtcnNxbm1rb3Fubm9ubm5vbmlqbmxpamxvbW1s
|
||||
bm9vb3FycHJsamtra21rbW1vcG5xb25tbGlpbWttbmxsbGxpa2hoamtrbWxqamxt
|
||||
bW9ub21rbnBoamdlZ2ppbW5tbW1vbmxqZWdmY2VlZGNjZWZlYmVjZGBiZGBfYmJp
|
||||
Z2NkZWNgX2NjYmNhX15lZWBdYF5iXVxbYWBgYmJgYF5gX15cX19jY2BeXmBfYGJi
|
||||
YV9gYmFfYWJjYF5gY2RiX2FdYWJlZGRkZWVmZ2NhX2FhXmNiXVtcXV1dXVxaWFZX
|
||||
WFVUUlNTU1VTVVNVT05QUFFNTU5MTU9RT1JTUFBRU1BRU1VUVVVTU1NWVFZaW1pY
|
||||
WlpaX11eX15cXVxdXlteXF5hZF9fX2BiYWFgXmBhYmJiZGVkY2RjYGBfXWBiXVxg
|
||||
YWJhX19jYF9hYGFfXFpbXWJjYmFgYGFiYmNiY2VhXV9fZmNkYWFiZGNjYF5cXVtb
|
||||
Xl5eX2RkZF9eXF5dYF5hXlxbXFlYW2FiY2JfYlxZXl5dXV9dXV5gXl1cW1tbWVpd
|
||||
Yl9fYl9eY2FdXV5eXlxdXFtbXmBgYGJiYmhlX2FeXl5fYF9fX11fYGBiYGFiYWFl
|
||||
Y2NiYmBiYWJnZ2FfY2NgX2JkYmNlYl9fYFxdXV5fXVxZWlpdXF1cYF9gX19eXlla
|
||||
XWBiXlxYWFxcXVtdXFpfXmFgW1lbWlpYW1pbW1tZWFtdYF1aWVpZXWFfWFZUVlZX
|
||||
WVtaWFZWWVZUV1dYWFVUVFZVWFxcXVtaW1hWVlVUU1ZXWVhbWFlWVFhaW1lYVlVU
|
||||
V1pYVllZWFdaW1pYWFtVVlpcWlRUWFdXWVlWWVtbW15YWVtbXFtXWllWVVdZVlZY
|
||||
V1hZWFlYV1daVVZZV1tcXF5cW1paWVheXl5dW1xcWVpbWFhXWllYW1hZXlpWXFxc
|
||||
W15aWVpZWllZW15dWlxbW1lbXVxaXF5cXFpaWlpbXVtcXFxcXl1aWFpcYWNfXFxc
|
||||
XF1dX2FaWVtaWVpbXVxbVltaWVpfXF1cYWBeYWFeX19dX2FfXmBfX2NqZGFfYGJg
|
||||
YGBjY2VhYGFmZGFgYWJgYV9eXl5fYmNiYWJiYF9eX15gYGBiYGFjZGNjY2JjZmdj
|
||||
ZGFhX2JfYGJhY2RjYWRjYmNiZGBkZmZmZWRkZmVmZmVlZGlmZ2lpaGZmZWdkZWRl
|
||||
aWhjY2FjZmNmaGlnZmtqZ2dkZWdkZWVkZGdkZ2hpamhoZ2ltZmZnZWVlY2dpamtr
|
||||
a25wbWppbW9vcHFxb2xxbGxva2xoamlpaWprbGprb21mZ2h3gqDN4u/3/f//////
|
||||
//9ueHx9fnx5eHl8eXp7fnl4eX14e3l5d3l3dHV0dXZ4dHZ1c3N0dXRzdnR3eXd4
|
||||
dHV6e359eXd4dnZ5d3d3dXZzdHZ0eHh3d3h3dXh1cnB0c3R2d3Zyc3R4enp3eXh4
|
||||
dnd2d3p7e3x6dXh2eHd2dHd5dHR0dXd5d3V0dXR1dHRzdnZ3eHhzdHd4eHJxbmxu
|
||||
b29wcnJzdnV0dXBydnNxcHFwcnV2dHd1dHV3dXRycnRzdHFtb3FxcXBubm9wbG9w
|
||||
b29vbnFycXBsbW1xc3Jtbm9ubW9ubWxtb25wdG9tbm1wcWttbW5sbWtwbnFsamps
|
||||
bGtoaWtvcW9tbGxsa25vbWtoaWtsa2psa2tpbWxqbGloZ2loaWtsbG5tbGxraWlq
|
||||
a2lnZWVlY2JiYGJnY2JkZV9hY2JjYmBga2dhYWNkY2ZkYWBfXmBgXlpdYl9bW11h
|
||||
ZGRhX19fXGFcXWFfX19hXmBhYGBiZGZlY11cXWNkY2ZmYmJgXl9eXmFhZGFjY2Nm
|
||||
Z2hmZGJjYl9eYGNhXl9eXFpcXVxbXFhWU1FRUlNSUE1OUFFNTE1NTUxPT0xKT1JY
|
||||
U1JSUE9SVFZTUlJTVVdZWlhZWlhZWVhdXF9hXV9cXVxeYl9dYWBdXV9gYl9fXmBg
|
||||
ZGNfX2NjY2NkYl9jYGFjY2FfYV5gYV9gY2JhYV9lXWBiXmFjX2BfXV9eXF5dX2Bf
|
||||
ZWNkZWhmX19dYF9jYmFfY2NhXF1dYV1dXFxdXl9gYGFdXGBeXmFhXFtdXVxcXl5g
|
||||
YmFeXVtcYGBcXl9dYFxfXl9fXl9eXV1eYWBeXVxdYGNhX2FfYWFgYV9eYGNgYWJj
|
||||
X19gX11cXl5dXl5hX19hYWFkZGJiZGNiYmJjYWFjY2FfXmFkY2RlZmdhX2BhXmBi
|
||||
ZGRiY19dXVxZXF1eXV1gYV9eYl5hX19eX2JdWl1cXVxcXmFeXF5eXV5bXmBkXFla
|
||||
WFtbWltbWllbW1hbWVlZWltZW1hXWFdaWlpZW1tVVldYV1ZXWFRWU1NWV1hYWVpY
|
||||
V1hWVlRTV1ZXVlVTUVNaVlVUWFdVVVNUWl5bWldYWFpbWlhZV1ZYVldcWltaWVdY
|
||||
WVdVV1lbW1hXWFpXVVZWVlVUV1dZVVVVVVZVWFpXVlhaWlpYWFtaXWFdWllZWltb
|
||||
W1pbW1lYWVxZWFhUVlhZXF9bWVtYXFxcW1pdXV5YWFlXWltcWldaWVlbW1pXV1pa
|
||||
W15hXVxgXVlZW11aW1laW11bXF1ZWmBcXFxdXF9cX15aWlpZXFteWl1gYl9hW1la
|
||||
Xl1eXV1eXV9dXl1dXV9hYGFhX11dX2BgX2RlZWNlYl9hYWNgX2BfW1tdXV9iZGJg
|
||||
YF9gYGNiYGFjZ2FgZGFgYWVhY2ZkZWdgYGBmZGFgYWFiYmBfY2RlZWRkZGVkYmVn
|
||||
Z2RnamdoZ2VjY2ZnZGJiZmplZmVlaGNkZ2ZmZWFiY2ZmZ2trbGtpZ2hqa2xqaGZn
|
@@ -1,120 +0,0 @@
|
||||
5eXl5uXk5eTl5eXl5eXm5eXl5eXl5ebl5ufl5efl5ebm5+bm5ubm5ebm5ufm5ufm
|
||||
5uXm5+bl5+bl5ufm5+bm5ebn5ufm5ubn5+bm5+bm6Ofn5+fm6Ofn5+jn5ubn6Ofn
|
||||
5+fm5+fn5+fn6Ofo5ujo5+fo5+fn6Ofo6Ojn6Ojn5+nn5+fn5+jn5+fo5+fo6Ojn
|
||||
6Ofn5+np6Ofo5ufo6Ojn6Ojn6Ojn5+no5+bn6Ofn5+fn5ufn5+fo5+fo5+fm6Obn
|
||||
6Ofn5+jo6Ofo6Ojn6Ojo6Ono6eno6ejo5+jo6Ojo6Ono6Ono5Ofo6Ono6ejo6Orp
|
||||
6ejp6enp6Ojo6Onq6Onp6ejo6eno6enp6eno6ejp6Onp6enp6unp6eno6Onp6unp
|
||||
6ejp6enq6ejp6unp6enp6Ono6eno6uno6enp6Orp6enq6uno6unp6enp6erp6Orq
|
||||
6Onq6eno6unp6unp6urp6urq6enp6urq6uno6urp6erp6erq6urp6urq6erq6uvr
|
||||
6erq6enq6ejq6urp6uvr6erq6urp6unq6unq6Orp6+nq6unp6err6unp6+rp6urp
|
||||
6ejq6erp6enp6erp6erp6eno6ujp6unq6+rq6urp6+vq6uvr6urq6urp6+rq6urr
|
||||
6+nq6unq6urq6uvr6+rq6uvr6+rq6uvq6+rr6urr6uvr6+vr6+vq6+vr6+zr6+vr
|
||||
6+zr6+rr6uvr6+rr6urq6+vr6uzr6+zs6+zs6+zr6+zs7Ovr7Ozr7O3r7Ozs7Ozs
|
||||
7e3s7ezr6+3r7Ozs7e3t7O7t7O3t7ezt7u3t7u3t7u3t7+/t7e7u7+7u7+3u7+7v
|
||||
7u7u7u7v7+/w7u/v7/Dv7+/w7+/v7u/w7+/w8O/w8PDw8PDw8PHy8PHw8PHx8PLx
|
||||
8fLx8vGVjoV7dW1kYmJYVlRVVFRWVldZW1xdYGJjZmlqbG5wcnZ3en1+gYKFh4qL
|
||||
jY6OkZKTlJaXmZqdnqGjpqipq6yur7Gxs7S0tLa2uLm5u7u9vr7AwMHCw8PDxsbI
|
||||
ycrJy8zNz8/S09PU1dfX2dnZ2dja2tra2tvb2tra2tvb29rb3Nzd3d3d3t/e3d/f
|
||||
3t/f39/f197f39/f3+Df39/e3t7e3t/f3d7d3t7e397e39/e3uDg4ODg4OHh4ODg
|
||||
4d/f3+De3uDf39/g3d7d3Nza29va2tja2tnZ2NjW1tjX1tbW1tXU1dXV1dXV1dXV
|
||||
1dXW1dTT09PS0tLS0dHS0NHR09PS09LT0tTU1NPT0tPT09TS09PT0tLR09PT09PT
|
||||
09TU1NTU1NTU1dXV1dXU1dXV1dXV1dXW1tXX2NfX19fX2djZ2dnZ2drZ2tvb2trb
|
||||
29vc29vb29vc3Nzd3N7d3d/e3d7e397f3t7e39/f3uDg3t/g4OHg4ODh4d/h4OHh
|
||||
4OHh4eHh4eHi4uLi4uLj4ePi4+Li4uPj4+Pi4uPj4+Pj4+Ti5OPj4+Xj5eTk5OTk
|
||||
5OXj5OTk5OTk5OTk5OTj5OPj4+Tk5OTj5uXl5OXl5OTl5eTl5OXl5ebl5ebk5eXl
|
||||
5ubk5OXn5ubl5eXl5uXl5+Xk5eXl5ebl5ebm5ubl5uXm5ufn5uXn5ubn5ubm5+fm
|
||||
5ubl5ubn5ufm5ufm5ujn5ubn5+fn5ufm5+jo6Ofn5ubm5+bm5+fn5ufn5+fo6Ofo
|
||||
5+bn5+jn5ujn5+fn5+fo6Ofo6Ojn6Ofo6Ofn6Ojp5ufo6Ojo6ejn6efn6eno6ejo
|
||||
6Ojo5+fn6Ojp6Ojo6ejo5+no6Ojo6Ofo5+fo6Onp6Ojn6Obn6Ofm5+fn6Ojn6Ojo
|
||||
5+jo6Ojo5+jo6Ofo6Onp6Ojo6Ojn6Ojo6Ojo6eno6ejo6enp6Ojp6ejp6unp6Onp
|
||||
6enp6Onp6Onp6eno6Ono6enp6enp6Ono6enp6OXp6Ojq6ero6unp6unp6enp6unp
|
||||
6unp6eno6enp6urq6enp6enq6unq6enp6erq6urq6unq6unp6Orp6enp6erq6erp
|
||||
6erp6urq6urq6enq6+rp6urq6unp6ujp6unq6enq6evq6unq6unq6uvq6unq6urq
|
||||
6+vp6ujq6unq6urp6unq6unp6+rq6evq6urp6unq6+rq6urq6erp6urr6+nq6urp
|
||||
6unq6+nq6erp6erq6erq6erp6urq6urq6evq6enp6enp6ero6unq6+nr6urq6+rr
|
||||
6urq6uvr6urq6+vr6+vq6+zq6+vr6+vq6urr6+rr6+vr6urr6urq6+zr6+rq6+vr
|
||||
6+vr6uzt6uvr6+vr6+vr7Ovs6+vs6+zs6+vs6+rr6+rr6+vr6+vr6+vr6+zr6+zt
|
||||
7Ozr7Ovr7Ovr6+zt6+zs7e3t7O3s7O3t7ezt7O3t7ezs7O3u7ezt7O3s7u3t7e3u
|
||||
7ezu7e3u7e/u7u3u7+3u7u/u7u/v7u/u7+/v8O/v7+/v7+/v8PDv7/Dv7+7v7/Dx
|
||||
8PDw8PDx8PHv8fHy8PHw8fDx8fHw8fHy8vLy8qOdlpGLhH56dXRycHFxcnR1d3l6
|
||||
fH+ChIeJi42PkpSWmZyfoaKmqKqrra+vsLK0s7W3uLm6vL2+wMLExcfGyMrKzczN
|
||||
zs/OztDQ0tLT09TV1tbW1dfY2NfY2dra2trc3Nzd3N7e3t7e39/f39/f4ODg4ODg
|
||||
4eHg3+Hh4eDg4OHg4ODh4uHh4OHh4uHh4eHj4eHi4OHh4uHi4eDh4eHg4eHh4eHi
|
||||
4eHg4eHg4eDi4eLg4eLj4+Li4+Li4+Hi4eLg4eHh4uHi4uLh4OHg4eDh4N/e4ODf
|
||||
4ODf397e3d/f3d7f393e3t/d3t7d3d7d3d3d3d3d3tze3d3c3tzb3d3d3Nzc3N3d
|
||||
3d3e3d3d3d3d3d3d3t7e3tze3d3e3d3e3dzf3d7e3d7d3t7d3t7e3t7e3t7e3t7f
|
||||
3eDg3+Df4N/f4ODf4N/g4N/g4ODh4OHh4eHg4eDi4eHi4OHh4uHh4uLh4eLi4uLj
|
||||
4eLj4uLj4+Lh4uPj5OLj5OLj5OPk4+Tk4uPj4+Tj4+Ti5OPk4+Pj5OTl5OXj5OTj
|
||||
5OPk4+Tk5OXk5eXl5eXl5ubm5eXl5eXm5uXk5eTl5ubl5eXk5Obl5eTj5OXl5OTl
|
||||
5uXm5ubl4+bl5uXl5ebk5uXl5eXm5uTm5ubn5ubm5uXn5ubm5ufl5ebm5uXm5+Xm
|
||||
5ufm5+fm5ebm5ubn5ujn5ubl5ubn5ufn5ufn5+fn6Ojn5+fn5+jn5+fm5ufm5+fo
|
||||
5+fn5+nn5ufn5+bm6Ofm6Ojn5+jo6ejn6Ofp6Ojo5+jo6ejo6Ojn5+jp6ejo6Ojo
|
||||
6eno6Ojo6Onp6efn6ejo6Ojo6ejo6enp6Ojo6ejo6eno6ejp6eno6ejo6Ojn6Ono
|
||||
6Ojp6enp6Ojp5+fo6Ojn6Ojo6ejo6ejo6enp6Ofo6ejo6ejp6Ojo6eno6ejp6erp
|
||||
6Ono6Ojo6eno6eno6enq6erp6uno6ero6Orp6unp6erp6unq6unq6urp6uno6ero
|
||||
6Orp5eno6erq6urp6unp6erp6Onr6erp6+nq6unq6enq6+nq6urp6urq6erp6urp
|
||||
6urq6urq6urq6urq6+rp6+rq6uvq6Orq6unr6urs6urr6urp6unq6urq6urq6+rq
|
||||
6erp6urp6urq6urq6urq6err6err6+rq6+rr6urq6+rr6urr6urq6+vq6uvq6+zq
|
||||
6urr6uvr6+vq6+rr6urr6uvq6uvq6uvq6+vr6urq6err6evq6uvr6urr6urp6urq
|
||||
6+rq6unp6urq6urq6urq6uvq6urq6+vr6+vr6+vr6uvs7Ovr6+rq6+vq6+vq6+vq
|
||||
6+vq6+vr6urr6+zq6uzr6+zr6uvs6uvs6+zr6+zr6+zs6+vr6uzs7Ozs6+vq6+zr
|
||||
6+zs6+zr6+zs6+zs7Ovr7Ovs7Ovs7Ozs7Ozs7Ozs7O3s7Ozs7Ozt7O3s7Ozs7u3t
|
||||
7e3t7O3t7e3t7e3t7u3u7e3u7e3t7e3t7e7t7u7u7u7u7u3v7u3v7+/u7+7u7+7w
|
||||
7+7u7u/w8O7v7+/w8O/x8PDv8PDw8fHw7/Dv8fHx8fDx8fHx8fHx8fHw8fHx8vLy
|
||||
8vLxs6+qpqGcmJWRkI6Oj5CQkZOVl5mbnaCipKepq62wsrS2uLu9vsDDxMXGx8jI
|
||||
yszNzc7P0NDS0tLU1dXY2NjY2dnc3Nvc3Nzc3Nzd3d3d3t7e397e4N/f39/g4eHh
|
||||
4OLg4eHh4eHi4eLh4uDh4uHi4eLi4uPi4+Hh4ePh4uHi4+Lh4uLj4uLi4uPi4uLj
|
||||
4uPi4uLi4uLi4+Pi4uPi4uHi4uPj4uLj4uLi4uPh4eLi4uLi4+Li4+Pj4+Li4+Pj
|
||||
4uLi4uLi4uPi4+Lh4uHi4uLi4uPi4eHi4eDh4eHf4eHh4eLi4OLh4ODg4eDh4eHh
|
||||
4eDh4eDh4eLf4eHg4N/h4ODi4ODg4OHh4eDg4OHh4eDh4uDg4uHi4eLg4OHh4eDh
|
||||
4OHg4uHh4eHh4eDg4eHi4eHi4eHi4eLh4uLi4uHi4uLi4uPj4uPj4uHi5OPk4+Pj
|
||||
4+Pj4uPk5OLi5OPj4+Pk5OTi4+Pj5OPk5OPj5OPk5OPk5OTk5OXk5OTk4+Tl5eTk
|
||||
5eXk4+Tk5OTk5OXk5OXl5eXk5eXm5eXk5OXk5uXl5ebl5uXl5ubn5eXm5ubl5ubm
|
||||
5uXl5eXm5uXm5uXl5eXl5eXk5eXm5uXl5ubn5ubl5ubl5+Xm5ubm5ubn5ubn5efm
|
||||
5+fm5ubn5+fn6Ofn5+fm5ufo5ubn5+bm5+fn5+fn5+fn5+jm6Ofn5ujn5+fn5+fn
|
||||
6Ojo6Ojn6Ojn5+jo6Ofn6Ofo5+fn5+jo6Ofo5+jn5+jn5+jn5+jn6Ojo5+jo6Ono
|
||||
5+no6Ofo6Ojo6Ofp6ejn6Ojo6Onn6Onp6enp6eno6efo5+jo6Ono6Ojo6enp6Ojo
|
||||
6enp6enp6Ojq6Ojo6eno6Onp6ejp6unp6ujq6unq6enp6Ojp6Orp6Onp6enq6enq
|
||||
6eno6Onp6eno6ejp6eno6Onp6erp6ejq6eno6erp6enp6enq6urp6Onq6unp6urp
|
||||
6+nq6enp6enq6unp6erp6+nq6enp6unp6enp6erq6unr6uvq6erp6+rp6erp6unq
|
||||
6urq6urp6urq6err6uvq6urq6urp6+rq6uvr6uvq6+rp6urq6urq6uvp6+nq6urr
|
||||
6unq6+vq6+rr6urq6urq6uvq6urp6urq6urr6urq6urq6urr6+rr6urq6uvq6urr
|
||||
6uvq6erq6uvr6+rr6urr7Ovq6uvr6+vr6+vq6+vr6+rq6+rr6+vr6urq6+vr6uvq
|
||||
6uvq6+vq6+zq6uvr6+rq6uvq6+rq6urr6+vq6urq6+rq6urq6uvr6+vq6+rq6uvr
|
||||
6+zr6+vr6uvr6+vr6+vs6+vr6+vr7Ozr7Orr7evr6+rr6uvs6+vr6+rq6+zs6+vs
|
||||
7Ovs7Ozs7Ovs6+zs7Ozs7Ovs6+zs7Ovs7Ovs6+zs7O3s7Ovs7Ozr7Ozr7Ozs7Ozs
|
||||
7O3s7O3s7e3t7Ozr7Ozs7uzt7ezs7O3t7uzs7e3t7uzt7ezu7e7t7u3u7u7u7e7u
|
||||
7e7u7u/u7u/v7e/u7+7v7+/v7u/u7u/w7+/v7u/w7vHv7u/v7vDw8PDw8PHx8fHx
|
||||
8PDw8fDx8PLx8vLx8fDw8fHy8vLy8vLy8/MAEAEAAAMAAAABBJcAAAEBAAMAAAAB
|
||||
Bt4AAAECAAMAAAABAAgAAAEDAAMAAAABAAEAAAEGAAMAAAABAAEAAAERAAQAAAAQ
|
||||
AB+FwAESAAMAAAABAAEAAAEVAAMAAAABAAEAAAEWAAMAAAABAG8AAAEXAAQAAAAQ
|
||||
AB+GAAEaAAUAAAABAB+GQAEbAAUAAAABAB+GSAEcAAMAAAABAAEAAAEoAAMAAAAB
|
||||
AAIAAAFTAAMAAAABAAEAAIdzAAcAAASkAB+GUAAAAAAAAAAIAAH9gQAD+voABfhz
|
||||
AAf17AAJ82UAC/DeAA3uVwAP69AAEelJABPmwgAV5DsAF+G0ABnfLQAb3KYAHdof
|
||||
AAH9eQAB/XkAAf15AAH9eQAB/XkAAf15AAH9eQAB/XkAAf15AAH9eQAB/XkAAf15
|
||||
AAH9eQAB/XkAAf15AAGq2yWAAAAAIAAAJYAAAAAgAAAAAASkYXBwbAIgAABzY25y
|
||||
R1JBWVhZWiAH0wAHAAEAAAAAAABhY3NwQVBQTAAAAABub25lAAAAAAAAAAAAAAAA
|
||||
AAAAAAAA9tYAAQAAAADTLWFwcGyYcjd2/nI/x5EwPxA3BfUzAAAAAAAAAAAAAAAA
|
||||
AAAAAAAAAAAAAAAAAAAAAAAAAAVkZXNjAAAA5AAAAEF3dHB0AAAAwAAAABRrVFJD
|
||||
AAAA1AAAAA5jcHJ0AAAEYAAAAEFkc2NtAAABKAAAAzZYWVogAAAAAAAA81EAAQAA
|
||||
AAEWzGN1cnYAAAAAAAAAAQHNAABkZXNjAAAAAAAAABVTY2FubmVyIEdyYXkgUHJv
|
||||
ZmlsZQAAAAAAAAAAAAAAFVNjYW5uZXIgR3JheSBQcm9maWxlAAAAAG1sdWMAAAAA
|
||||
AAAADwAAAAxlblVTAAAAKAAAAw5lc0VTAAAAMAAAAYpkYURLAAAAPAAAAjZkZURF
|
||||
AAAAOgAAAeJmaUZJAAAAMgAAAMRmckZVAAAALgAAATBpdElUAAAALAAAAuJubE5M
|
||||
AAAAKAAAAnJub05PAAAAKAAAAbpwdEJSAAAALgAAArRzdlNFAAAAOgAAAPZqYUpQ
|
||||
AAAAGgAAAV5rb0tSAAAAGgAAApp6aFRXAAAAEgAAAXh6aENOAAAAGgAAAhwAUwBr
|
||||
AGEAbgBuAGUAcgBpAG4AIABIAGEAcgBtAGEAYQAtAHAAcgBvAGYAaQBpAGwAaQBH
|
||||
AHIA5QBzAGsAYQBsAGUAcAByAG8AZgBpAGwAIABmAPYAcgAgAEIAaQBsAGQAbADk
|
||||
AHMAYQByAGUAUAByAG8AZgBpAGwAIABHAHIAaQBzACAAZAB1ACAAUwBjAGEAbgBu
|
||||
AGUAdQByMLkwrTDjMMowsDDsMKQw1zDtMNUwoTCkMOtjg2PPVmhwcJaOgnJfaWPP
|
||||
j/AAUABlAHIAZgBpAGwAIABHAHIAaQBzACAAcABhAHIAYQAgAEUAcwBjAOEAbgBl
|
||||
AHIARwByAOUAdABvAG4AZQBzAGsAYQBuAG4AZQByAHAAcgBvAGYAaQBsAEcAcgBh
|
||||
AHUAcwB0AHUAZgBlAG4ALQBQAHIAbwBmAGkAbAAgAGYA/AByACAAUwBjAGEAbgBu
|
||||
AGUAcmJrY89O6gAgAEcAcgBhAHkAIGPPj/Blh072AEcAcgDlAHQAbwBuAGUAYgBl
|
||||
AHMAawByAGkAdgBlAGwAcwBlACAAdABpAGwAIABTAGMAYQBuAG4AZQByAEcAcgBp
|
||||
AGoAcwBwAHIAbwBmAGkAZQBsACAAUwBjAGEAbgBuAGUAcsKkzpCxCAAgAEcAcgBh
|
||||
AHkAINUEuFzTDMd8AFAAZQByAGYAaQBsACAAQwBpAG4AegBhACAAZABlACAAUwBj
|
||||
AGEAbgBuAGUAcgBQAHIAbwBmAGkAbABvACAARwByAGkAZwBpAG8AIABTAGMAYQBu
|
||||
AG4AZQByAFMAYwBhAG4AbgBlAHIAIABHAHIAYQB5ACAAUAByAG8AZgBpAGwAZQAA
|
||||
dGV4dAAAAABDb3B5cmlnaHQgMjAwMyBBcHBsZSBDb21wdXRlciBJbmMuLCBhbGwg
|
||||
cmlnaHRzIHJlc2VydmVkLgAAAAA=
|
@@ -1,136 +0,0 @@
|
||||
TUxOT1JVUFNUVlVRT1VYWVdXUlJUT1FPU1VPT01PUE9WVlFSUFJRTkxKTU1PTEtJ
|
||||
R0JDR0RDQEBBQD8/PDs/PD0+Pz44NzY1NjY5ODw5OT08Nzk5ODs8QUNBQj9BQUND
|
||||
QklLSk5KSU9TXlhLT0xWUlFaVFdMTVdVW1VgWVdWXV9dWFtWUlFSTkVERTk1NTUz
|
||||
MzUzNjU0ODg1ODY2Nzk6PTo6P0NETE1JR1RSTFBISkpKVVVLSUpUTU5STVZRVFpT
|
||||
Vk5XXGBYUFhVWFJTV19kXVdVUFdVVlZUW1xbWlhZV1pcWE9TWlRWWVlXUE1MTlJD
|
||||
PDo8Ozo+P0pOTVhWVFJWW15oYFxbXlpUVlpZXFhYVVdXUFlcYFhUVFdaW1RQXVxc
|
||||
XltXUVBSTU1RUVRYVVNNSU1RUFFWVFFST05QUk9OSU5QTk1KS1BVSkxLTE5LT1RO
|
||||
VlRZWlZYVE1FRkVHR0ZLSU9LTlFOXWaJo7CspZ2WlZOJfXFmYmFqdG9eS0E+OTk4
|
||||
ODtBQTw9Ojg5PD5EQT8/P0BAPDc6OEE+Pzo+QENAPDtBQENDRkNDR0A6QEQ8ODU0
|
||||
MTQ3NTg3Mzc2NDg0OTs/RUpTS05JT1xYWVlUXFZWVVtdWVlXUE5TUlJQT1BUVlZR
|
||||
VFVYW1NRTkxMUlZUUEtMTk9PTE1MSERESUpLSkxJRklJSUtLRkRJSEVCRENERUZE
|
||||
QkNBQ0JEQ0FAPjk6PDo3OTc3ODU2ODY2NTc+Rk9YYmdqaGhna3B3e3x+gYGBgYaH
|
||||
iYuKi4uKioWCfXdwbmpnaWlsb3eCiIuMjYmJjo6SkJCTl5ORjIaBfnZnVEc/Ojo6
|
||||
ODo7P0RJSkxPUlVWWVhWVlVSVFFRT05JRkVARD5BPkBCRERDQ0ZGRUdFSUpKSkpK
|
||||
SklOS0xNTkxOT05MS0tMTk9NT1ZWU1dZWl1eXWJkZ2hqbm91dXV4fH5/gYB/gYOC
|
||||
hYmGiIiHh4iGh4qLi4qMjY2Li4uLjZKTlpeWlpSPjo+SkZOQkpGRlZiXlpaZmZuZ
|
||||
mZibl5mZmJiampual5aYnKCpr7KqmImGiJWosbzAvLu5u7i1tbGwsbKzt7a8vcC/
|
||||
vL29vr6/v7q8vLq8vrq4ube1tLe3t7S0ta2ysrK1tKyginBfXVhTUlBOTVBMTU9M
|
||||
S0tLSUpLSkhJSkdPT05KSUdNS0lJSE1LSkxKTk9MTUtNSk9OTUxPUU5NUE9OT0xM
|
||||
Tk5QUVFQUU9QUVJSVFVSUlNTU1JRTlJTUFBSVFRSUlFTT09RUlBSUVNTUU9QUVNV
|
||||
VVVVUVFSU1FVU1JSUFFSU1hUUVFPUVRQUVJRU1NUVVZYWFZWWlhYVFFVWFhXVlhW
|
||||
WFhaWltbWF5bV1dYVlhbWFZYWVlaWVlYV1laWVpZV1taWVlaWlpaWVtcXV1cXF1d
|
||||
YF9dYF5dXV1dYF5bXV1cWlxWV1dYV1ZWWFdYV1ZZXIO9ydPa3uHk5efo6el7enh5
|
||||
ent8eHd1dnl2dnh6enl4eXdwZ1pMR0VFSkVEQz09Q0hKQ0A/P0I/PEJCQT4+PTpA
|
||||
RURFQ0RHQ0RBPT5ARkhJSkxMTk1JS05QTklKTk5QUVNUU1FXU1ddWVVRUFFTU1JQ
|
||||
UlBQT0tRVVVVU1JSUFJNSktPT0tJSUhHREVFQ0dEQkNAPj0+PTw7Ozs6OTw2Nzk4
|
||||
ODg6PDs5OTg3Nzs4Ojw7Ozw9PURBQkQ/RktGS0tISUpRVU5RTUpTT1lTV1VOVlNc
|
||||
WV1cWVddY1xdXllPT1JVT0pAODc1MzU5Njc6OTs3Njg2NTc7ODg4OTg+Q0dPUEpH
|
||||
VVRMUUxRSkpUTklOSVNSTU1KV1RSWlFYVFRVWVdNUFJeVFRVYWFdXVZQUVVYV1VZ
|
||||
VFdYWVhZXGVhVlRbW1pXUU1LTFBMTkhAOTg6OTk7Q1BSVVldWFpeXmFhY2VjXlNR
|
||||
U1BXWFVVUVZYWFdWU1NTVVZaV09WWVlaWlNQTUtOUE1OUlhZVFFXUE1NUFBQTlFS
|
||||
UFJWTU1OS0pRSkVJUFBNSkpNUEtPVFVXV1lXVldXU0hGRUdJSVBJSUhOVE9RWnWU
|
||||
qauroZiVkYl8c2xmY2VrdWlSQTs6Ozg7OTw8Oz08PDw7Ozw7PTtAPj09Pj1BQUJA
|
||||
OTo+QUQ9OD1FQUM+RUJCOzY9Q0E4ODU0NDY2NjQ0MzI1Njg4Oz1ESkpISkpTWlhY
|
||||
W1ZZV1hTVldOUVNOTE5OUlFQVFlYU01XV1dWU09MSktOUlRTUU1PT0xQTklFR0ZL
|
||||
TU1LS0dHR0dJSkpGRUNGSExHQ0RDREVBQD9APz5AOzs+QD88Pjw4NjY0Njc5Nzg7
|
||||
QUpTXmRmaGdoaGxwdHp7fXmBh4eHhoyQj5CNjYuJhYJ8dnN1b2xtbGtze4SJjI6M
|
||||
iImOj5KUlpWVk5GQi4B3a11RRj5APkFAQUFCSEpLTVBQU1hYWFZWV1NRUlBQTkxJ
|
||||
RkdDQT5AP0NDQkNARERJR0lJRkhHSUtQUE1MS0tNTExNTE1NT1FSUFBVVVVXWF1f
|
||||
XmNjZGdsbG5zdXZ1dnt9f4CDg4F/goOFhYaGh4uHhoWJi4mKi4mIiouNjIuMkZGR
|
||||
lpSUj5GQkpKSkpWTkpaXl5OVlpmbmpiYmZmZmJqWlZeYl5iZmp+jqrO5s6aTgXeB
|
||||
mK64vby7urq9ure0srSztba1t7m9vsDDwr69vb+9uru+wL69vbi3tbSztbq1tLe4
|
||||
rrOztrW1saylknplXFZUVVNPTU9PTk5NTU1NSkhISkpJR0lKS0lKUEpKS0xPTVBL
|
||||
TUxKS01KTExMTkpPTktQUE5PT09QTU5NUFBSUlNST1BPT05ST05PUVFTVlJSU1NS
|
||||
UlRTUVJTUVBRUU5RTlFSU1NQTk5NUFVTUlBSUVBRVFRTU1NSVFJQUlVUVlNUVFFS
|
||||
UFNVU1JUVVVWVVZXV1VWV1dWVVVYWVhZW1pYWVtdXF5aW1hZWFZZWVhYWlpYV1dY
|
||||
WFZXW1tZWFlYWVhWWVlZXFxcW11cXltcXltdXlxdX19dXl5bXVtbWFlYV1VXV1ZU
|
||||
VlVVVVdgfLvJ0dre4eTm5+jp6nl7e3x7eHp6dnh5dnd4dXd4dnZ5cmlgUkhCQEJH
|
||||
QEM/PkFCRERBQERDQz4/QkU7PD1CPkBBQUFAQEFDR0I9PENCR0dISEdJTklMT01P
|
||||
UlFNUFBRUlJZVVVWV1ZUU1hSVFZVUlJTUlBRUVNTVFVSUFFOUE5NTExPTUtIREhH
|
||||
RENDQkJFQj5APkE/Pz87Oj08Oz04Nzc4NzxBODQ1Nzc4Ozo6Ojg2OTs7Ozs+QT9D
|
||||
SUdISEZGRkpQS01LRElHTEpLVVRaWVhZXFtZVlhgX1xXV1BVblVUSkA5NzQ1NDc1
|
||||
NTQzNDQ0NDg1Njc2NTg7PD8+PkpJTUZNT0dPS1JNSFBLRkxIS0hLSk1UVFlgVl5X
|
||||
UVJUVUxRT1ZVUlFZXVpWVFJTVllZV1dUVFtaWltfZl1VWFtcVlZVT0tTUElIR0Q5
|
||||
NzY3Njk/SVJWWmxlWlxdWWBpYV9kV1JUUVJcWlhTT1NSV1pTVFNTVlVXVlZVWFJU
|
||||
WlNPS01VVVpaWVVYV1VWUU5QTk5PUFVRTE1LS0xIRU5KSEpOTk1JR01MSVBVWlxT
|
||||
VFhcWFpZTkdDQEFFS0VISElTUU9WYniWpqiooJeOhn92a2NgYGZwbV5JOzs/QkI7
|
||||
ODs9OkA+PDw6OT1APj4+SDw6Oz4/QkA7O0A9Pz5CPDs8QTxDQkJJPzpBPzo8Ozg2
|
||||
NzQ3NjczMjQ2Nzg7PT9HS0RJR01SUldSUE9OT01VWFJWVE5LTlFTUlBSVldSVFhW
|
||||
VFJWUVBNTEhLTFJUTExNS05OSUZITE1LS0pKT0pGREVGRkdIRklKSUlERURCQ0NC
|
||||
Q0E+PDk9QD9BPzw6ODo4OTo9Ojg5PUdQW2VqamlrbWttcnd6fH19fYKDiI2Ojo2N
|
||||
jo6LjIiIhX58eXVzcW9sb3d/hIyOkI+Lio6QkZOYlpSTjYuHgXJkWE1IRD89QEJF
|
||||
RUZMT0xPUVNUVlhaW1lXVVNSUlJPTUtNS0dDQUJEQkJDRUZGR0hFR0dHQ0dHSEtI
|
||||
SEtJS05LS0xSUVNQTlFUUlVZWFlcXWFlZ2hsbW9zcnV8fH9+fX+AgYGBg4SEg4KD
|
||||
hYOCh4eHh4eJi4qKi4uOjI2KjpGSlZWUmZaSkpeWkI6TmJWYmpiXmJiampuXnJmY
|
||||
lpaZmJqYmZmbnJ2jrLGwsbSwopSDfIeXrLu/vr28urq4s7OzsrK0trW3ubu8v8G/
|
||||
v7++vr27ur27vLy7ubW2uby7t7e1ube1tbe2tLW0sa+mmIFmWldXUlBRT0xOS0xO
|
||||
TVJPTUtKR0lKTEpKTUpJSUlLTUxJTE1PUExJS0tNS0xOTU5MS0xLS09PUVFTUE9R
|
||||
UFNSU1FRVFJNT09OTlBQUlNSUVBRT1JUVFFPUVRUUVNRUE5QUVFSUFFPSk5RUE9P
|
||||
UVNTVlFRTFBPUVJSUlJRT09SUlBQUE9RUlJTVVVTVFVWV1ZYWFZYV1hVVVRTV1ta
|
||||
W11bWVxaXV1aWlpcWllZWllaXV5bV1dXWFpZWldXWVpZVlVXWVlbXFxaXF9cX11f
|
||||
XFxcX15iYWBdXFhaW1pfXFtZV1RWVllXU1NXW2Z9usjT2d/h4+bn6OnpeXp7enl7
|
||||
d3t7enl6eHp4eHl1dG9rZFtRSkdDQkBAQUY/PEVESUREREM9QUFEQUVBPT9BPT8/
|
||||
Pz8+QT5BRENHQkNFRkhJS0xNTkxQTE1SU1NQUlNRUlVWVVVZWlZVU1VWU1ZWVFJQ
|
||||
VlJPUFNXWFZVU1RUUFFPTkxISEdJTEpGREJCQUBAQENHQj07PTo8OzU5Nzc4ODg3
|
||||
Nzg1ODk4ODc5Ozg6ODk3OTk4PD5FQj5AQEBFREU/QlFPSklIR0dHSkxUU1xZUVVZ
|
||||
YFhPU2BaV1RYUU9UWFZKQDo3NzI0NTAyNjQ0Ozg4Njc2Nzk5ODw6Ozo+S0ZLRUdF
|
||||
Q1RMWlVMUU9KT0pPTFVWSlVTVFtTWlNUVlJSTFNOUlRQSlRUWVdaWVVSUldZWlVT
|
||||
U1dUU1pdXFZXW15VVVVOTldSTUdHRzo2NzU2OTk+TV1eYmJYX11aYGleX2lYTVJR
|
||||
Vl5gXFhRUVNYXFJSWl1ZVlFWWlJSU1JcVVhTTlhYWFNTU1lYVVhSTU9RUVRTT05F
|
||||
SEhJRk9NS01OTU9KS1FJTFFRUlNUV1FTV1xdX1lRSERBQkJHRkpJRVJRU1dVYnqW
|
||||
pKekno+Jg3pybWhkZW1yZ1BEPDw+PTs3PDpEQ0E9Ozs7PDs/PEdCOjk9Oz1AQkA9
|
||||
QEFEQj06Ojw7PT9ASUhAPEFCPDg4OTczNDM2NDQ1MzU2ODk6PD5FRk1JUE5WXlJU
|
||||
UkxMTFVVT1BSUFRVVk5ISlNVVVRWWFRUVltYWE9LTUtKSkxJSUhLTU9NSUlMTkxI
|
||||
TU9NR0NHSElLS0xISkhKRkNBQ0RCREJCQz49PDtAPjw6ODg5PDs5Ozg2OkBLWGNo
|
||||
am1tbWtubXB1enp7e36Bg4aGiZKRjo2NjY2LiIiFhoKCd3Vua25vdH2DjI6NjIyO
|
||||
kpGQkpOVko+NiYN4aV5XU01LSUI+PUNHTFFSU05RUlVUWVtcXFZUUlFUU1FPTkxK
|
||||
R0ZCQUBAQUFEQz5CR0pIR0hESUhHRElKSklLS05MUFJVU1JRU1VaWFxdX19iY2lr
|
||||
bW9ycnR3enp5e318fX9/gH6Cg4SFgIOFhoeGh4mMiouOjo6PjY+MjY2RlJKSlJuX
|
||||
lZSUlZaQkpKWl5qTk5aYmpqbm5yampyam5mWl5uenZ+lqK2ytby9tqmcmJiRjJit
|
||||
uL6/vru6uLKuq62vs7a2t7e6u73BwcHAwcG/vcC9vLm4u7e4t7i4ur29urq4tre6
|
||||
uLa5trWzs62onohtXFVUVFJRT01NS0tKS05RS0tKS0xPTklJS0pJSUdLTEtJTEpO
|
||||
S0tHSUpNT05QTk5LS0xQTlBPUFJRTVBRTk9OT05PUlJPUlBQTk9QUFFRT1FRVVNU
|
||||
VFRTUlFWU1JQU1JRUFNVV1RPT1BRT1FSUVNUU1JOTlBPUFBQU1RSUVBSUVNSUVNR
|
||||
UVNVVFRTVVRWVFJTVlhXWVdXU1NTWFtbWl5dXFlZWFhZWFxYVlpYWFlbWVpZWVZX
|
||||
V1dYWVhYWFdXVVRZW1pZWlxdW1peXl1cXGBgX19gYV9fW1pZW1lcW1hWVFVXVVlW
|
||||
U1NVaoS8ytPa3uLk5+jo6el4eXh1eXh9eHt7e3t4eHZ1eHh0cm5jWEtLTEY/PTs8
|
||||
P0NGSklGREVBOz0+RD9BRENAPkE/Oj0+P0A9Pz0+Q0NCQkRJSUlKSUtMTEpLTFBU
|
||||
VlVUVlZSWVteXFpYU1RXWFlVWFlXV1VTVVJPUlZaVldTUVJRUVFOUE1KTE1LSElF
|
||||
QUVEQkVCRUNERD8/Pjs8QDw6Ojo6Ozw5Nzk5PDc2NDQ4Ojg6OTk4Ojc4PEQ7Oj0/
|
||||
PUNCRkNBSUtHSERJTEdKR1BLUVlVV1ZiV1BLU1JVVVZWU1RbWVBJQzo9NzY3NzYy
|
||||
Mjc3ODg0MzU3OTk/Pjo8Oz1ERk9FRkVJSklXUkxWUVBRSlFPV1ZHTU9SXlVdVVdc
|
||||
VlZMUk1QWVJRUFNZWF5eWU9PU1VWVFRSWFBPVllbWlZYWVdUVFFYXFhTUkxKQTo0
|
||||
MjQ1OT5DVFhPV1paYFtgX15gX1FPUlRUWltbVlNPUVdWUlhXXVZVVldaVlNWVllZ
|
||||
VFNPTVNRTVFPUlNUUVVUUlhVU1ZRS0lLRk1LSFFPTVFNTUpLT01LUlRMTVNVU1BU
|
||||
V1tiWFVQSUNDQEVDSEhHVVJYWlBYXn6Ypqiil4qBfHp4cGttcHNtYFBDOz47Ojo3
|
||||
OT07ODo7Oz88OjxAREA8Pj07OjxBQTw4PUFEQTxAPTtBRUVGR0U+QEI+ODUzMzc2
|
||||
Njc4ODQxNDY3OTs8P0RKR0hSTlVfVVtRT09RU1VSUVJTU1JQS05OTVJXVVZUUVNY
|
||||
VVRSTUxOSUtMSktKTEpJTEpKRkdLTE1NT01NSklJSktOTkpGREdGQUFERUREREI9
|
||||
Pj4/Ozc5ODo5Njc6OTs5NzpBSlhja21vb3RxcHBucnp9eXl6fH+EhIWGjo2Njo+N
|
||||
j4+MiYuLhH54cm5tb3BzfYaLjo6MjpKSkpORlJeWkpCHfnNrYVdWVVRMQj0/RE9V
|
||||
UVJQUVFRVFtcXF1dXFlWVlZXV1FRTk9NS0VDQ0FBQUFAP0FER0dHR0dHSUhKSkxL
|
||||
TEpJTlJOUFFUVlNWVltcYGBfZGhnaW5wcnR2dXh6eXt8f4GBgoKAg4GBgoODgoSE
|
||||
iIiHio6Ni4+Sk46KjY6Qk5WVkpGUlJOSlpKSlJWTkpOYmJiYmZial5iZm5mZmpye
|
||||
nZ+foKGip7Cyt7e5vLyznpKcn5aVorO5wcC/wLm2sa2rrK+zuLa4uL2/v768vMDA
|
||||
wsG+wL68vra1tLK1tri8vbi6ubi2tre3tra1tbW4trGroY1tW1hUVFNNTk5KSktP
|
||||
T0tLSkpMSktNTExLS0tLSkxKSUlMTUtLSk5JSE1OTk9MTE9RT0xNUFBRU1BPTU1P
|
||||
UFBTUlFPUlFOUVNRUFFRUU9OUFFTU1NTUlNUVFJTUU5QUlJUVVRUU1ZST1BPUFFS
|
||||
UVBOUVJPUFJSUFJRU1NRUFFSVFNSVFNUVFFRU1RXVlVXVFlYWFhZWFhVWFZUWFdX
|
||||
XV1cWFdYWVdaWFdaVVVaWVlaWVdaWVlYVVdaWVlXWFlbWFdYWVpdW1xcXlpbX2Fj
|
||||
YmBhYV9fX15cXl9aWFlVUFZWV1lYWVlXU1VvorzJ0tre4eTm5+jq6nl3d3l4d3h6
|
||||
ent8fHh2dXN1d3NxbGFUSkdGSEM7Pj89QUhJRkZFQ0RFQ0JCQj09PTg8PUE7Oj4+
|
||||
Qz0/QEFDQkVHR0pJSUxLTU1MTExLT1FSVFNTVVRVWFdXV1ZRUlNWVlVXWFlXWlta
|
||||
VFZXWlxZV1VTVVBTUU1NTEtNS05MR0pMSEVER0ZISEVERD4+Ozs6Ozs6OTk6Ojc1
|
||||
NTY5ODY2Njg2NzY4ODk3PDo4Pjw8PD9CRUFBPT5GRkVLTEZLTVFKSkxSW1daV11Z
|
||||
SlJWVlNSV1pUU1dXVlZQQjo7OTU1NDMyNjc0NTZINzc3OTo8PT07QUJDUkpOS0hN
|
||||
R1RRTlRQTlFIUFJVVEhSUVJgV1ZSWmFeYFJVTk5VUlJQV1lUVVZQSk5OUVZYVFBP
|
||||
UFNUWV1XUlRZWFlXVFVcXlpWWFBCOTIyMzc2PUNNV01TWlpbW1paXl1VVFZXVVZZ
|
||||
V1lcUk1OU1BVXVlaVlNTUVNYVVVbUk9VT05JTE9SUU9QUVZVUlNVWFlUS05LTFFU
|
||||
V09SUFNSUVRNSkpNUk5OV1FNVFpSTlRcYVxYW1FKQ0JER0NFR0hTTFFUTlVWbYma
|
||||
paOelImBfXx7dnRxcXBpWkY9Oj1COTQ5Ozs7QTk6Pzw7Ozs/QEJDPDo6PkBFPjtA
|
||||
QkRFQjk6PUJGREZEQkFCRj04MzQ1ODk1NTM5NzQ0NTk6Oj49P0JFSFRRWFlSXFNS
|
||||
VlZXVVRTU1ZTUFNNTU5PUFRUV1lRTk5SU09MTU5PUVBKS01MSkhIS0pJR0hDR0tL
|
||||
TUtFSk1OS0tIR0VHRkhEQ0NGRENBPj89PT87PDs4Ojw4OTo4Njk9QUxZZG1vb3By
|
||||
cnFzcnR2fH99eHh7gISHjJKJjpGRk5WSkpKOiomIgHx0cm5vcXV+hIeLjo+SlZiY
|
||||
mJWUlZmSjIJ4cG1jVE5NTkxIQ0ZMVFhXVldUVldYXWBiX19gXFxbWlhXU1FPTk1L
|
@@ -1,136 +0,0 @@
|
||||
TUxOT1JVUFNUVlVRT1VYWVdXUlJUT1FPU1VPT01PUE9WVlFSUFJRTkxKTU1PTEtJ
|
||||
R0JDR0RDQEBBQD8/PDs/PD0+Pz44NzY1NjY5ODw5OT08Nzk5ODs8QUNBQj9BQUND
|
||||
QklLSk5KSU9TXlhLT0xWUlFaVFdMTVdVW1VgWVdWXV9dWFtWUlFSTkVERTk1NTUz
|
||||
MzUzNjU0ODg1ODY2Nzk6PTo6P0NETE1JR1RSTFBISkpKVVVLSUpUTU5STVZRVFpT
|
||||
Vk5XXGBYUFhVWFJTV19kXVdVUFdVVlZUW1xbWlhZV1pcWE9TWlRWWVlXUE1MTlJD
|
||||
PDo8Ozo+P0pOTVhWVFJWW15oYFxbXlpUVlpZXFhYVVdXUFlcYFhUVFdaW1RQXVxc
|
||||
XltXUVBSTU1RUVRYVVNNSU1RUFFWVFFST05QUk9OSU5QTk1KS1BVSkxLTE5LT1RO
|
||||
VlRZWlZYVE1FRkVHR0ZLSU9LTlFOXWaJo7CspZ2WlZOJfXFmYmFqdG9eS0E+OTk4
|
||||
ODtBQTw9Ojg5PD5EQT8/P0BAPDc6OEE+Pzo+QENAPDtBQENDRkNDR0A6QEQ8ODU0
|
||||
MTQ3NTg3Mzc2NDg0OTs/RUpTS05JT1xYWVlUXFZWVVtdWVlXUE5TUlJQT1BUVlZR
|
||||
VFVYW1NRTkxMUlZUUEtMTk9PTE1MSERESUpLSkxJRklJSUtLRkRJSEVCRENERUZE
|
||||
QkNBQ0JEQ0FAPjk6PDo3OTc3ODU2ODY2NTc+Rk9YYmdqaGhna3B3e3x+gYGBgYaH
|
||||
iYuKi4uKioWCfXdwbmpnaWlsb3eCiIuMjYmJjo6SkJCTl5ORjIaBfnZnVEc/Ojo6
|
||||
ODo7P0RJSkxPUlVWWVhWVlVSVFFRT05JRkVARD5BPkBCRERDQ0ZGRUdFSUpKSkpK
|
||||
SklOS0xNTkxOT05MS0tMTk9NT1ZWU1dZWl1eXWJkZ2hqbm91dXV4fH5/gYB/gYOC
|
||||
hYmGiIiHh4iGh4qLi4qMjY2Li4uLjZKTlpeWlpSPjo+SkZOQkpGRlZiXlpaZmZuZ
|
||||
mZibl5mZmJiampual5aYnKCpr7KqmImGiJWosbzAvLu5u7i1tbGwsbKzt7a8vcC/
|
||||
vL29vr6/v7q8vLq8vrq4ube1tLe3t7S0ta2ysrK1tKyginBfXVhTUlBOTVBMTU9M
|
||||
S0tLSUpLSkhJSkdPT05KSUdNS0lJSE1LSkxKTk9MTUtNSk9OTUxPUU5NUE9OT0xM
|
||||
Tk5QUVFQUU9QUVJSVFVSUlNTU1JRTlJTUFBSVFRSUlFTT09RUlBSUVNTUU9QUVNV
|
||||
VVVVUVFSU1FVU1JSUFFSU1hUUVFPUVRQUVJRU1NUVVZYWFZWWlhYVFFVWFhXVlhW
|
||||
WFhaWltbWF5bV1dYVlhbWFZYWVlaWVlYV1laWVpZV1taWVlaWlpaWVtcXV1cXF1d
|
||||
YF9dYF5dXV1dYF5bXV1cWlxWV1dYV1ZWWFdYV1ZZXIO9ydPa3uHk5efo6el7enh5
|
||||
ent8eHd1dnl2dnh6enl4eXdwZ1pMR0VFSkVEQz09Q0hKQ0A/P0I/PEJCQT4+PTpA
|
||||
RURFQ0RHQ0RBPT5ARkhJSkxMTk1JS05QTklKTk5QUVNUU1FXU1ddWVVRUFFTU1JQ
|
||||
UlBQT0tRVVVVU1JSUFJNSktPT0tJSUhHREVFQ0dEQkNAPj0+PTw7Ozs6OTw2Nzk4
|
||||
ODg6PDs5OTg3Nzs4Ojw7Ozw9PURBQkQ/RktGS0tISUpRVU5RTUpTT1lTV1VOVlNc
|
||||
WV1cWVddY1xdXllPT1JVT0pAODc1MzU5Njc6OTs3Njg2NTc7ODg4OTg+Q0dPUEpH
|
||||
VVRMUUxRSkpUTklOSVNSTU1KV1RSWlFYVFRVWVdNUFJeVFRVYWFdXVZQUVVYV1VZ
|
||||
VFdYWVhZXGVhVlRbW1pXUU1LTFBMTkhAOTg6OTk7Q1BSVVldWFpeXmFhY2VjXlNR
|
||||
U1BXWFVVUVZYWFdWU1NTVVZaV09WWVlaWlNQTUtOUE1OUlhZVFFXUE1NUFBQTlFS
|
||||
UFJWTU1OS0pRSkVJUFBNSkpNUEtPVFVXV1lXVldXU0hGRUdJSVBJSUhOVE9RWnWU
|
||||
qauroZiVkYl8c2xmY2VrdWlSQTs6Ozg7OTw8Oz08PDw7Ozw7PTtAPj09Pj1BQUJA
|
||||
OTo+QUQ9OD1FQUM+RUJCOzY9Q0E4ODU0NDY2NjQ0MzI1Njg4Oz1ESkpISkpTWlhY
|
||||
W1ZZV1hTVldOUVNOTE5OUlFQVFlYU01XV1dWU09MSktOUlRTUU1PT0xQTklFR0ZL
|
||||
TU1LS0dHR0dJSkpGRUNGSExHQ0RDREVBQD9APz5AOzs+QD88Pjw4NjY0Njc5Nzg7
|
||||
QUpTXmRmaGdoaGxwdHp7fXmBh4eHhoyQj5CNjYuJhYJ8dnN1b2xtbGtze4SJjI6M
|
||||
iImOj5KUlpWVk5GQi4B3a11RRj5APkFAQUFCSEpLTVBQU1hYWFZWV1NRUlBQTkxJ
|
||||
RkdDQT5AP0NDQkNARERJR0lJRkhHSUtQUE1MS0tNTExNTE1NT1FSUFBVVVVXWF1f
|
||||
XmNjZGdsbG5zdXZ1dnt9f4CDg4F/goOFhYaGh4uHhoWJi4mKi4mIiouNjIuMkZGR
|
||||
lpSUj5GQkpKSkpWTkpaXl5OVlpmbmpiYmZmZmJqWlZeYl5iZmp+jqrO5s6aTgXeB
|
||||
mK64vby7urq9ure0srSztba1t7m9vsDDwr69vb+9uru+wL69vbi3tbSztbq1tLe4
|
||||
rrOztrW1saylknplXFZUVVNPTU9PTk5NTU1NSkhISkpJR0lKS0lKUEpKS0xPTVBL
|
||||
TUxKS01KTExMTkpPTktQUE5PT09QTU5NUFBSUlNST1BPT05ST05PUVFTVlJSU1NS
|
||||
UlRTUVJTUVBRUU5RTlFSU1NQTk5NUFVTUlBSUVBRVFRTU1NSVFJQUlVUVlNUVFFS
|
||||
UFNVU1JUVVVWVVZXV1VWV1dWVVVYWVhZW1pYWVtdXF5aW1hZWFZZWVhYWlpYV1dY
|
||||
WFZXW1tZWFlYWVhWWVlZXFxcW11cXltcXltdXlxdX19dXl5bXVtbWFlYV1VXV1ZU
|
||||
VlVVVVdgfLvJ0dre4eTm5+jp6nl7e3x7eHp6dnh5dnd4dXd4dnZ5cmlgUkhCQEJH
|
||||
QEM/PkFCRERBQERDQz4/QkU7PD1CPkBBQUFAQEFDR0I9PENCR0dISEdJTklMT01P
|
||||
UlFNUFBRUlJZVVVWV1ZUU1hSVFZVUlJTUlBRUVNTVFVSUFFOUE5NTExPTUtIREhH
|
||||
RENDQkJFQj5APkE/Pz87Oj08Oz04Nzc4NzxBODQ1Nzc4Ozo6Ojg2OTs7Ozs+QT9D
|
||||
SUdISEZGRkpQS01LRElHTEpLVVRaWVhZXFtZVlhgX1xXV1BVblVUSkA5NzQ1NDc1
|
||||
NTQzNDQ0NDg1Njc2NTg7PD8+PkpJTUZNT0dPS1JNSFBLRkxIS0hLSk1UVFlgVl5X
|
||||
UVJUVUxRT1ZVUlFZXVpWVFJTVllZV1dUVFtaWltfZl1VWFtcVlZVT0tTUElIR0Q5
|
||||
NzY3Njk/SVJWWmxlWlxdWWBpYV9kV1JUUVJcWlhTT1NSV1pTVFNTVlVXVlZVWFJU
|
||||
WlNPS01VVVpaWVVYV1VWUU5QTk5PUFVRTE1LS0xIRU5KSEpOTk1JR01MSVBVWlxT
|
||||
VFhcWFpZTkdDQEFFS0VISElTUU9WYniWpqiooJeOhn92a2NgYGZwbV5JOzs/QkI7
|
||||
ODs9OkA+PDw6OT1APj4+SDw6Oz4/QkA7O0A9Pz5CPDs8QTxDQkJJPzpBPzo8Ozg2
|
||||
NzQ3NjczMjQ2Nzg7PT9HS0RJR01SUldSUE9OT01VWFJWVE5LTlFTUlBSVldSVFhW
|
||||
VFJWUVBNTEhLTFJUTExNS05OSUZITE1LS0pKT0pGREVGRkdIRklKSUlERURCQ0NC
|
||||
Q0E+PDk9QD9BPzw6ODo4OTo9Ojg5PUdQW2VqamlrbWttcnd6fH19fYKDiI2Ojo2N
|
||||
jo6LjIiIhX58eXVzcW9sb3d/hIyOkI+Lio6QkZOYlpSTjYuHgXJkWE1IRD89QEJF
|
||||
RUZMT0xPUVNUVlhaW1lXVVNSUlJPTUtNS0dDQUJEQkJDRUZGR0hFR0dHQ0dHSEtI
|
||||
SEtJS05LS0xSUVNQTlFUUlVZWFlcXWFlZ2hsbW9zcnV8fH9+fX+AgYGBg4SEg4KD
|
||||
hYOCh4eHh4eJi4qKi4uOjI2KjpGSlZWUmZaSkpeWkI6TmJWYmpiXmJiampuXnJmY
|
||||
lpaZmJqYmZmbnJ2jrLGwsbSwopSDfIeXrLu/vr28urq4s7OzsrK0trW3ubu8v8G/
|
||||
v7++vr27ur27vLy7ubW2uby7t7e1ube1tbe2tLW0sa+mmIFmWldXUlBRT0xOS0xO
|
||||
TVJPTUtKR0lKTEpKTUpJSUlLTUxJTE1PUExJS0tNS0xOTU5MS0xLS09PUVFTUE9R
|
||||
UFNSU1FRVFJNT09OTlBQUlNSUVBRT1JUVFFPUVRUUVNRUE5QUVFSUFFPSk5RUE9P
|
||||
UVNTVlFRTFBPUVJSUlJRT09SUlBQUE9RUlJTVVVTVFVWV1ZYWFZYV1hVVVRTV1ta
|
||||
W11bWVxaXV1aWlpcWllZWllaXV5bV1dXWFpZWldXWVpZVlVXWVlbXFxaXF9cX11f
|
||||
XFxcX15iYWBdXFhaW1pfXFtZV1RWVllXU1NXW2Z9usjT2d/h4+bn6OnpeXp7enl7
|
||||
d3t7enl6eHp4eHl1dG9rZFtRSkdDQkBAQUY/PEVESUREREM9QUFEQUVBPT9BPT8/
|
||||
Pz8+QT5BRENHQkNFRkhJS0xNTkxQTE1SU1NQUlNRUlVWVVVZWlZVU1VWU1ZWVFJQ
|
||||
VlJPUFNXWFZVU1RUUFFPTkxISEdJTEpGREJCQUBAQENHQj07PTo8OzU5Nzc4ODg3
|
||||
Nzg1ODk4ODc5Ozg6ODk3OTk4PD5FQj5AQEBFREU/QlFPSklIR0dHSkxUU1xZUVVZ
|
||||
YFhPU2BaV1RYUU9UWFZKQDo3NzI0NTAyNjQ0Ozg4Njc2Nzk5ODw6Ozo+S0ZLRUdF
|
||||
Q1RMWlVMUU9KT0pPTFVWSlVTVFtTWlNUVlJSTFNOUlRQSlRUWVdaWVVSUldZWlVT
|
||||
U1dUU1pdXFZXW15VVVVOTldSTUdHRzo2NzU2OTk+TV1eYmJYX11aYGleX2lYTVJR
|
||||
Vl5gXFhRUVNYXFJSWl1ZVlFWWlJSU1JcVVhTTlhYWFNTU1lYVVhSTU9RUVRTT05F
|
||||
SEhJRk9NS01OTU9KS1FJTFFRUlNUV1FTV1xdX1lRSERBQkJHRkpJRVJRU1dVYnqW
|
||||
pKekno+Jg3pybWhkZW1yZ1BEPDw+PTs3PDpEQ0E9Ozs7PDs/PEdCOjk9Oz1AQkA9
|
||||
QEFEQj06Ojw7PT9ASUhAPEFCPDg4OTczNDM2NDQ1MzU2ODk6PD5FRk1JUE5WXlJU
|
||||
UkxMTFVVT1BSUFRVVk5ISlNVVVRWWFRUVltYWE9LTUtKSkxJSUhLTU9NSUlMTkxI
|
||||
TU9NR0NHSElLS0xISkhKRkNBQ0RCREJCQz49PDtAPjw6ODg5PDs5Ozg2OkBLWGNo
|
||||
am1tbWtubXB1enp7e36Bg4aGiZKRjo2NjY2LiIiFhoKCd3Vua25vdH2DjI6NjIyO
|
||||
kpGQkpOVko+NiYN4aV5XU01LSUI+PUNHTFFSU05RUlVUWVtcXFZUUlFUU1FPTkxK
|
||||
R0ZCQUBAQUFEQz5CR0pIR0hESUhHRElKSklLS05MUFJVU1JRU1VaWFxdX19iY2lr
|
||||
bW9ycnR3enp5e318fX9/gH6Cg4SFgIOFhoeGh4mMiouOjo6PjY+MjY2RlJKSlJuX
|
||||
lZSUlZaQkpKWl5qTk5aYmpqbm5yampyam5mWl5uenZ+lqK2ytby9tqmcmJiRjJit
|
||||
uL6/vru6uLKuq62vs7a2t7e6u73BwcHAwcG/vcC9vLm4u7e4t7i4ur29urq4tre6
|
||||
uLa5trWzs62onohtXFVUVFJRT01NS0tKS05RS0tKS0xPTklJS0pJSUdLTEtJTEpO
|
||||
S0tHSUpNT05QTk5LS0xQTlBPUFJRTVBRTk9OT05PUlJPUlBQTk9QUFFRT1FRVVNU
|
||||
VFRTUlFWU1JQU1JRUFNVV1RPT1BRT1*SUVNUU1JOTlBPUFBQU1RSUVBSUVNSUVNR
|
||||
UVNVVFRTVVRWVFJTVlhXWVdXU1NTWFtbWl5dXFlZWFhZWFxYVlpYWFlbWVpZWVZX
|
||||
V1dYWVhYWFdXVVRZW1pZWlxdW1peXl1cXGBgX19gYV9fW1pZW1lcW1hWVFVXVVlW
|
||||
U1NVaoS8ytPa3uLk5+jo6el4eXh1eXh9eHt7e3t4eHZ1eHh0cm5jWEtLTEY/PTs8
|
||||
P0NGSklGREVBOz0+RD9BRENAPkE/Oj0+P0A9Pz0+Q0NCQkRJSUlKSUtMTEpLTFBU
|
||||
VlVUVlZSWVteXFpYU1RXWFlVWFlXV1VTVVJPUlZaVldTUVJRUVFOUE1KTE1LSElF
|
||||
QUVEQkVCRUNERD8/Pjs8QDw6Ojo6Ozw5Nzk5PDc2NDQ4Ojg6OTk4Ojc4PEQ7Oj0/
|
||||
PUNCRkNBSUtHSERJTEdKR1BLUVlVV1ZiV1BLU1JVVVZWU1RbWVBJQzo9NzY3NzYy
|
||||
Mjc3ODg0MzU3OTk/Pjo8Oz1ERk9FRkVJSklXUkxWUVBRSlFPV1ZHTU9SXlVdVVdc
|
||||
VlZMUk1QWVJRUFNZWF5eWU9PU1VWVFRSWFBPVllbWlZYWVdUVFFYXFhTUkxKQTo0
|
||||
MjQ1OT5DVFhPV1paYFtgX15gX1FPUlRUWltbVlNPUVdWUlhXXVZVVldaVlNWVllZ
|
||||
VFNPTVNRTVFPUlNUUVVUUlhVU1ZRS0lLRk1LSFFPTVFNTUpLT01LUlRMTVNVU1BU
|
||||
V1tiWFVQSUNDQEVDSEhHVVJYWlBYXn6Ypqiil4qBfHp4cGttcHNtYFBDOz47Ojo3
|
||||
OT07ODo7Oz88OjxAREA8Pj07OjxBQTw4PUFEQTxAPTtBRUVGR0U+QEI+ODUzMzc2
|
||||
Njc4ODQxNDY3OTs8P0RKR0hSTlVfVVtRT09RU1VSUVJTU1JQS05OTVJXVVZUUVNY
|
||||
VVRSTUxOSUtMSktKTEpJTEpKRkdLTE1NT01NSklJSktOTkpGREdGQUFERUREREI9
|
||||
Pj4/Ozc5ODo5Njc6OTs5NzpBSlhja21vb3RxcHBucnp9eXl6fH+EhIWGjo2Njo+N
|
||||
j4+MiYuLhH54cm5tb3BzfYaLjo6MjpKSkpORlJeWkpCHfnNrYVdWVVRMQj0/RE9V
|
||||
UVJQUVFRVFtcXF1dXFlWVlZXV1FRTk9NS0VDQ0FBQUFAP0FER0dHR0dHSUhKSkxL
|
||||
TEpJTlJOUFFUVlNWVltcYGBfZGhnaW5wcnR2dXh6eXt8f4GBgoKAg4GBgoODgoSE
|
||||
iIiHio6Ni4+Sk46KjY6Qk5WVkpGUlJOSlpKSlJWTkpOYmJiYmZial5iZm5mZmpye
|
||||
nZ+foKGip7Cyt7e5vLyznpKcn5aVorO5wcC/wLm2sa2rrK+zuLa4uL2/v768vMDA
|
||||
wsG+wL68vra1tLK1tri8vbi6ubi2tre3tra1tbW4trGroY1tW1hUVFNNTk5KSktP
|
||||
T0tLSkpMSktNTExLS0tLSkxKSUlMTUtLSk5JSE1OTk9MTE9RT0xNUFBRU1BPTU1P
|
||||
UFBTUlFPUlFOUVNRUFFRUU9OUFFTU1NTUlNUVFJTUU5QUlJUVVRUU1ZST1BPUFFS
|
||||
UVBOUVJPUFJSUFJRU1NRUFFSVFNSVFNUVFFRU1RXVlVXVFlYWFhZWFhVWFZUWFdX
|
||||
XV1cWFdYWVdaWFdaVVVaWVlaWVdaWVlYVVdaWVlXWFlbWFdYWVpdW1xcXlpbX2Fj
|
||||
YmBhYV9fX15cXl9aWFlVUFZWV1lYWVlXU1V#orzJ0tre4eTm5+jq6nl3d3l4d3h6
|
||||
ent8fHh2dXN1d3NxbGFUSkdGSEM7Pj89QUhJRkZFQ0RFQ0JCQj09PTg8PUE7Oj4+
|
||||
Qz0/QEFDQkVHR0pJSUxLTU1MTExLT1FSVFNTVVRVWFdXV1ZRUlNWVlVXWFlXWlta
|
||||
VFZXWlxZV1VTVVBTUU1NTEtNS05MR0pMSEVER0ZISEVERD4+Ozs6Ozs6OTk6Ojc1
|
||||
NTY5ODY2Njg2NzY4ODk3PDo4Pjw8PD9CRUFBPT5GRkVLTEZLTVFKSkxSW1daV11Z
|
||||
SlJWVlNSV1pUU1dXVlZQQjo7OTU1NDMyNjc0NTZINzc3OTo8PT07QUJDUkpOS0hN
|
||||
R1RRTlRQTlFIUFJVVEhSUVJgV1ZSWmFeYFJVTk5VUlJQV1lUVVZQSk5OUVZYVFBP
|
||||
UFNUWV1XUlRZWFlXVFVcXlpWWFBCOTIyMzc2PUNNV01TWlpbW1paXl1VVFZXVVZZ
|
||||
V1lcUk1OU1BVXVlaVlNTUVNYVVVbUk9VT05JTE9SUU9QUVZVUlNVWFlUS05LTFFU
|
||||
V09SUFNSUVRNSkpNUk5OV1FNVFpSTlRcYVxYW1FKQ0JER0NFR0hTTFFUTlVWbYma
|
||||
paOelImBfXx7dnRxcXBpWkY9Oj1COTQ5Ozs7QTk6Pzw7Ozs/QEJDPDo6PkBFPjtA
|
||||
QkRFQjk6PUJGREZEQkFCRj04MzQ1ODk1NTM5NzQ0NTk6Oj49P0JFSFRRWFlSXFNS
|
||||
VlZXVVRTU1ZTUFNNTU5PUFRUV1lRTk5SU09MTU5PUVBKS01MSkhIS0pJR0hDR0tL
|
||||
TUtFSk1OS0tIR0VHRkhEQ0NGRENBPj89PT87PDs4Ojw4OTo4Njk9QUxZZG1vb3By
|
||||
cnFzcnR2fH99eHh7gISHjJKJjpGRk5WSkpKOiomIgHx0cm5vcXV+hIeLjo+SlZiY
|
||||
mJWUlZmSjIJ4cG1jVE5NTkxIQ0ZMVFhXVldUVldYXWBiX19gXFxbWlhXU1FPTk1L
|
Reference in New Issue
Block a user