optional_optimization branch

[SVN r77091]

example/Jamfile.v2

@@ -0,0 +1,22 @@
+#  Boost algorithm library example programs Jamfile
+#
+#  Copyright Marshall Clow 2010-2012. Use, modification and
+#  distribution is subject to the Boost Software License, Version
+#  1.0. (See accompanying file LICENSE_1_0.txt or copy at
+#  http://www.boost.org/LICENSE_1_0.txt)
+#
+#  See http://www.boost.org for updates, documentation, and revision history.
+
+
+project /boost/algorithm/example
+    : requirements
+      <include>../../../
+      <optimization>speed
+      <toolset>msvc:<define>_SCL_SECURE_NO_WARNINGS
+      <toolset>msvc:<define>NOMINMAX
+      <link>static
+    :
+    ;
+
+exe clamp_example   : clamp_example.cpp ;
+exe search_example  : search_example.cpp ;

example/clamp_example.cpp

@@ -0,0 +1,54 @@
+/* 
+   Copyright (c) Marshall Clow 2010-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <string>
+#include <iostream>     // for cout, etc
+
+#include <boost/algorithm/clamp.hpp>
+
+namespace ba = boost::algorithm;
+
+bool compare_string_lengths ( const std::string &one, const std::string &two )
+{
+    return one.length () < two.length ();
+}
+
+int main ( int /*argc*/, char * /*argv*/ [] ) {
+//  Clamp takes a value and two "fenceposts", and brings the value "between" the fenceposts.
+
+//  If the input value is "between" the fenceposts, then it is returned unchanged.
+    std::cout << "Clamping   5 to between [1, 10] -> " << ba::clamp ( 5, 1, 10 ) << std::endl;
+
+//  If the input value is out side the range of the fenceposts, it "brought into" range.
+    std::cout << "Clamping  15 to between [1, 10] -> " << ba::clamp (  15, 1, 10 ) << std::endl;
+    std::cout << "Clamping -15 to between [1, 10] -> " << ba::clamp ( -15, 1, 10 ) << std::endl;
+
+//  It doesn't just work for ints
+    std::cout << "Clamping 5.1 to between [1, 10] -> " << ba::clamp ( 5.1, 1.0, 10.0 ) << std::endl;
+
+    {
+        std::string one ( "Lower Bound" ), two ( "upper bound!" ), test1 ( "test#" ), test2 ( "#test" );
+        std::cout << "Clamping '" << test1 << "' between ['" << one << "' and '" << two << "'] -> '" << 
+            ba::clamp ( test1, one, two ) << "'" << std::endl;
+        std::cout << "Clamping '" << test2 << "' between ['" << one << "' and '" << two << "'] -> '" << 
+            ba::clamp ( test2, one, two ) << "'" << std::endl;
+    //  There is also a predicate based version, if you want to compare objects in your own way
+        std::cout << "Clamping '" << test1 << "' between ['" << one << "' and '" << two << "'] (comparing lengths) -> '" << 
+            ba::clamp ( test1, one, two, compare_string_lengths ) << "'" << std::endl;
+        std::cout << "Clamping '" << test2 << "' between ['" << one << "' and '" << two << "'] (comparing lengths) -> '" << 
+            ba::clamp ( test2, one, two, compare_string_lengths ) << "'" << std::endl;
+    
+    }
+
+//  Sometimes, though, you don't get quite what you expect
+//  This is because the two double arguments get converted to int
+    std::cout << "Somewhat unexpected: clamp ( 12, 14.7, 15.9 ) --> " << ba::clamp ( 12, 14.7, 15.9 ) << std::endl;
+    std::cout << "Expected:     clamp ((double)12, 14.7, 15.9 ) --> " << ba::clamp ((double) 12, 14.7, 15.9 ) << std::endl;
+    return 0;
+    }

example/search_example.cpp

@@ -0,0 +1,57 @@
+/* 
+   Copyright (c) Marshall Clow 2010-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <string>
+#include <iostream>     //  for cout, etc.
+
+#include <boost/algorithm/searching/boyer_moore.hpp>
+#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
+#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
+
+namespace ba = boost::algorithm;
+
+const std::string haystack ( "ABACAB is it everywhere!" );
+const std::string needle1  ( "ACAB" );
+const std::string needle2  ( "not ABA" );
+
+
+
+int main ( int /*argc*/, char * /*argv*/ [] ) {
+//  In search.hpp, there are generic implementations of three classic sequence search
+//  algorithms. They all have the same (dual) interface.
+
+//  There is a procedural interface, based on std::search:
+    if ( ba::boyer_moore_search ( haystack.begin (), haystack.end (), needle1.begin (), needle1.end ()) != haystack.end ())
+        std::cout << "Found '" << needle1 << "'  in '" << haystack << "' (boyer-moore 1)" << std::endl;
+    else
+        std::cout << "Did NOT find '" << needle1 << "'  in '" << haystack << "' (boyer-moore 1)" << std::endl;
+
+//  If you plan on searching for the same pattern in several different data sets,
+//  you can create a search object and use that over and over again - amortizing the setup
+//  costs across several searches
+    ba::boyer_moore<std::string::const_iterator> search1 ( needle1.begin (), needle1.end ());
+    if ( search1 ( haystack.begin (), haystack.end ()) != haystack.end ())
+        std::cout << "Found '" << needle1 << "'  in '" << haystack << "' (boyer-moore 2)" << std::endl;
+    else
+        std::cout << "Did NOT find '" << needle1 << "'  in '" << haystack << "' (boyer-moore 2)" << std::endl;
+
+//  There is also an implementation of boyer-moore-horspool searching
+    if ( ba::boyer_moore_horspool_search ( haystack.begin (), haystack.end (), needle1.begin (), needle1.end ()) != haystack.end ())
+        std::cout << "Found '" << needle1 << "'  in '" << haystack << "' (boyer-moore-horspool)" << std::endl;
+    else
+        std::cout << "Did NOT find '" << needle1 << "'  in '" << haystack << "' (boyer-moore-horspool)" << std::endl;
+
+//  And also the knuth-pratt-morris search algorithm
+    if ( ba::knuth_morris_pratt_search ( haystack.begin (), haystack.end (), needle1.begin (), needle1.end ()) != haystack.end ())
+        std::cout << "Found '" << needle1 << "'  in '" << haystack << "' (knuth_morris_pratt)" << std::endl;
+    else
+        std::cout << "Did NOT find '" << needle1 << "'  in '" << haystack << "' (knuth_morris_pratt)" << std::endl;
+
+    return 0;
+    }

include/boost/algorithm/clamp.hpp

@@ -0,0 +1,175 @@
+/* 
+   Copyright (c) Marshall Clow 2008-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+ Revision history:
+   27 June 2009 mtc First version
+   23 Oct  2010 mtc Added predicate version
+   
+*/
+
+/// \file clamp.hpp
+/// \brief Clamp algorithm
+/// \author Marshall Clow
+///
+/// Suggested by olafvdspek in https://svn.boost.org/trac/boost/ticket/3215
+
+#ifndef BOOST_ALGORITHM_CLAMP_HPP
+#define BOOST_ALGORITHM_CLAMP_HPP
+
+#include <functional>       //  For std::less
+#include <iterator>         //  For std::iterator_traits
+#include <cassert>
+
+#include <boost/range/begin.hpp>
+#include <boost/range/end.hpp>
+#include <boost/mpl/identity.hpp>      // for identity
+#include <boost/utility/enable_if.hpp> // for boost::disable_if
+
+namespace boost { namespace algorithm {
+
+/// \fn clamp ( T const& val, 
+///               typename boost::mpl::identity<T>::type const& lo, 
+///               typename boost::mpl::identity<T>::type const& hi, Pred p )
+/// \return the value "val" brought into the range [ lo, hi ]
+///     using the comparison predicate p.
+///     If p ( val, lo ) return lo.
+///     If p ( hi, val ) return hi.
+///     Otherwise, return the original value.
+/// 
+/// \param val   The value to be clamped
+/// \param lo    The lower bound of the range to be clamped to
+/// \param hi    The upper bound of the range to be clamped to
+/// \param p     A predicate to use to compare the values.
+///                 p ( a, b ) returns a boolean.
+///
+  template<typename T, typename Pred> 
+  T const & clamp ( T const& val, 
+    typename boost::mpl::identity<T>::type const & lo, 
+    typename boost::mpl::identity<T>::type const & hi, Pred p )
+  {
+//    assert ( !p ( hi, lo ));    // Can't assert p ( lo, hi ) b/c they might be equal
+    return p ( val, lo ) ? lo : p ( hi, val ) ? hi : val;
+  } 
+
+
+/// \fn clamp ( T const& val, 
+///               typename boost::mpl::identity<T>::type const& lo, 
+///               typename boost::mpl::identity<T>::type const& hi )
+/// \return the value "val" brought into the range [ lo, hi ].
+///     If the value is less than lo, return lo.
+///     If the value is greater than "hi", return hi.
+///     Otherwise, return the original value.
+///
+/// \param val   The value to be clamped
+/// \param lo    The lower bound of the range to be clamped to
+/// \param hi    The upper bound of the range to be clamped to
+///
+  template<typename T> 
+  T const& clamp ( const T& val, 
+    typename boost::mpl::identity<T>::type const & lo, 
+    typename boost::mpl::identity<T>::type const & hi )
+  {
+    return (clamp) ( val, lo, hi, std::less<T>());
+  } 
+
+/// \fn clamp_range ( InputIterator first, InputIterator last, OutputIterator out, 
+///       std::iterator_traits<InputIterator>::value_type lo, 
+///       std::iterator_traits<InputIterator>::value_type hi )
+/// \return clamp the sequence of values [first, last) into [ lo, hi ]
+/// 
+/// \param first The start of the range of values
+/// \param last  One past the end of the range of input values
+/// \param out   An output iterator to write the clamped values into
+/// \param lo    The lower bound of the range to be clamped to
+/// \param hi    The upper bound of the range to be clamped to
+///
+  template<typename InputIterator, typename OutputIterator> 
+  OutputIterator clamp_range ( InputIterator first, InputIterator last, OutputIterator out,
+    typename std::iterator_traits<InputIterator>::value_type lo, 
+    typename std::iterator_traits<InputIterator>::value_type hi )
+  {
+  // this could also be written with bind and std::transform
+    while ( first != last )
+        *out++ = clamp ( *first++, lo, hi );
+    return out;
+  } 
+
+/// \fn clamp_range ( const Range &r, OutputIterator out, 
+///       typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type lo,
+///       typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type hi )
+/// \return clamp the sequence of values [first, last) into [ lo, hi ]
+/// 
+/// \param r     The range of values to be clamped
+/// \param out   An output iterator to write the clamped values into
+/// \param lo    The lower bound of the range to be clamped to
+/// \param hi    The upper bound of the range to be clamped to
+///
+  template<typename Range, typename OutputIterator> 
+  typename boost::disable_if_c<boost::is_same<Range, OutputIterator>::value, OutputIterator>::type
+  clamp_range ( const Range &r, OutputIterator out,
+    typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type lo, 
+    typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type hi )
+  {
+    return clamp_range ( boost::begin ( r ), boost::end ( r ), out, lo, hi );
+  } 
+
+
+/// \fn clamp_range ( InputIterator first, InputIterator last, OutputIterator out, 
+///       std::iterator_traits<InputIterator>::value_type lo, 
+///       std::iterator_traits<InputIterator>::value_type hi, Pred p )
+/// \return clamp the sequence of values [first, last) into [ lo, hi ]
+///     using the comparison predicate p.
+/// 
+/// \param first The start of the range of values
+/// \param last  One past the end of the range of input values
+/// \param out   An output iterator to write the clamped values into
+/// \param lo    The lower bound of the range to be clamped to
+/// \param hi    The upper bound of the range to be clamped to
+/// \param p     A predicate to use to compare the values.
+///                 p ( a, b ) returns a boolean.
+
+///
+  template<typename InputIterator, typename OutputIterator, typename Pred> 
+  OutputIterator clamp_range ( InputIterator first, InputIterator last, OutputIterator out,
+    typename std::iterator_traits<InputIterator>::value_type lo, 
+    typename std::iterator_traits<InputIterator>::value_type hi, Pred p )
+  {
+  // this could also be written with bind and std::transform
+    while ( first != last )
+        *out++ = clamp ( *first++, lo, hi, p );
+    return out;
+  } 
+
+/// \fn clamp_range ( const Range &r, OutputIterator out, 
+///       typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type lo,
+///       typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type hi,
+///       Pred p )
+/// \return clamp the sequence of values [first, last) into [ lo, hi ]
+///     using the comparison predicate p.
+/// 
+/// \param r     The range of values to be clamped
+/// \param out   An output iterator to write the clamped values into
+/// \param lo    The lower bound of the range to be clamped to
+/// \param hi    The upper bound of the range to be clamped to
+/// \param p     A predicate to use to compare the values.
+///                 p ( a, b ) returns a boolean.
+//
+//  Disable this template if the first two parameters are the same type;
+//  In that case, the user will get the two iterator version.
+  template<typename Range, typename OutputIterator, typename Pred> 
+  typename boost::disable_if_c<boost::is_same<Range, OutputIterator>::value, OutputIterator>::type
+  clamp_range ( const Range &r, OutputIterator out,
+    typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type lo, 
+    typename std::iterator_traits<typename boost::range_iterator<const Range>::type>::value_type hi,
+    Pred p )
+  {
+    return clamp_range ( boost::begin ( r ), boost::end ( r ), out, lo, hi, p );
+  } 
+
+
+}}
+
+#endif // BOOST_ALGORITHM_CLAMP_HPP

include/boost/algorithm/cxx11/all_of.hpp

@@ -0,0 +1,90 @@
+/* 
+   Copyright (c) Marshall Clow 2008-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+*/
+
+/// \file  all_of.hpp
+/// \brief Test ranges to see if all elements match a value or predicate.
+/// \author Marshall Clow
+
+#ifndef BOOST_ALGORITHM_ALL_OF_HPP
+#define BOOST_ALGORITHM_ALL_OF_HPP
+
+#include <boost/range/begin.hpp>
+#include <boost/range/end.hpp>
+
+namespace boost { namespace algorithm {
+
+#if __cplusplus >= 201103L
+//  Use the C++11 versions of all_of if it is available
+using std::all_of;      // Section 25.2.1
+#else
+/// \fn all_of ( InputIterator first, InputIterator last, Predicate p )
+/// \return true if all elements in [first, last) satisfy the predicate 'p'
+/// \note returns true on an empty range
+/// 
+/// \param first The start of the input sequence
+/// \param last  One past the end of the input sequence
+/// \param p     A predicate for testing the elements of the sequence
+///
+/// \note           This function is part of the C++2011 standard library.
+///  We will use the standard one if it is available, 
+///  otherwise we have our own implementation.
+template<typename InputIterator, typename Predicate> 
+bool all_of ( InputIterator first, InputIterator last, Predicate p )
+{
+    for ( ; first != last; ++first )
+        if ( !p(*first)) 
+            return false;
+    return true; 
+} 
+#endif
+
+/// \fn all_of ( const Range &r, Predicate p )
+/// \return true if all elements in the range satisfy the predicate 'p'
+/// \note returns true on an empty range
+/// 
+/// \param r    The input range
+/// \param p    A predicate for testing the elements of the range
+///
+template<typename Range, typename Predicate> 
+bool all_of ( const Range &r, Predicate p )
+{
+    return boost::algorithm::all_of ( boost::begin (r), boost::end (r), p );
+} 
+
+/// \fn all_of_equal ( InputIterator first, InputIterator last, const T &val )
+/// \return true if all elements in [first, last) are equal to 'val'
+/// \note returns true on an empty range
+/// 
+/// \param first The start of the input sequence
+/// \param last  One past the end of the input sequence
+/// \param val   A value to compare against
+///
+template<typename InputIterator, typename T> 
+bool all_of_equal ( InputIterator first, InputIterator last, const T &val )
+{
+    for ( ; first != last; ++first )
+    if ( val != *first ) 
+        return false;
+    return true; 
+} 
+
+/// \fn all_of_equal ( const Range &r, const T &val )
+/// \return true if all elements in the range are equal to 'val'
+/// \note returns true on an empty range
+/// 
+/// \param r    The input range
+/// \param val  A value to compare against
+///
+template<typename Range, typename T> 
+bool all_of_equal ( const Range &r, const T &val ) 
+{
+    return boost::algorithm::all_of_equal ( boost::begin (r), boost::end (r), val );
+} 
+
+}} // namespace boost and algorithm
+
+#endif // BOOST_ALGORITHM_ALL_OF_HPP

include/boost/algorithm/cxx11/any_of.hpp

@@ -0,0 +1,89 @@
+/* 
+   Copyright (c) Marshall Clow 2008-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+/// \file
+/// \brief Test ranges to see if any elements match a value or predicate.
+/// \author Marshall Clow
+
+#ifndef BOOST_ALGORITHM_ANY_OF_HPP
+#define BOOST_ALGORITHM_ANY_OF_HPP
+
+#include <boost/range/begin.hpp>
+#include <boost/range/end.hpp>
+
+namespace boost { namespace algorithm {
+
+//  Use the C++11 versions of any_of if it is available
+#if __cplusplus >= 201103L
+using std::any_of;      // Section 25.2.2
+#else
+/// \fn any_of ( InputIterator first, InputIterator last, Predicate p )
+/// \return true if any of the elements in [first, last) satisfy the predicate
+/// \note returns false on an empty range
+/// 
+/// \param first The start of the input sequence
+/// \param last  One past the end of the input sequence
+/// \param p     A predicate for testing the elements of the sequence
+///
+template<typename InputIterator, typename Predicate> 
+bool any_of ( InputIterator first, InputIterator last, Predicate p ) 
+{
+    for ( ; first != last; ++first )
+        if ( p(*first)) 
+            return true;
+    return false; 
+} 
+#endif
+
+/// \fn any_of ( const Range &r, Predicate p )
+/// \return true if any elements in the range satisfy the predicate 'p'
+/// \note returns false on an empty range
+/// 
+/// \param r    The input range
+/// \param p    A predicate for testing the elements of the range
+///
+template<typename Range, typename Predicate> 
+bool any_of ( const Range &r, Predicate p )
+{
+    return boost::algorithm::any_of (boost::begin (r), boost::end (r), p);
+} 
+
+/// \fn any_of_equal ( InputIterator first, InputIterator last, const V &val )
+/// \return true if any of the elements in [first, last) are equal to 'val'
+/// \note returns false on an empty range
+/// 
+/// \param first The start of the input sequence
+/// \param last  One past the end of the input sequence
+/// \param val   A value to compare against
+///
+template<typename InputIterator, typename V> 
+bool any_of_equal ( InputIterator first, InputIterator last, const V &val ) 
+{
+    for ( ; first != last; ++first )
+        if ( val == *first )
+            return true;
+    return false; 
+} 
+
+/// \fn any_of_equal ( const Range &r, const V &val )
+/// \return true if any of the elements in the range are equal to 'val'
+/// \note returns false on an empty range
+/// 
+/// \param r     The input range
+/// \param val   A value to compare against
+///
+template<typename Range, typename V> 
+bool any_of_equal ( const Range &r, const V &val ) 
+{
+    return boost::algorithm::any_of_equal (boost::begin (r), boost::end (r), val);
+}
+
+}} // namespace boost and algorithm
+
+#endif // BOOST_ALGORITHM_ANY_OF_HPP

include/boost/algorithm/cxx11/copy_if.hpp

@@ -0,0 +1,133 @@
+/* 
+   Copyright (c) Marshall Clow 2008-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+*/
+
+/// \file  copy_if.hpp
+/// \brief Copy a subset of a sequence to a new sequence
+/// \author Marshall Clow
+
+#ifndef BOOST_ALGORITHM_COPY_IF_HPP
+#define BOOST_ALGORITHM_COPY_IF_HPP
+
+#include <algorithm>	// for std::copy_if, if available
+#include <boost/range/begin.hpp>
+#include <boost/range/end.hpp>
+
+namespace boost { namespace algorithm {
+
+#if __cplusplus >= 201103L
+//  Use the C++11 versions of copy_if if it is available
+using std::copy_if;         // Section 25.3.1
+#else
+/// \fn copy_if ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
+/// \brief Copies all the elements from the input range that satisfy the
+/// predicate to the output range.
+/// \return The updated output iterator
+/// 
+/// \param first    The start of the input sequence
+/// \param last     One past the end of the input sequence
+/// \param result   An output iterator to write the results into
+/// \param p        A predicate for testing the elements of the range
+/// \note           This function is part of the C++2011 standard library.
+///  We will use the standard one if it is available, 
+///  otherwise we have our own implementation.
+template<typename InputIterator, typename OutputIterator, typename Predicate> 
+OutputIterator copy_if ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
+{
+    for ( ; first != last; ++first )
+        if (p(*first))
+            *result++ = first;
+    return result;
+}
+#endif
+
+/// \fn copy_if ( const Range &r, OutputIterator result, Predicate p )
+/// \brief Copies all the elements from the input range that satisfy the
+/// predicate to the output range.
+/// \return The updated output iterator
+/// 
+/// \param r        The input range
+/// \param result   An output iterator to write the results into
+/// \param p        A predicate for testing the elements of the range
+///
+template<typename Range, typename OutputIterator, typename Predicate>
+OutputIterator copy_if ( const Range &r, OutputIterator result, Predicate p )
+{
+    return boost::algorithm::copy_if (boost::begin (r), boost::end(r), result, p);
+}
+
+
+/// \fn copy_while ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
+/// \brief Copies all the elements at the start of the input range that
+///     satisfy the predicate to the output range.
+/// \return The updated output iterator
+/// 
+/// \param first    The start of the input sequence
+/// \param last     One past the end of the input sequence
+/// \param result   An output iterator to write the results into
+/// \param p        A predicate for testing the elements of the range
+///
+template<typename InputIterator, typename OutputIterator, typename Predicate> 
+OutputIterator copy_while ( InputIterator first, InputIterator last, 
+                                OutputIterator result, Predicate p )
+{
+    for ( ; first != last && p(*first); ++first )
+        *result++ = first;
+    return result;
+}
+
+/// \fn copy_while ( const Range &r, OutputIterator result, Predicate p )
+/// \brief Copies all the elements at the start of the input range that
+///     satisfy the predicate to the output range.
+/// \return The updated output iterator
+/// 
+/// \param r        The input range
+/// \param result   An output iterator to write the results into
+/// \param p        A predicate for testing the elements of the range
+///
+template<typename Range, typename OutputIterator, typename Predicate>
+OutputIterator copy_while ( const Range &r, OutputIterator result, Predicate p )
+{
+    return boost::algorithm::copy_while (boost::begin (r), boost::end(r), result, p);
+}
+
+
+/// \fn copy_until ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
+/// \brief Copies all the elements at the start of the input range that do not
+///     satisfy the predicate to the output range.
+/// \return The updated output iterator
+/// 
+/// \param first    The start of the input sequence
+/// \param last     One past the end of the input sequence
+/// \param result   An output iterator to write the results into
+/// \param p        A predicate for testing the elements of the range
+///
+template<typename InputIterator, typename OutputIterator, typename Predicate> 
+OutputIterator copy_until ( InputIterator first, InputIterator last, OutputIterator result, Predicate p )
+{
+    for ( ; first != last && !p(*first); ++first )
+        *result++ = first;
+    return result;
+}
+
+/// \fn copy_until ( const Range &r, OutputIterator result, Predicate p )
+/// \brief Copies all the elements at the start of the input range that do not
+///     satisfy the predicate to the output range.
+/// \return The updated output iterator
+/// 
+/// \param r        The input range
+/// \param result   An output iterator to write the results into
+/// \param p        A predicate for testing the elements of the range
+///
+template<typename Range, typename OutputIterator, typename Predicate>
+OutputIterator copy_until ( const Range &r, OutputIterator result, Predicate p )
+{
+    return boost::algorithm::copy_until (boost::begin (r), boost::end(r), result, p);
+}
+
+}} // namespace boost and algorithm
+
+#endif  // BOOST_ALGORITHM_COPY_IF_HPP

include/boost/algorithm/cxx11/copy_n.hpp

@@ -0,0 +1,44 @@
+/* 
+   Copyright (c) Marshall Clow 2011-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+*/
+
+/// \file  copy_n.hpp
+/// \brief Copy n items from one sequence to another
+/// \author Marshall Clow
+
+#ifndef BOOST_ALGORITHM_COPY_N_HPP
+#define BOOST_ALGORITHM_COPY_N_HPP
+
+#include <algorithm>    // for std::copy_n, if available
+
+namespace boost { namespace algorithm {
+
+#if __cplusplus >= 201103L
+//  Use the C++11 versions of copy_n if it is available
+using std::copy_n;          // Section 25.3.1
+#else
+/// \fn copy_n ( InputIterator first, Size n, OutputIterator result )
+/// \brief Copies exactly n (n > 0) elements from the range starting at first to
+///     the range starting at result.
+/// \return         The updated output iterator
+/// 
+/// \param first    The start of the input sequence
+/// \param n        The number of elements to copy
+/// \param result   An output iterator to write the results into
+/// \note           This function is part of the C++2011 standard library.
+///  We will use the standard one if it is available, 
+///     otherwise we have our own implementation.
+template <typename InputIterator, typename Size, typename OutputIterator>
+OutputIterator copy_n ( InputIterator first, Size n, OutputIterator result )
+{
+    for ( ; n > 0; --n, ++first, ++result )
+        *result = *first;
+    return result;
+}
+#endif
+}} // namespace boost and algorithm
+
+#endif  // BOOST_ALGORITHM_COPY_IF_HPP

include/boost/algorithm/cxx11/find_if_not.hpp

@@ -0,0 +1,60 @@
+/* 
+   Copyright (c) Marshall Clow 2011-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+*/
+
+/// \file  find_if_not.hpp
+/// \brief Find the first element in a sequence that does not satisfy a predicate.
+/// \author Marshall Clow
+
+#ifndef BOOST_ALGORITHM_FIND_IF_NOT_HPP
+#define BOOST_ALGORITHM_FIND_IF_NOT_HPP
+
+#include <algorithm>    // for std::find_if_not, if it exists
+
+#include <boost/range/begin.hpp>
+#include <boost/range/end.hpp>
+
+namespace boost { namespace algorithm {
+
+#if __cplusplus >= 201103L
+//  Use the C++11 versions of find_if_not if it is available
+using std::find_if_not;      // Section 25.2.5
+#else
+/// \fn find_if_not(InputIterator first, InputIterator last, Predicate p)
+/// \brief Finds the first element in the sequence that does not satisfy the predicate.
+/// \return         The iterator pointing to the desired element.
+/// 
+/// \param first    The start of the input sequence
+/// \param last     One past the end of the input sequence
+/// \param p        A predicate for testing the elements of the range
+/// \note           This function is part of the C++2011 standard library.
+///  We will use the standard one if it is available, 
+///  otherwise we have our own implementation.
+template<typename InputIterator, typename Predicate> 
+InputIterator find_if_not ( InputIterator first, InputIterator last, Predicate p )
+{
+    for ( ; first != last; ++first )
+        if ( !p(*first))
+            break;
+    return first;
+}
+#endif
+
+/// \fn find_if_not ( const Range &r, Predicate p )
+/// \brief Finds the first element in the sequence that does not satisfy the predicate.
+/// \return         The iterator pointing to the desired element.
+/// 
+/// \param r        The input range
+/// \param p        A predicate for testing the elements of the range
+///
+template<typename Range, typename Predicate>
+typename boost::range_iterator<const Range>::type find_if_not ( const Range &r, Predicate p )
+{
+    return boost::algorithm::find_if_not (boost::begin (r), boost::end(r), p);
+}
+
+}}
+#endif  // BOOST_ALGORITHM_FIND_IF_NOT_HPP

include/boost/algorithm/cxx11/iota.hpp

@@ -0,0 +1,74 @@
+/* 
+   Copyright (c) Marshall Clow 2008-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+*/
+
+/// \file  iota.hpp
+/// \brief Generate an increasing series
+/// \author Marshall Clow
+
+#ifndef BOOST_ALGORITHM_IOTA_HPP
+#define BOOST_ALGORITHM_IOTA_HPP
+
+#include <numeric>
+
+#include <boost/range/begin.hpp>
+#include <boost/range/end.hpp>
+
+namespace boost { namespace algorithm {
+
+#if __cplusplus >= 201103L
+//  Use the C++11 versions of iota if it is available
+using std::iota;      // Section 26.7.6
+#else
+/// \fn iota ( ForwardIterator first, ForwardIterator last, T value )
+/// \brief Generates an increasing sequence of values, and stores them in [first, last)
+/// 
+/// \param first    The start of the input sequence
+/// \param last     One past the end of the input sequence
+/// \param value    The initial value of the sequence to be generated
+/// \note           This function is part of the C++2011 standard library.
+///  We will use the standard one if it is available, 
+///  otherwise we have our own implementation.
+template <typename ForwardIterator, typename T>
+void iota ( ForwardIterator first, ForwardIterator last, T value )
+{
+    for ( ; first != last; ++first, ++value )
+        *first = value;
+}
+#endif
+
+/// \fn iota ( Range &r, T value )
+/// \brief Generates an increasing sequence of values, and stores them in the input Range.
+/// 
+/// \param r        The input range
+/// \param value    The initial value of the sequence to be generated
+///
+template <typename Range, typename T>
+void iota ( Range &r, T value )
+{
+    boost::algorithm::iota (boost::begin(r), boost::end(r), value);
+}
+
+
+/// \fn iota_n ( OutputIterator out, T value, std::size_t n )
+/// \brief Generates an increasing sequence of values, and stores them in the input Range.
+/// 
+/// \param out      An output iterator to write the results into
+/// \param value    The initial value of the sequence to be generated
+/// \param n        The number of items to write
+///
+template <typename OutputIterator, typename T>
+OutputIterator iota_n ( OutputIterator out, T value, std::size_t n )
+{
+    while ( n-- > 0 )
+        *out++ = value++;
+
+    return out;
+}
+
+}}
+
+#endif  // BOOST_ALGORITHM_IOTA_HPP

include/boost/algorithm/cxx11/is_partitioned.hpp

@@ -0,0 +1,65 @@
+/* 
+   Copyright (c) Marshall Clow 2011-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+*/
+
+/// \file  is_partitioned.hpp
+/// \brief Tell if a sequence is partitioned
+/// \author Marshall Clow
+
+#ifndef BOOST_ALGORITHM_IS_PARTITIONED_HPP
+#define BOOST_ALGORITHM_IS_PARTITIONED_HPP
+
+#include <algorithm>	// for std::is_partitioned, if available
+
+#include <boost/range/begin.hpp>
+#include <boost/range/end.hpp>
+
+namespace boost { namespace algorithm {
+
+#if __cplusplus >= 201103L
+//  Use the C++11 versions of iota if it is available
+using std::is_partitioned;      // Section 25.3.13
+#else
+/// \fn is_partitioned ( InputIterator first, InputIterator last, UnaryPredicate p )
+/// \brief Tests to see if a sequence is partititioned according to a predicate
+/// 
+/// \param first    The start of the input sequence
+/// \param last     One past the end of the input sequence
+/// \param p        The predicicate to test the values with
+/// \note           This function is part of the C++2011 standard library.
+///  We will use the standard one if it is available, 
+///  otherwise we have our own implementation.
+template <typename InputIterator, typename UnaryPredicate>
+bool is_partitioned ( InputIterator first, InputIterator last, UnaryPredicate p )
+{
+//	Run through the part that satisfy the predicate
+    for ( ; first != last; ++first )
+        if ( !p (*first))
+        	break;
+//	Now the part that does not satisfy the predicate
+    for ( ; first != last; ++first )
+        if ( p (*first))
+        	return false;
+    return true;
+}
+#endif
+
+/// \fn is_partitioned ( const Range &r, UnaryPredicate p )
+/// \brief Generates an increasing sequence of values, and stores them in the input Range.
+/// 
+/// \param r        The input range
+/// \param p        The predicicate to test the values with
+///
+template <typename Range, typename UnaryPredicate>
+bool is_partitioned ( const Range &r, UnaryPredicate p )
+{
+    return boost::algorithm::is_partitioned (boost::begin(r), boost::end(r), p);
+}
+
+
+}}
+
+#endif  // BOOST_ALGORITHM_IS_PARTITIONED_HPP

include/boost/algorithm/cxx11/is_permutation.hpp

@@ -0,0 +1,139 @@
+/*
+   Copyright (c) Marshall Clow 2011-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+*/
+
+/// \file  is_permutation.hpp
+/// \brief Is a sequence a permutation of another sequence
+/// \author Marshall Clow
+
+#ifndef BOOST_ALGORITHM_IS_PERMUTATION_HPP
+#define BOOST_ALGORITHM_IS_PERMUTATION_HPP
+
+#include <algorithm>    // for std::less, tie, mismatch and is_permutation (if available)
+#include <utility>      // for std::make_pair
+#include <functional>   // for std::equal_to
+#include <iterator>
+
+#include <boost/range/begin.hpp>
+#include <boost/range/end.hpp>
+#include <boost/utility/enable_if.hpp>
+#include <boost/type_traits/is_same.hpp>
+#include <boost/tr1/tr1/tuple>      // for tie
+
+namespace boost { namespace algorithm {
+
+#if __cplusplus >= 201103L
+//  Use the C++11 versions of is_permutation if it is available
+using std::is_permutation;              // Section 25.2.12
+#else
+/// \cond DOXYGEN_HIDE
+namespace detail {
+    template <typename Predicate, typename Iterator>
+    struct value_predicate {
+        value_predicate ( Predicate p, Iterator it ) : p_ ( p ), it_ ( it ) {}
+
+        template <typename T1>
+        bool operator () ( const T1 &t1 ) const { return p_ ( *it_, t1 ); }
+    private:
+        Predicate &p_;
+        Iterator it_;
+        };
+}
+/// \endcond
+
+
+/// \fn is_permutation ( ForwardIterator1 first, ForwardIterator1 last, ForwardIterator2 first2, BinaryPredicate p )
+/// \brief Tests to see if a the sequence [first,last) is a permutation of the sequence starting at first2
+///
+/// \param first    The start of the input sequence
+/// \param last     One past the end of the input sequence
+/// \param first2   The start of the second sequence
+/// \param p        The predicate to compare elements with
+///
+/// \note           This function is part of the C++2011 standard library.
+///  We will use the standard one if it is available,
+///     otherwise we have our own implementation.
+template< class ForwardIterator1, class ForwardIterator2, class BinaryPredicate >
+bool is_permutation ( ForwardIterator1 first1, ForwardIterator1 last1,
+                      ForwardIterator2 first2, BinaryPredicate p )
+{
+//  Skip the common prefix (if any)
+//  std::tie (first1, first2) = std::mismatch (first1, last1, first2, p);
+    std::pair<ForwardIterator1, ForwardIterator2> eq = std::mismatch (first1, last1, first2, p);
+    first1 = eq.first;
+    first2 = eq.second;
+    if ( first1 != last1 ) {
+    //  Create last2
+        ForwardIterator2 last2 = first2;
+        std::advance ( last2, std::distance (first1, last1));
+
+    //  for each unique value in the sequence [first1,last1), count how many times
+    //  it occurs, and make sure it occurs the same number of times in [first2, last2)
+        for ( ForwardIterator1 iter = first1; iter != last1; ++iter ) {
+            detail::value_predicate<BinaryPredicate, ForwardIterator1> pred ( p, iter );
+
+        /*  For each value we haven't seen yet... */
+            if ( std::find_if ( first1, iter, pred ) == iter ) {
+                std::size_t dest_count = std::count_if ( first2, last2, pred );
+                if ( dest_count == 0 || dest_count != (std::size_t) std::count_if ( iter, last1, pred ))
+                    return false;
+                }
+            }
+        }
+
+    return true;
+}
+
+/// \fn is_permutation ( ForwardIterator1 first, ForwardIterator1 last, ForwardIterator2 first2 )
+/// \brief Tests to see if a the sequence [first,last) is a permutation of the sequence starting at first2
+///
+/// \param first    The start of the input sequence
+/// \param last     One past the end of the input sequence
+/// \param first2   The start of the second sequence
+/// \note           This function is part of the C++2011 standard library.
+///  We will use the standard one if it is available,
+///     otherwise we have our own implementation.
+template< class ForwardIterator1, class ForwardIterator2 >
+bool is_permutation ( ForwardIterator1 first, ForwardIterator1 last, ForwardIterator2 first2 )
+{
+//  How should I deal with the idea that ForwardIterator1::value_type
+//  and ForwardIterator2::value_type could be different? Define my own comparison predicate?
+    return boost::algorithm::is_permutation ( first, last, first2,
+                          std::equal_to<typename std::iterator_traits<ForwardIterator1>::value_type> ());
+}
+
+#endif
+
+/// \fn is_permutation ( const Range &r, ForwardIterator first2 )
+/// \brief Tests to see if a the sequence [first,last) is a permutation of the sequence starting at first2
+///
+/// \param r        The input range
+/// \param first2   The start of the second sequence
+template <typename Range, typename ForwardIterator>
+bool is_permutation ( const Range &r, ForwardIterator first2 )
+{
+    return boost::algorithm::is_permutation (boost::begin (r), boost::end (r), first2 );
+}
+
+/// \fn is_permutation ( const Range &r, ForwardIterator first2, BinaryPredicate pred )
+/// \brief Tests to see if a the sequence [first,last) is a permutation of the sequence starting at first2
+///
+/// \param r        The input range
+/// \param first2   The start of the second sequence
+/// \param pred     The predicate to compare elements with
+///
+//  Disable this template when the first two parameters are the same type
+//  That way the non-range version will be chosen.
+template <typename Range, typename ForwardIterator, typename BinaryPredicate>
+typename boost::disable_if_c<boost::is_same<Range, ForwardIterator>::value, bool>::type
+is_permutation ( const Range &r, ForwardIterator first2, BinaryPredicate pred )
+{
+    return boost::algorithm::is_permutation (boost::begin (r), boost::end (r), first2, pred );
+}
+
+}}
+
+#endif  // BOOST_ALGORITHM_IS_PERMUTATION_HPP

include/boost/algorithm/cxx11/none_of.hpp

@@ -0,0 +1,87 @@
+/* 
+   Copyright (c) Marshall Clow 2008-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+*/
+
+/// \file  none_of.hpp
+/// \brief Test ranges to see if no elements match a value or predicate.
+/// \author Marshall Clow
+
+#ifndef BOOST_ALGORITHM_NONE_OF_HPP
+#define BOOST_ALGORITHM_NONE_OF_HPP
+
+#include <boost/range/begin.hpp>
+#include <boost/range/end.hpp>
+
+namespace boost { namespace algorithm {
+
+//  Use the C++11 versions of the none_of if it is available
+#if __cplusplus >= 201103L
+using std::none_of;     // Section 25.2.3
+#else
+/// \fn none_of ( InputIterator first, InputIterator last, Predicate p )
+/// \return true if none of the elements in [first, last) satisfy the predicate 'p'
+/// \note returns true on an empty range
+/// 
+/// \param first The start of the input sequence
+/// \param last  One past the end of the input sequence
+/// \param p     A predicate for testing the elements of the sequence
+///
+template<typename InputIterator, typename Predicate> 
+bool none_of ( InputIterator first, InputIterator last, Predicate p )
+{
+for ( ; first != last; ++first )
+    if ( p(*first)) 
+        return false;
+    return true;
+} 
+#endif
+
+/// \fn none_of ( const Range &r, Predicate p )
+/// \return true if none of the elements in the range satisfy the predicate 'p'
+/// \note returns true on an empty range
+/// 
+/// \param r     The input range
+/// \param p     A predicate for testing the elements of the range
+///
+template<typename Range, typename Predicate> 
+bool none_of ( const Range &r, Predicate p )
+{
+    return boost::algorithm::none_of (boost::begin (r), boost::end (r), p );
+} 
+
+/// \fn none_of_equal ( InputIterator first, InputIterator last, const V &val )
+/// \return true if none of the elements in [first, last) are equal to 'val'
+/// \note returns true on an empty range
+/// 
+/// \param first The start of the input sequence
+/// \param last  One past the end of the input sequence
+/// \param val   A value to compare against
+///
+template<typename InputIterator, typename V> 
+bool none_of_equal ( InputIterator first, InputIterator last, const V &val ) 
+{
+    for ( ; first != last; ++first )
+        if ( val == *first )
+            return false;
+    return true; 
+} 
+
+/// \fn none_of_equal ( const Range &r, const V &val )
+/// \return true if none of the elements in the range are equal to 'val'
+/// \note returns true on an empty range
+/// 
+/// \param r     The input range
+/// \param val   A value to compare against
+///
+template<typename Range, typename V> 
+bool none_of_equal ( const Range &r, const V & val ) 
+{
+    return boost::algorithm::none_of_equal (boost::begin (r), boost::end (r), val);
+} 
+
+}} // namespace boost and algorithm
+
+#endif // BOOST_ALGORITHM_NONE_OF_HPP

include/boost/algorithm/cxx11/one_of.hpp

@@ -0,0 +1,82 @@
+/* 
+   Copyright (c) Marshall Clow 2008-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+*/
+
+/// \file one_of.hpp
+/// \brief Test ranges to see if only one element matches a value or predicate.
+/// \author Marshall Clow
+
+#ifndef BOOST_ALGORITHM_ONE_OF_HPP
+#define BOOST_ALGORITHM_ONE_OF_HPP
+
+#include <algorithm>            // for std::find and std::find_if
+#include <boost/algorithm/cxx11/none_of.hpp>
+
+#include <boost/range/begin.hpp>
+#include <boost/range/end.hpp>
+
+namespace boost { namespace algorithm {
+
+/// \fn one_of ( InputIterator first, InputIterator last, Predicate p )
+/// \return true if the predicate 'p' is true for exactly one item in [first, last).
+/// 
+/// \param first The start of the input sequence
+/// \param last  One past the end of the input sequence
+/// \param p     A predicate for testing the elements of the sequence
+///
+template<typename InputIterator, typename Predicate> 
+bool one_of ( InputIterator first, InputIterator last, Predicate p )
+{
+    InputIterator i = std::find_if (first, last, p);
+    if (i == last)
+        return false;    // Didn't occur at all
+    return boost::algorithm::none_of (++i, last, p);
+}
+
+/// \fn one_of ( const Range &r, Predicate p )
+/// \return true if the predicate 'p' is true for exactly one item in the range.
+/// 
+/// \param r    The input range
+/// \param p    A predicate for testing the elements of the range
+///
+template<typename Range, typename Predicate> 
+bool one_of ( const Range &r, Predicate p ) 
+{
+    return boost::algorithm::one_of ( boost::begin (r), boost::end (r), p );
+}
+
+
+/// \fn one_of_equal ( InputIterator first, InputIterator last, const V &val )
+/// \return true if the value 'val' exists only once in [first, last).
+/// 
+/// \param first    The start of the input sequence
+/// \param last     One past the end of the input sequence
+/// \param val      A value to compare against
+///
+template<typename InputIterator, typename V> 
+bool one_of_equal ( InputIterator first, InputIterator last, const V &val )
+{
+    InputIterator i = std::find (first, last, val); // find first occurrence of 'val'
+    if (i == last)
+        return false;                    // Didn't occur at all
+    return boost::algorithm::none_of_equal (++i, last, val);
+}
+
+/// \fn one_of_equal ( const Range &r, const V &val )
+/// \return true if the value 'val' exists only once in the range.
+/// 
+/// \param r    The input range
+/// \param val  A value to compare against
+///
+template<typename Range, typename V> 
+bool one_of_equal ( const Range &r, const V &val )
+{
+    return boost::algorithm::one_of_equal ( boost::begin (r), boost::end (r), val );
+} 
+
+}} // namespace boost and algorithm
+
+#endif // BOOST_ALGORITHM_ALL_HPP

include/boost/algorithm/cxx11/ordered.hpp

@@ -0,0 +1,286 @@
+//  Copyright (c) 2010 Nuovation System Designs, LLC
+//    Grant Erickson <gerickson@nuovations.com>
+//
+//  Reworked somewhat by Marshall Clow; August 2010
+//  
+//  Distributed under the Boost Software License, Version 1.0. (See
+//  accompanying file LICENSE_1_0.txt or copy at
+//  http://www.boost.org/LICENSE_1_0.txt)
+//
+//  See http://www.boost.org/ for latest version.
+//
+
+#ifndef BOOST_ALGORITHM_ORDERED_HPP
+#define BOOST_ALGORITHM_ORDERED_HPP
+
+#include <algorithm>
+#include <functional>
+#include <iterator>
+
+#include <boost/range/begin.hpp>
+#include <boost/range/end.hpp>
+
+#include <boost/utility/enable_if.hpp>
+#include <boost/type_traits/is_same.hpp>
+
+namespace boost { namespace algorithm {
+
+#if __cplusplus >= 201103L
+//  Use the C++11 versions of iota if it is available
+using std::is_sorted_until; // Section 25.4.1.5
+using std::is_sorted;       // Section 25.4.1.5
+#else
+/// \fn is_sorted_until ( ForwardIterator first, ForwardIterator last, Pred p )
+/// \return the point in the sequence [first, last) where the elements are unordered
+///     (according to the comparison predicate 'p').
+/// 
+/// \param first The start of the sequence to be tested.
+/// \param last  One past the end of the sequence
+/// \param p     A binary predicate that returns true if two elements are ordered.
+///
+    template <typename ForwardIterator, typename Pred>
+    ForwardIterator is_sorted_until ( ForwardIterator first, ForwardIterator last, Pred p )
+    {
+        if ( first == last ) return last;  // the empty sequence is ordered
+        ForwardIterator next = first;
+        while ( ++next != last )
+        {
+            if ( !p ( *first, *next ))
+                return next;
+            first = next;
+        }
+        return last;    
+    }
+
+/// \fn is_sorted_until ( ForwardIterator first, ForwardIterator last )
+/// \return the point in the sequence [first, last) where the elements are unordered
+/// 
+/// \param first The start of the sequence to be tested.
+/// \param last  One past the end of the sequence
+///
+    template <typename ForwardIterator>
+    ForwardIterator is_sorted_until ( ForwardIterator first, ForwardIterator last )
+    {
+        typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
+        return boost::algorithm::is_sorted_until ( first, last, std::less_equal<value_type>());
+    }
+
+
+/// \fn is_sorted ( ForwardIterator first, ForwardIterator last, Pred p )
+/// \return whether or not the entire sequence is sorted
+/// 
+/// \param first The start of the sequence to be tested.
+/// \param last  One past the end of the sequence
+/// \param p     A binary predicate that returns true if two elements are ordered.
+///
+    template <typename ForwardIterator, typename Pred>
+    bool is_sorted ( ForwardIterator first, ForwardIterator last, Pred p )
+    {
+        return boost::algorithm::is_sorted_until (first, last, p) == last;
+    }
+
+/// \fn is_sorted ( ForwardIterator first, ForwardIterator last )
+/// \return whether or not the entire sequence is sorted
+/// 
+/// \param first The start of the sequence to be tested.
+/// \param last  One past the end of the sequence
+///
+    template <typename ForwardIterator>
+    bool is_sorted ( ForwardIterator first, ForwardIterator last )
+    {
+        return boost::algorithm::is_sorted_until (first, last) == last;
+    }
+#endif
+
+///
+///	-- Range based versions of the C++11 functions
+///
+
+/// \fn is_sorted_until ( const R &range, Pred p )
+/// \return the point in the range R where the elements are unordered
+///     (according to the comparison predicate 'p').
+/// 
+/// \param range The range to be tested.
+/// \param p     A binary predicate that returns true if two elements are ordered.
+///
+    template <typename R, typename Pred>
+    typename boost::lazy_disable_if_c<
+        boost::is_same<R, Pred>::value, 
+        typename boost::range_iterator<const R> 
+    >::type is_sorted_until ( const R &range, Pred p )
+    {
+        return boost::algorithm::is_sorted_until ( boost::begin ( range ), boost::end ( range ), p );
+    }
+
+
+/// \fn is_sorted_until ( const R &range )
+/// \return the point in the range R where the elements are unordered
+/// 
+/// \param range The range to be tested.
+///
+    template <typename R>
+    typename boost::range_iterator<const R>::type is_sorted_until ( const R &range )
+    {
+        return boost::algorithm::is_sorted_until ( boost::begin ( range ), boost::end ( range ));
+    }
+
+
+/// \fn is_sorted ( const R &range, Pred p )
+/// \return whether or not the entire range R is sorted
+///     (according to the comparison predicate 'p').
+/// 
+/// \param range The range to be tested.
+/// \param p     A binary predicate that returns true if two elements are ordered.
+///
+    template <typename R, typename Pred>
+    bool is_sorted ( const R &range, Pred p )
+    {
+        return boost::algorithm::is_sorted ( boost::begin ( range ), boost::end ( range ), p );
+    }
+
+
+/// \fn is_sorted ( const R &range )
+/// \return whether or not the entire range R is sorted
+/// 
+/// \param range The range to be tested.
+///
+    template <typename R, typename Pred>
+    bool is_sorted ( const R &range )
+    {
+        return boost::algorithm::is_sorted ( boost::begin ( range ), boost::end ( range ));
+    }
+
+
+///
+///	-- Range based versions of the C++11 functions
+///
+
+/// \fn is_increasing ( ForwardIterator first, ForwardIterator last )
+/// \return true if the entire sequence is increasing; i.e, each item is greater than or  
+///     equal to the previous one.
+/// 
+/// \param first The start of the sequence to be tested.
+/// \param last  One past the end of the sequence
+///
+/// \note This function will return true for sequences that contain items that compare
+///     equal. If that is not what you intended, you should use is_strictly_increasing instead.
+    template <typename ForwardIterator>
+    bool is_increasing ( ForwardIterator first, ForwardIterator last )
+    {
+        typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
+        return boost::algorithm::is_sorted (first, last, std::less_equal<value_type>());
+    }
+
+
+/// \fn is_increasing ( const R &range )
+/// \return true if the entire sequence is increasing; i.e, each item is greater than or  
+///     equal to the previous one.
+/// 
+/// \param range The range to be tested.
+///
+/// \note This function will return true for sequences that contain items that compare
+///     equal. If that is not what you intended, you should use is_strictly_increasing instead.
+    template <typename R>
+    bool is_increasing ( const R &range )
+    {
+        return is_increasing ( boost::begin ( range ), boost::end ( range ));
+    }
+
+
+
+/// \fn is_decreasing ( ForwardIterator first, ForwardIterator last )
+/// \return true if the entire sequence is decreasing; i.e, each item is less than 
+///     or equal to the previous one.
+/// 
+/// \param first The start of the sequence to be tested.
+/// \param last  One past the end of the sequence
+///
+/// \note This function will return true for sequences that contain items that compare
+///     equal. If that is not what you intended, you should use is_strictly_decreasing instead.
+    template <typename ForwardIterator>
+    bool is_decreasing ( ForwardIterator first, ForwardIterator last )
+    {
+        typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
+        return boost::algorithm::is_sorted (first, last, std::greater_equal<value_type>());
+    }
+
+/// \fn is_decreasing ( const R &range )
+/// \return true if the entire sequence is decreasing; i.e, each item is less than 
+///     or equal to the previous one.
+/// 
+/// \param range The range to be tested.
+///
+/// \note This function will return true for sequences that contain items that compare
+///     equal. If that is not what you intended, you should use is_strictly_decreasing instead.
+    template <typename R>
+    bool is_decreasing ( const R &range )
+    {
+        return is_decreasing ( boost::begin ( range ), boost::end ( range ));
+    }
+
+
+
+/// \fn is_strictly_increasing ( ForwardIterator first, ForwardIterator last )
+/// \return true if the entire sequence is strictly increasing; i.e, each item is greater
+///     than the previous one
+/// 
+/// \param first The start of the sequence to be tested.
+/// \param last  One past the end of the sequence
+///
+/// \note This function will return false for sequences that contain items that compare
+///     equal. If that is not what you intended, you should use is_increasing instead.
+    template <typename ForwardIterator>
+    bool is_strictly_increasing ( ForwardIterator first, ForwardIterator last )
+    {
+        typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
+        return boost::algorithm::is_sorted (first, last, std::less<value_type>());
+    }
+
+/// \fn is_strictly_increasing ( const R &range )
+/// \return true if the entire sequence is strictly increasing; i.e, each item is greater
+///     than the previous one
+/// 
+/// \param range The range to be tested.
+///
+/// \note This function will return false for sequences that contain items that compare
+///     equal. If that is not what you intended, you should use is_increasing instead.
+    template <typename R>
+    bool is_strictly_increasing ( const R &range )
+    {
+        return is_strictly_increasing ( boost::begin ( range ), boost::end ( range ));
+    }
+
+
+/// \fn is_strictly_decreasing ( ForwardIterator first, ForwardIterator last )
+/// \return true if the entire sequence is strictly decreasing; i.e, each item is less than
+///     the previous one
+/// 
+/// \param first The start of the sequence to be tested.
+/// \param last  One past the end of the sequence
+///
+/// \note This function will return false for sequences that contain items that compare
+///     equal. If that is not what you intended, you should use is_decreasing instead.
+    template <typename ForwardIterator>
+    bool is_strictly_decreasing ( ForwardIterator first, ForwardIterator last )
+    {
+        typedef typename std::iterator_traits<ForwardIterator>::value_type value_type;
+        return boost::algorithm::is_sorted (first, last, std::greater<value_type>());
+    }
+
+/// \fn is_strictly_decreasing ( const R &range )
+/// \return true if the entire sequence is strictly decreasing; i.e, each item is less than
+///     the previous one
+/// 
+/// \param range The range to be tested.
+///
+/// \note This function will return false for sequences that contain items that compare
+///     equal. If that is not what you intended, you should use is_decreasing instead.
+    template <typename R>
+    bool is_strictly_decreasing ( const R &range )
+    {
+        return is_strictly_decreasing ( boost::begin ( range ), boost::end ( range ));
+    }
+
+}} // namespace boost
+
+#endif  // BOOST_ALGORITHM_ORDERED_HPP

include/boost/algorithm/cxx11/partition_copy.hpp

@@ -0,0 +1,77 @@
+/* 
+   Copyright (c) Marshall Clow 2011-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+*/
+
+/// \file  partition_copy.hpp
+/// \brief Copy a subset of a sequence to a new sequence
+/// \author Marshall Clow
+
+#ifndef BOOST_ALGORITHM_PARTITION_COPY_HPP
+#define BOOST_ALGORITHM_PARTITION_COPY_HPP
+
+#include <utility>  // for make_pair
+
+#include <boost/range/begin.hpp>
+#include <boost/range/end.hpp>
+
+namespace boost { namespace algorithm {
+
+#if __cplusplus >= 201103L
+//  Use the C++11 versions of partition_copy if it is available
+using std::partition_copy;  // Section 25.3.13
+#else
+/// \fn partition_copy ( InputIterator first, InputIterator last,
+///     OutputIterator1 out_true, OutputIterator2 out_false, UnaryPredicate p )
+/// \brief Copies the elements that satisfy the predicate p from the range [first, last) 
+///     to the range beginning at d_first_true, and
+///     copies the elements that do not satisfy p to the range beginning at d_first_false.
+///
+/// 
+/// \param first     The start of the input sequence
+/// \param last      One past the end of the input sequence
+/// \param out_true  An output iterator to write the elements that satisfy the predicate into
+/// \param out_false An output iterator to write the elements that do not satisfy the predicate into
+/// \param p         A predicate for dividing the elements of the input sequence.
+///
+/// \note            This function is part of the C++2011 standard library.
+///  We will use the standard one if it is available, 
+///  otherwise we have our own implementation.
+template <typename InputIterator, 
+        typename OutputIterator1, typename OutputIterator2, typename UnaryPredicate>
+std::pair<OutputIterator1, OutputIterator2>
+partition_copy ( InputIterator first, InputIterator last,
+        OutputIterator1 out_true, OutputIterator2 out_false, UnaryPredicate p )
+{
+    for ( ; first != last; ++first )
+        if ( p (*first))
+            *out_true++ = *first;
+        else
+            *out_false++ = *first;
+    return std::pair<OutputIterator1, OutputIterator2> ( out_true, out_false );
+}
+#endif
+
+/// \fn partition_copy ( const Range &r, 
+///     OutputIterator1 out_true, OutputIterator2 out_false, UnaryPredicate p )
+/// 
+/// \param r         The input range
+/// \param out_true  An output iterator to write the elements that satisfy the predicate into
+/// \param out_false An output iterator to write the elements that do not satisfy the predicate into
+/// \param p         A predicate for dividing the elements of the input sequence.
+///
+template <typename Range, typename OutputIterator1, typename OutputIterator2, 
+            typename UnaryPredicate>
+std::pair<OutputIterator1, OutputIterator2>
+partition_copy ( const Range &r, OutputIterator1 out_true, OutputIterator2 out_false, 
+                                UnaryPredicate p )
+{
+    return boost::algorithm::partition_copy 
+                      (boost::begin(r), boost::end(r), out_true, out_false, p );
+}
+
+}} // namespace boost and algorithm
+
+#endif  // BOOST_ALGORITHM_PARTITION_COPY_HPP

include/boost/algorithm/cxx11/partition_point.hpp

@@ -0,0 +1,72 @@
+/* 
+   Copyright (c) Marshall Clow 2011-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+*/
+
+/// \file  partition_point.hpp
+/// \brief Find the partition point in a sequence
+/// \author Marshall Clow
+
+#ifndef BOOST_ALGORITHM_PARTITION_POINT_HPP
+#define BOOST_ALGORITHM_PARTITION_POINT_HPP
+
+#include <algorithm>	// for std::partition_point, if available
+
+#include <boost/range/begin.hpp>
+#include <boost/range/end.hpp>
+
+namespace boost { namespace algorithm {
+
+#if __cplusplus >= 201103L
+//  Use the C++11 versions of iota if it is available
+using std::partition_point;      // Section 25.3.13
+#else
+/// \fn partition_point ( ForwardIterator first, ForwardIterator last, Predicate p )
+/// \brief Given a partitioned range, returns the partition point, i.e, the first element 
+///		that does not satisfy p
+/// 
+/// \param first    The start of the input sequence
+/// \param last     One past the end of the input sequence
+/// \param p        The predicate to test the values with
+/// \note           This function is part of the C++2011 standard library.
+///  We will use the standard one if it is available, 
+///  otherwise we have our own implementation.
+template <typename ForwardIterator, typename Predicate>
+ForwardIterator partition_point ( ForwardIterator first, ForwardIterator last, Predicate p )
+{
+    std::size_t dist = std::distance ( first, last );
+    while ( first != last ) {
+        std::size_t d2 = dist / 2;
+        ForwardIterator ret_val = first;
+        std::advance (ret_val, d2);
+        if (p (*ret_val)) {
+            first = ++ret_val;
+            dist -= d2 + 1;
+            }
+        else {
+            last = ret_val;
+            dist = d2;
+            }
+        }
+    return first;
+}
+#endif
+
+/// \fn partition_point ( Range &r, Predicate p )
+/// \brief Given a partitioned range, returns the partition point
+/// 
+/// \param r        The input range
+/// \param p        The predicate to test the values with
+///
+template <typename Range, typename Predicate>
+typename boost::range_iterator<Range> partition_point ( Range &r, Predicate p )
+{
+    return boost::algorithm::partition_point (boost::begin(r), boost::end(r), p);
+}
+
+
+}}
+
+#endif  // BOOST_ALGORITHM_PARTITION_POINT_HPP

include/boost/algorithm/searching/boyer_moore.hpp

@@ -0,0 +1,268 @@
+/* 
+   Copyright (c) Marshall Clow 2010-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#ifndef BOOST_ALGORITHM_BOYER_MOORE_SEARCH_HPP
+#define BOOST_ALGORITHM_BOYER_MOORE_SEARCH_HPP
+
+#include <iterator>     // for std::iterator_traits
+
+#include <boost/assert.hpp>
+#include <boost/static_assert.hpp>
+
+#include <boost/range/begin.hpp>
+#include <boost/range/end.hpp>
+
+#include <boost/utility/enable_if.hpp>
+#include <boost/type_traits/is_same.hpp>
+
+#include <boost/algorithm/searching/detail/bm_traits.hpp>
+#include <boost/algorithm/searching/detail/debugging.hpp>
+
+namespace boost { namespace algorithm {
+
+/*
+    A templated version of the boyer-moore searching algorithm.
+    
+References:
+    http://www.cs.utexas.edu/users/moore/best-ideas/string-searching/
+    http://www.cs.utexas.edu/~moore/publications/fstrpos.pdf
+    
+Explanations:   boostinspect:noascii (test tool complains)
+    http://en.wikipedia.org/wiki/Boyer–Moore_string_search_algorithm
+    http://www.movsd.com/bm.htm
+    http://www.cs.ucdavis.edu/~gusfield/cs224f09/bnotes.pdf
+
+The Boyer-Moore search algorithm uses two tables, a "bad character" table
+to tell how far to skip ahead when it hits a character that is not in the pattern,
+and a "good character" table to tell how far to skip ahead when it hits a
+mismatch on a character that _is_ in the pattern.
+
+Requirements:
+        * Random access iterators
+        * The two iterator types (patIter and corpusIter) must 
+            "point to" the same underlying type and be comparable.
+        * Additional requirements may be imposed but the skip table, such as:
+        ** Numeric type (array-based skip table)
+        ** Hashable type (map-based skip table)
+*/
+
+    template <typename patIter, typename traits = detail::BM_traits<patIter> >
+    class boyer_moore {
+        typedef typename std::iterator_traits<patIter>::difference_type difference_type;
+    public:
+        boyer_moore ( patIter first, patIter last ) 
+                : pat_first ( first ), pat_last ( last ),
+                  k_pattern_length ( std::distance ( pat_first, pat_last )),
+                  skip_ ( k_pattern_length, -1 ),
+                  suffix_ ( k_pattern_length + 1 )
+            {
+            this->build_skip_table   ( first, last );
+            this->build_suffix_table ( first, last );
+            }
+            
+        ~boyer_moore () {}
+        
+        /// \fn operator ( corpusIter corpus_first, corpusIter corpus_last )
+        /// \brief Searches the corpus for the pattern that was passed into the constructor
+        /// 
+        /// \param corpus_first The start of the data to search (Random Access Iterator)
+        /// \param corpus_last  One past the end of the data to search
+        ///
+        template <typename corpusIter>
+        corpusIter operator () ( corpusIter corpus_first, corpusIter corpus_last ) const {
+            BOOST_STATIC_ASSERT (( boost::is_same<
+                                    typename std::iterator_traits<patIter>::value_type, 
+                                    typename std::iterator_traits<corpusIter>::value_type>::value ));
+
+            if ( corpus_first == corpus_last ) return corpus_last;  // if nothing to search, we didn't find it!
+            if (    pat_first ==    pat_last ) return corpus_first; // empty pattern matches at start
+
+            const difference_type k_corpus_length  = std::distance ( corpus_first, corpus_last );
+        //  If the pattern is larger than the corpus, we can't find it!
+            if ( k_corpus_length < k_pattern_length ) 
+                return corpus_last;
+
+        //  Do the search 
+            return this->do_search   ( corpus_first, corpus_last );
+            }
+            
+        template <typename Range>
+        typename boost::range_iterator<Range>::type operator () ( Range &r ) const {
+            return (*this) (boost::begin(r), boost::end(r));
+            }
+
+    private:
+/// \cond DOXYGEN_HIDE
+        patIter pat_first, pat_last;
+        const difference_type k_pattern_length;
+        typename traits::skip_table_t skip_;
+        std::vector <difference_type> suffix_;
+
+        /// \fn operator ( corpusIter corpus_first, corpusIter corpus_last, Pred p )
+        /// \brief Searches the corpus for the pattern that was passed into the constructor
+        /// 
+        /// \param corpus_first The start of the data to search (Random Access Iterator)
+        /// \param corpus_last  One past the end of the data to search
+        /// \param p            A predicate used for the search comparisons.
+        ///
+        template <typename corpusIter>
+        corpusIter do_search ( corpusIter corpus_first, corpusIter corpus_last ) const {
+        /*  ---- Do the matching ---- */
+            corpusIter curPos = corpus_first;
+            const corpusIter lastPos = corpus_last - k_pattern_length;
+            difference_type j, k, m;
+
+            while ( curPos <= lastPos ) {
+        /*  while ( std::distance ( curPos, corpus_last ) >= k_pattern_length ) { */
+            //  Do we match right where we are?
+                j = k_pattern_length;
+                while ( pat_first [j-1] == curPos [j-1] ) {
+                    j--;
+                //  We matched - we're done!
+                    if ( j == 0 )
+                        return curPos;
+                    }
+                
+            //  Since we didn't match, figure out how far to skip forward
+                k = skip_ [ curPos [ j - 1 ]];
+                m = j - k - 1;
+                if ( k < j && m > suffix_ [ j ] )
+                    curPos += m;
+                else
+                    curPos += suffix_ [ j ];
+                }
+        
+            return corpus_last;     // We didn't find anything
+            }
+
+
+        void build_skip_table ( patIter first, patIter last ) {
+            for ( std::size_t i = 0; first != last; ++first, ++i )
+                skip_.insert ( *first, i );
+            }
+        
+
+        template<typename Iter, typename Container>
+        void compute_bm_prefix ( Iter pat_first, Iter pat_last, Container &prefix ) {
+            const std::size_t count = std::distance ( pat_first, pat_last );
+            BOOST_ASSERT ( count > 0 );
+            BOOST_ASSERT ( prefix.size () == count );
+                            
+            prefix[0] = 0;
+            std::size_t k = 0;
+            for ( std::size_t i = 1; i < count; ++i ) {
+                BOOST_ASSERT ( k < count );
+                while ( k > 0 && ( pat_first[k] != pat_first[i] )) {
+                    BOOST_ASSERT ( k < count );
+                    k = prefix [ k - 1 ];
+                    }
+                    
+                if ( pat_first[k] == pat_first[i] )
+                    k++;
+                prefix [ i ] = k;
+                }
+            }
+
+        void build_suffix_table ( patIter pat_first, patIter pat_last ) {
+            const std::size_t count = (std::size_t) std::distance ( pat_first, pat_last );
+            
+            if ( count > 0 ) {  // empty pattern
+                std::vector<typename std::iterator_traits<patIter>::value_type> reversed(count);
+                (void) std::reverse_copy ( pat_first, pat_last, reversed.begin ());
+                
+                std::vector<difference_type> prefix (count);
+                compute_bm_prefix ( pat_first, pat_last, prefix );
+        
+                std::vector<difference_type> prefix_reversed (count);
+                compute_bm_prefix ( reversed.begin (), reversed.end (), prefix_reversed );
+                
+                for ( std::size_t i = 0; i <= count; i++ )
+                    suffix_[i] = count - prefix [count-1];
+         
+                for ( std::size_t i = 0; i < count; i++ ) {
+                    const std::size_t     j = count - prefix_reversed[i];
+                    const difference_type k = i -     prefix_reversed[i] + 1;
+         
+                    if (suffix_[j] > k)
+                        suffix_[j] = k;
+                    }
+                }
+            }
+/// \endcond
+        };
+
+
+/*  Two ranges as inputs gives us four possibilities; with 2,3,3,4 parameters
+    Use a bit of TMP to disambiguate the 3-argument templates */
+
+/// \fn boyer_moore_search ( corpusIter corpus_first, corpusIter corpus_last, 
+///       patIter pat_first, patIter pat_last )
+/// \brief Searches the corpus for the pattern.
+/// 
+/// \param corpus_first The start of the data to search (Random Access Iterator)
+/// \param corpus_last  One past the end of the data to search
+/// \param pat_first    The start of the pattern to search for (Random Access Iterator)
+/// \param pat_last     One past the end of the data to search for
+///
+    template <typename patIter, typename corpusIter>
+    corpusIter boyer_moore_search ( 
+                  corpusIter corpus_first, corpusIter corpus_last, 
+                  patIter pat_first, patIter pat_last )
+    {
+        boyer_moore<patIter> bm ( pat_first, pat_last );
+        return bm ( corpus_first, corpus_last );
+    }
+
+    template <typename PatternRange, typename corpusIter>
+    corpusIter boyer_moore_search ( 
+        corpusIter corpus_first, corpusIter corpus_last, const PatternRange &pattern )
+    {
+        typedef typename boost::range_iterator<PatternRange> pattern_iterator;
+        boyer_moore<pattern_iterator> bm ( boost::begin(pattern), boost::end (pattern));
+        return bm ( corpus_first, corpus_last );
+    }
+    
+    template <typename patIter, typename CorpusRange>
+    typename boost::lazy_disable_if_c<
+        boost::is_same<CorpusRange, patIter>::value, typename boost::range_iterator<CorpusRange> >
+    ::type
+    boyer_moore_search ( CorpusRange &corpus, patIter pat_first, patIter pat_last )
+    {
+        boyer_moore<patIter> bm ( pat_first, pat_last );
+        return bm (boost::begin (corpus), boost::end (corpus));
+    }
+    
+    template <typename PatternRange, typename CorpusRange>
+    typename boost::range_iterator<CorpusRange>::type
+    boyer_moore_search ( CorpusRange &corpus, const PatternRange &pattern )
+    {
+        typedef typename boost::range_iterator<PatternRange> pattern_iterator;
+        boyer_moore<pattern_iterator> bm ( boost::begin(pattern), boost::end (pattern));
+        return bm (boost::begin (corpus), boost::end (corpus));
+    }
+
+
+    //  Creator functions -- take a pattern range, return an object
+    template <typename Range>
+    boost::algorithm::boyer_moore<typename boost::range_iterator<const Range>::type>
+    make_boyer_moore ( const Range &r ) {
+        return boost::algorithm::boyer_moore
+            <typename boost::range_iterator<const Range>::type> (boost::begin(r), boost::end(r));
+        }
+    
+    template <typename Range>
+    boost::algorithm::boyer_moore<typename boost::range_iterator<Range>::type>
+    make_boyer_moore ( Range &r ) {
+        return boost::algorithm::boyer_moore
+            <typename boost::range_iterator<Range>::type> (boost::begin(r), boost::end(r));
+        }
+
+}}
+
+#endif  //  BOOST_ALGORITHM_BOYER_MOORE_SEARCH_HPP

include/boost/algorithm/searching/boyer_moore_horspool.hpp

@@ -0,0 +1,141 @@
+/* 
+   Copyright (c) Marshall Clow 2010-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#ifndef BOOST_ALGORITHM_BOYER_MOORE_HORSPOOOL_SEARCH_HPP
+#define BOOST_ALGORITHM_BOYER_MOORE_HORSPOOOL_SEARCH_HPP
+
+#include <iterator>     // for std::iterator_traits
+
+#include <boost/assert.hpp>
+#include <boost/static_assert.hpp>
+#include <boost/type_traits/is_same.hpp>
+
+#include <boost/algorithm/searching/detail/bm_traits.hpp>
+#include <boost/algorithm/searching/detail/debugging.hpp>
+
+// #define  BOOST_ALGORITHM_BOYER_MOORE_HORSPOOL_DEBUG_HPP
+
+namespace boost { namespace algorithm {
+
+/*
+    A templated version of the boyer-moore-horspool searching algorithm.
+    
+    Requirements:
+        * Random access iterators
+        * The two iterator types (patIter and corpusIter) must 
+            "point to" the same underlying type.
+        * Additional requirements may be imposed buy the skip table, such as:
+        ** Numeric type (array-based skip table)
+        ** Hashable type (map-based skip table)
+
+http://www-igm.univ-mlv.fr/%7Elecroq/string/node18.html
+
+*/
+
+    template <typename patIter, typename traits = detail::BM_traits<patIter> >
+    class boyer_moore_horspool {
+        typedef typename std::iterator_traits<patIter>::difference_type difference_type;
+    public:
+        boyer_moore_horspool ( patIter first, patIter last ) 
+                : pat_first ( first ), pat_last ( last ),
+                  k_pattern_length ( std::distance ( pat_first, pat_last )),
+                  skip_ ( k_pattern_length, k_pattern_length ) {
+                  
+        //  Build the skip table
+            std::size_t i = 0;
+            if ( first != last )    // empty pattern?
+                for ( patIter iter = first; iter != last-1; ++iter, ++i )
+                    skip_.insert ( *iter, k_pattern_length - 1 - i );
+#ifdef BOOST_ALGORITHM_BOYER_MOORE_HORSPOOL_DEBUG_HPP
+            skip_.PrintSkipTable ();
+#endif
+            }
+            
+        ~boyer_moore_horspool () {}
+        
+        /// \fn operator ( corpusIter corpus_first, corpusIter corpus_last, Pred p )
+        /// \brief Searches the corpus for the pattern that was passed into the constructor
+        /// 
+        /// \param corpus_first The start of the data to search (Random Access Iterator)
+        /// \param corpus_last  One past the end of the data to search
+        /// \param p            A predicate used for the search comparisons.
+        ///
+        template <typename corpusIter>
+        corpusIter operator () ( corpusIter corpus_first, corpusIter corpus_last ) const {
+            BOOST_STATIC_ASSERT (( boost::is_same<
+                typename std::iterator_traits<patIter>::value_type, 
+                typename std::iterator_traits<corpusIter>::value_type>::value ));
+
+            if ( corpus_first == corpus_last ) return corpus_last;  // if nothing to search, we didn't find it!
+            if (    pat_first ==    pat_last ) return corpus_first; // empty pattern matches at start
+
+            const difference_type k_corpus_length  = std::distance ( corpus_first, corpus_last );
+        //  If the pattern is larger than the corpus, we can't find it!
+            if ( k_corpus_length < k_pattern_length )
+                return corpus_last;
+    
+        //  Do the search 
+            return this->do_search ( corpus_first, corpus_last );
+            }
+            
+    private:
+/// \cond DOXYGEN_HIDE
+        patIter pat_first, pat_last;
+        const difference_type k_pattern_length;
+        typename traits::skip_table_t skip_;
+
+        /// \fn do_search ( corpusIter corpus_first, corpusIter corpus_last )
+        /// \brief Searches the corpus for the pattern that was passed into the constructor
+        /// 
+        /// \param corpus_first The start of the data to search (Random Access Iterator)
+        /// \param corpus_last  One past the end of the data to search
+        /// \param k_corpus_length The length of the corpus to search
+        ///
+        template <typename corpusIter>
+        corpusIter do_search ( corpusIter corpus_first, corpusIter corpus_last ) const {
+            corpusIter curPos = corpus_first;
+            const corpusIter lastPos = corpus_last - k_pattern_length;
+            while ( curPos <= lastPos ) {
+            //  Do we match right where we are?
+                std::size_t j = k_pattern_length - 1;
+                while ( pat_first [j] == curPos [j] ) {
+                //  We matched - we're done!
+                    if ( j == 0 )
+                        return curPos;
+                    j--;
+                    }
+        
+                curPos += skip_ [ curPos [ k_pattern_length - 1 ]];
+                }
+            
+            return corpus_last;
+            }
+// \endcond
+        };
+
+/// \fn boyer_moore_horspool_search ( corpusIter corpus_first, corpusIter corpus_last, 
+///       patIter pat_first, patIter pat_last )
+/// \brief Searches the corpus for the pattern.
+/// 
+/// \param corpus_first The start of the data to search (Random Access Iterator)
+/// \param corpus_last  One past the end of the data to search
+/// \param pat_first    The start of the pattern to search for (Random Access Iterator)
+/// \param pat_last     One past the end of the data to search for
+///
+    template <typename patIter, typename corpusIter>
+    corpusIter boyer_moore_horspool_search ( 
+            corpusIter corpus_first, corpusIter corpus_last, 
+            patIter pat_first, patIter pat_last ) {
+        boyer_moore_horspool<patIter> bmh ( pat_first, pat_last );
+        return bmh ( corpus_first, corpus_last );
+        }
+
+}}
+
+#endif  //  BOOST_ALGORITHM_BOYER_MOORE_HORSPOOOL_SEARCH_HPP

include/boost/algorithm/searching/detail/bm_traits.hpp

@@ -0,0 +1,105 @@
+/* 
+   Copyright (c) Marshall Clow 2010-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#ifndef BOOST_ALGORITHM_SEARCH_DETAIL_BM_TRAITS_HPP
+#define BOOST_ALGORITHM_SEARCH_DETAIL_BM_TRAITS_HPP
+
+#include <climits>      // for CHAR_BIT
+#include <vector>
+#include <iterator>     // for std::iterator_traits
+
+#include <boost/type_traits/make_unsigned.hpp>
+#include <boost/type_traits/is_integral.hpp>
+#include <boost/type_traits/remove_pointer.hpp>
+#include <boost/type_traits/remove_const.hpp>
+
+#include <boost/array.hpp>
+#include <boost/tr1/tr1/unordered_map>
+
+#include <boost/algorithm/searching/detail/debugging.hpp>
+
+namespace boost { namespace algorithm { namespace detail {
+
+//
+//  Default implementations of the skip tables for B-M and B-M-H
+//
+    template<typename key_type, typename value_type, bool /*useArray*/> class skip_table;
+
+//  General case for data searching other than bytes; use a map
+    template<typename key_type, typename value_type>
+    class skip_table<key_type, value_type, false> {
+    private:
+        typedef std::tr1::unordered_map<key_type, value_type> skip_map;
+        const value_type k_default_value;
+        skip_map skip_;
+        
+    public:
+        skip_table ( std::size_t patSize, value_type default_value ) 
+            : k_default_value ( default_value ), skip_ ( patSize ) {}
+        
+        void insert ( key_type key, value_type val ) {
+            skip_ [ key ] = val;    // Would skip_.insert (val) be better here?
+            }
+
+        value_type operator [] ( key_type key ) const {
+            typename skip_map::const_iterator it = skip_.find ( key );
+            return it == skip_.end () ? k_default_value : it->second;
+            }
+            
+        void PrintSkipTable () const {
+            std::cout << "BM(H) Skip Table <unordered_map>:" << std::endl;
+            for ( typename skip_map::const_iterator it = skip_.begin (); it != skip_.end (); ++it )
+                if ( it->second != k_default_value )
+                    std::cout << "  " << it->first << ": " << it->second << std::endl;
+            std::cout << std::endl;
+            }
+        };
+        
+    
+//  Special case small numeric values; use an array
+    template<typename key_type, typename value_type>
+    class skip_table<key_type, value_type, true> {
+    private:
+        typedef typename boost::make_unsigned<key_type>::type unsigned_key_type;
+        typedef boost::array<value_type, 1U << (CHAR_BIT * sizeof(key_type))> skip_map;
+        skip_map skip_;
+        const value_type k_default_value;
+    public:
+        skip_table ( std::size_t patSize, value_type default_value ) : k_default_value ( default_value ) {
+            std::fill_n ( skip_.begin(), skip_.size(), default_value );
+            }
+        
+        void insert ( key_type key, value_type val ) {
+            skip_ [ static_cast<unsigned_key_type> ( key ) ] = val;
+            }
+
+        value_type operator [] ( key_type key ) const {
+            return skip_ [ static_cast<unsigned_key_type> ( key ) ];
+            }
+
+        void PrintSkipTable () const {
+            std::cout << "BM(H) Skip Table <boost:array>:" << std::endl;
+            for ( typename skip_map::const_iterator it = skip_.begin (); it != skip_.end (); ++it )
+                if ( *it != k_default_value )
+                    std::cout << "  " << std::distance (skip_.begin (), it) << ": " << *it << std::endl;
+            std::cout << std::endl;
+            }
+        };
+
+    template<typename Iterator>
+    struct BM_traits {
+        typedef typename std::iterator_traits<Iterator>::difference_type value_type;
+        typedef typename std::iterator_traits<Iterator>::value_type key_type;
+        typedef boost::algorithm::detail::skip_table<key_type, value_type, 
+                boost::is_integral<key_type>::value && (sizeof(key_type)==1)> skip_table_t;
+        };
+
+}}} // namespaces
+
+#endif  //  BOOST_ALGORITHM_SEARCH_DETAIL_BM_TRAITS_HPP

include/boost/algorithm/searching/detail/debugging.hpp

@@ -0,0 +1,30 @@
+/* 
+   Copyright (c) Marshall Clow 2010-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#ifndef BOOST_ALGORITHM_SEARCH_DETAIL_DEBUG_HPP
+#define BOOST_ALGORITHM_SEARCH_DETAIL_DEBUG_HPP
+
+#include <iostream>
+/// \cond DOXYGEN_HIDE
+
+namespace boost { namespace algorithm { namespace detail {
+
+//  Debugging support
+    template <typename Iter>
+    void PrintTable ( Iter first, Iter last ) {
+        std::cout << std::distance ( first, last ) << ": { ";
+        for ( Iter iter = first; iter != last; ++iter )
+            std::cout << *iter << " ";
+        std::cout << "}" << std::endl;
+        }
+    
+}}}
+/// \endcond
+
+#endif  //  BOOST_ALGORITHM_SEARCH_DETAIL_DEBUG_HPP

include/boost/algorithm/searching/knuth_morris_pratt.hpp

@@ -0,0 +1,200 @@
+/* 
+   Copyright (c) Marshall Clow 2010-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#ifndef BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_SEARCH_HPP
+#define BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_SEARCH_HPP
+
+#include <vector>
+#include <iterator>     // for std::iterator_traits
+
+#include <boost/assert.hpp>
+#include <boost/static_assert.hpp>
+#include <boost/type_traits/is_same.hpp>
+
+#include <boost/algorithm/searching/detail/debugging.hpp>
+
+// #define  BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_DEBUG
+
+namespace boost { namespace algorithm {
+
+// #define  NEW_KMP
+
+/*
+    A templated version of the Knuth-Morris-Pratt searching algorithm.
+    
+    Requirements:
+        * Random-access iterators
+        * The two iterator types (I1 and I2) must "point to" the same underlying type.
+
+    http://en.wikipedia.org/wiki/Knuth–Morris–Pratt_algorithm
+    http://www.inf.fh-flensburg.de/lang/algorithmen/pattern/kmpen.htm
+*/
+
+    template <typename patIter>
+    class knuth_morris_pratt {
+        typedef typename std::iterator_traits<patIter>::difference_type difference_type;
+    public:
+        knuth_morris_pratt ( patIter first, patIter last ) 
+                : pat_first ( first ), pat_last ( last ), 
+                  k_pattern_length ( std::distance ( pat_first, pat_last )),
+                  skip_ ( k_pattern_length + 1 ) {
+#ifdef NEW_KMP
+            preKmp ( pat_first, pat_last );
+#else
+            init_skip_table ( pat_first, pat_last );
+#endif
+#ifdef BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_DEBUG
+            detail::PrintTable ( skip_.begin (), skip_.end ());
+#endif
+            }
+            
+        ~knuth_morris_pratt () {}
+        
+        /// \fn operator ( corpusIter corpus_first, corpusIter corpus_last, Pred p )
+        /// \brief Searches the corpus for the pattern that was passed into the constructor
+        /// 
+        /// \param corpus_first The start of the data to search (Random Access Iterator)
+        /// \param corpus_last  One past the end of the data to search
+        /// \param p            A predicate used for the search comparisons.
+        ///
+        template <typename corpusIter>
+        corpusIter operator () ( corpusIter corpus_first, corpusIter corpus_last ) const {
+            BOOST_STATIC_ASSERT (( boost::is_same<
+                typename std::iterator_traits<patIter>::value_type, 
+                typename std::iterator_traits<corpusIter>::value_type>::value ));
+            if ( corpus_first == corpus_last ) return corpus_last;  // if nothing to search, we didn't find it!
+            if ( pat_first == pat_last )       return corpus_first; // empty pattern matches at start
+
+            const difference_type k_corpus_length = std::distance ( corpus_first, corpus_last );
+        //  If the pattern is larger than the corpus, we can't find it!
+            if ( k_corpus_length < k_pattern_length ) 
+                return corpus_last;
+
+            return do_search   ( corpus_first, corpus_last, k_corpus_length );
+            }
+    
+    private:
+/// \cond DOXYGEN_HIDE
+        patIter pat_first, pat_last;
+        const difference_type k_pattern_length;
+        std::vector <difference_type> skip_;
+
+        /// \fn operator ( corpusIter corpus_first, corpusIter corpus_last, Pred p )
+        /// \brief Searches the corpus for the pattern that was passed into the constructor
+        /// 
+        /// \param corpus_first The start of the data to search (Random Access Iterator)
+        /// \param corpus_last  One past the end of the data to search
+        /// \param p            A predicate used for the search comparisons.
+        ///
+        template <typename corpusIter>
+        corpusIter do_search ( corpusIter corpus_first, corpusIter corpus_last, 
+                                                difference_type k_corpus_length ) const {
+            difference_type match_start = 0;  // position in the corpus that we're matching
+            
+#ifdef NEW_KMP
+            int patternIdx = 0;
+            while ( match_start < k_corpus_length ) {
+                while ( patternIdx > -1 && pat_first[patternIdx] != corpus_first [match_start] )
+                    patternIdx = skip_ [patternIdx]; //<--- Shifting the pattern on mismatch
+
+                patternIdx++;
+                match_start++; //<--- corpus is always increased by 1
+
+                if ( patternIdx >= (int) k_pattern_length )
+                    return corpus_first + match_start - patternIdx;
+                }
+            
+#else
+//  At this point, we know:
+//          k_pattern_length <= k_corpus_length
+//          for all elements of skip, it holds -1 .. k_pattern_length
+//      
+//          In the loop, we have the following invariants
+//              idx is in the range 0 .. k_pattern_length
+//              match_start is in the range 0 .. k_corpus_length - k_pattern_length + 1
+
+            const difference_type last_match = k_corpus_length - k_pattern_length;
+            difference_type idx = 0;          // position in the pattern we're comparing
+
+            while ( match_start <= last_match ) {
+                while ( pat_first [ idx ] == corpus_first [ match_start + idx ] ) {
+                    if ( ++idx == k_pattern_length )
+                        return corpus_first + match_start;
+                    }
+            //  Figure out where to start searching again
+           //   assert ( idx - skip_ [ idx ] > 0 ); // we're always moving forward
+                match_start += idx - skip_ [ idx ];
+                idx = skip_ [ idx ] >= 0 ? skip_ [ idx ] : 0;
+           //   assert ( idx >= 0 && idx < k_pattern_length );
+                }
+#endif
+                
+        //  We didn't find anything
+            return corpus_last;
+            }
+    
+
+        void preKmp ( patIter first, patIter last ) {
+           const /*std::size_t*/ int count = std::distance ( first, last );
+        
+           int i, j;
+        
+           i = 0;
+           j = skip_[0] = -1;
+           while (i < count) {
+              while (j > -1 && first[i] != first[j])
+                 j = skip_[j];
+              i++;
+              j++;
+              if (first[i] == first[j])
+                 skip_[i] = skip_[j];
+              else
+                 skip_[i] = j;
+           }
+        }
+
+
+        void init_skip_table ( patIter first, patIter last ) {
+            const difference_type count = std::distance ( first, last );
+    
+            int j;
+            skip_ [ 0 ] = -1;
+            for ( int i = 1; i <= count; ++i ) {
+                j = skip_ [ i - 1 ];
+                while ( j >= 0 ) {
+                    if ( first [ j ] == first [ i - 1 ] )
+                        break;
+                    j = skip_ [ j ];
+                    }
+                skip_ [ i ] = j + 1;
+                }
+            }
+// \endcond
+        };
+
+
+/// \fn knuth_morris_pratt_search ( corpusIter corpus_first, corpusIter corpus_last, 
+///       patIter pat_first, patIter pat_last )
+/// \brief Searches the corpus for the pattern.
+/// 
+/// \param corpus_first The start of the data to search (Random Access Iterator)
+/// \param corpus_last  One past the end of the data to search
+/// \param pat_first    The start of the pattern to search for (Random Access Iterator)
+/// \param pat_last     One past the end of the data to search for
+///
+    template <typename patIter, typename corpusIter>
+    corpusIter knuth_morris_pratt_search ( 
+            corpusIter corpus_first, corpusIter corpus_last, 
+            patIter pat_first, patIter pat_last ) {
+        knuth_morris_pratt<patIter> kmp ( pat_first, pat_last );
+        return kmp ( corpus_first, corpus_last );
+        }
+}}
+
+#endif  // BOOST_ALGORITHM_KNUTH_MORRIS_PRATT_SEARCH_HPP

test/Jamfile.v2

@@ -0,0 +1,44 @@
+#  Boost algorithm library test suite Jamfile  ----------------------------
+#
+#  Copyright Marshall Clow 2010-2012. Use, modification and
+#  distribution is subject to the Boost Software License, Version
+#  1.0. (See accompanying file LICENSE_1_0.txt or copy at
+#  http://www.boost.org/LICENSE_1_0.txt)
+#
+#  See http://www.boost.org for updates, documentation, and revision history.
+
+import testing ;
+
+{
+  test-suite algorithm:
+# Search tests
+   : [ run empty_search_test.cpp     : : : : empty_search_test ]
+     [ run search_test1.cpp          : : : : search_test1 ]
+     [ run search_test2.cpp          : : : : search_test2 ]
+     [ run search_test3.cpp          : : : : search_test3 ]
+     [ compile-fail search_fail1.cpp : : : : ]
+     [ compile-fail search_fail2.cpp : : : : ]
+     [ compile-fail search_fail3.cpp : : : : ]
+
+# Clamp tests
+     [ run clamp_test.cpp        : : : : clamp_test ]
+   
+# Cxx11 tests
+     [ run all_of_test.cpp        : : : : all_of_test ]
+     [ run any_of_test.cpp        : : : : any_of_test ]
+     [ run none_of_test.cpp       : : : : none_of_test ]
+     [ run one_of_test.cpp        : : : : one_of_test ]
+     
+     [ run ordered_test.cpp       : : : : ordered_test ]
+     [ run find_if_not_test1.cpp  : : : : find_if_not_test1 ]
+     [ run copy_n_test1.cpp       : : : : copy_n_test1 ]
+     [ run iota_test1.cpp         : : : : iota_test1 ]
+
+     [ run is_permutation_test1.cpp        : : : : is_permutation_test1 ]
+     [ run partition_point_test1.cpp       : : : : partition_point_test1 ]
+     [ run is_partitioned_test1.cpp        : : : : is_partitioned_test1 ]
+     [ run partition_copy_test1.cpp        : : : : partition_copy_test1 ]
+
+   ;
+}
+

test/all_of_test.cpp

@@ -0,0 +1,86 @@
+/* 
+   Copyright (c) Marshall Clow 2010-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <boost/config.hpp>
+#include <boost/algorithm/cxx11/all_of.hpp>
+#include <boost/test/included/test_exec_monitor.hpp>
+
+#include <functional>
+#include <vector>
+#include <list>
+
+template<typename T>
+struct is_ : public std::unary_function<T, bool> {
+    is_ ( T v ) : val_ ( v ) {}
+    ~is_ () {}
+    bool operator () ( T comp ) const { return val_ == comp; }
+private:
+    is_ (); // need a value
+
+    T val_;
+    };
+
+namespace ba = boost::algorithm;
+
+void test_all ()
+{
+//  Note: The literal values here are tested against directly, careful if you change them:
+    int some_numbers[] = { 1, 1, 1, 18, 10 };
+    std::vector<int> vi(some_numbers, some_numbers + 5);
+    std::list<int>   li(vi.begin(), vi.end ());
+    
+    int some_letters[] = { 'a', 'q', 'n', 'y', 'n' };
+    std::vector<char> vc(some_letters, some_letters + 5);
+    
+    
+    BOOST_CHECK (!ba::all_of_equal ( vi,                                  1 ));
+    BOOST_CHECK (!ba::all_of       ( vi,                       is_<int> ( 1 )));
+    BOOST_CHECK (!ba::all_of_equal ( vi.begin(),     vi.end(),            1 ));
+    BOOST_CHECK (!ba::all_of       ( vi.begin(),     vi.end(), is_<int> ( 1 )));
+    
+    BOOST_CHECK (!ba::all_of_equal ( vi,                                  0 ));
+    BOOST_CHECK (!ba::all_of       ( vi,                       is_<int> ( 0 )));
+    BOOST_CHECK (!ba::all_of_equal ( vi.begin(),     vi.end(),            0 ));
+    BOOST_CHECK (!ba::all_of       ( vi.begin(),     vi.end(), is_<int> ( 0 )));
+
+    BOOST_CHECK ( ba::all_of_equal ( vi.end(),       vi.end(),            0 ));
+    BOOST_CHECK ( ba::all_of       ( vi.end(),       vi.end(), is_<int> ( 0 )));
+
+    BOOST_CHECK ( ba::all_of_equal ( vi.begin(), vi.begin () + 3,            1 ));
+    BOOST_CHECK ( ba::all_of       ( vi.begin(), vi.begin () + 3, is_<int> ( 1 )));
+    
+    BOOST_CHECK ( ba::all_of_equal ( vc.begin() + 1, vc.begin() + 2,             'q' ));
+    BOOST_CHECK ( ba::all_of       ( vc.begin() + 1, vc.begin() + 2, is_<char> ( 'q' )));
+
+    BOOST_CHECK (!ba::all_of_equal ( vc,             '!' ));
+    BOOST_CHECK (!ba::all_of       ( vc, is_<char> ( '!' )));
+
+    BOOST_CHECK ( ba::all_of_equal ( vi.begin(), vi.begin(),   1 ));
+    BOOST_CHECK ( ba::all_of_equal ( vc.begin(), vc.begin(), 'a' ));
+    BOOST_CHECK ( ba::all_of       ( vi.begin(), vi.begin(), is_<int>  (   1 )));
+    BOOST_CHECK ( ba::all_of       ( vc.begin(), vc.begin(), is_<char> ( 'a' )));
+
+    BOOST_CHECK (!ba::all_of_equal ( li,                                  1 ));
+    BOOST_CHECK (!ba::all_of       ( li,                       is_<int> ( 1 )));
+    BOOST_CHECK (!ba::all_of_equal ( li.begin(),     li.end(),            1 ));
+    BOOST_CHECK (!ba::all_of       ( li.begin(),     li.end(), is_<int> ( 1 )));
+    
+    std::list<int>::iterator l_iter = li.begin ();
+    l_iter++; l_iter++; l_iter++;
+    BOOST_CHECK ( ba::all_of_equal ( li.begin(), l_iter,            1 ));
+    BOOST_CHECK ( ba::all_of       ( li.begin(), l_iter, is_<int> ( 1 )));
+    
+}
+
+
+int test_main( int , char* [] )
+{
+  test_all ();
+  return 0;
+}

test/any_of_test.cpp

@@ -0,0 +1,105 @@
+/* 
+   Copyright (c) Marshall Clow 2010-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <boost/config.hpp>
+#include <boost/algorithm/cxx11/any_of.hpp>
+#include <boost/test/included/test_exec_monitor.hpp>
+
+#include <functional>
+#include <vector>
+#include <list>
+
+template<typename T>
+struct is_ : public std::unary_function<T, bool> {
+    is_ ( T v ) : val_ ( v ) {}
+    ~is_ () {}
+    bool operator () ( T comp ) const { return val_ == comp; }
+private:
+    is_ (); // need a value
+
+    T val_;
+    };
+
+namespace ba = boost::algorithm;
+
+void test_any ()
+{
+//  Note: The literal values here are tested against directly, careful if you change them:
+    int some_numbers[] = { 1, 5, 0, 18, 10 };
+    std::vector<int> vi(some_numbers, some_numbers + 5);
+    std::list<int>   li(vi.begin(), vi.end ());
+
+    int some_letters[] = { 'a', 'q', 'n', 'y', 'n' };
+    std::vector<char> vc(some_letters, some_letters + 5);
+    
+    BOOST_CHECK ( ba::any_of_equal ( vi,                                   1 ));
+    BOOST_CHECK ( ba::any_of       ( vi,                       is_<int> (  1 )));
+    BOOST_CHECK ( ba::any_of_equal ( vi.begin(),     vi.end(),             1 ));
+    BOOST_CHECK ( ba::any_of       ( vi.begin(),     vi.end(), is_<int> (  1 )));
+
+    BOOST_CHECK (!ba::any_of_equal ( vi,                                   9 ));
+    BOOST_CHECK (!ba::any_of       ( vi,                       is_<int> (  9 )));
+    BOOST_CHECK (!ba::any_of_equal ( vi.begin(),     vi.end(),             9 ));
+    BOOST_CHECK (!ba::any_of       ( vi.begin(),     vi.end(), is_<int> (  9 )));
+
+    BOOST_CHECK ( ba::any_of_equal ( vi,                                  10 ));
+    BOOST_CHECK ( ba::any_of       ( vi,                       is_<int> ( 10 )));
+    BOOST_CHECK (!ba::any_of_equal ( vi,                                   4 ));
+    BOOST_CHECK (!ba::any_of       ( vi,                       is_<int> (  4 )));
+
+    BOOST_CHECK (!ba::any_of_equal ( vi.end(),       vi.end(),            0 ));
+    BOOST_CHECK (!ba::any_of       ( vi.end(),       vi.end(), is_<int> ( 0 )));
+
+//   5 is not in { 0, 18, 10 }, but 10 is
+    BOOST_CHECK ( ba::any_of_equal ( vi.begin() + 2, vi.end(),            10 ));
+    BOOST_CHECK ( ba::any_of       ( vi.begin() + 2, vi.end(), is_<int> ( 10 )));
+
+    BOOST_CHECK (!ba::any_of_equal ( vi.begin() + 2, vi.end(),             5 ));
+    BOOST_CHECK (!ba::any_of       ( vi.begin() + 2, vi.end(), is_<int> (  5 )));
+
+//  18 is not in { 1, 5, 0 }, but 5 is
+    BOOST_CHECK ( ba::any_of_equal ( vi.begin(), vi.begin() + 3,             5 ));
+    BOOST_CHECK ( ba::any_of       ( vi.begin(), vi.begin() + 3, is_<int> (  5 )));
+
+    BOOST_CHECK (!ba::any_of_equal ( vi.begin(), vi.begin() + 3,            18 ));
+    BOOST_CHECK (!ba::any_of       ( vi.begin(), vi.begin() + 3, is_<int> ( 18 )));
+
+    BOOST_CHECK ( ba::any_of_equal ( vc,             'q' ));
+    BOOST_CHECK ( ba::any_of       ( vc, is_<char> ( 'q' )));
+
+    BOOST_CHECK (!ba::any_of_equal ( vc,             '!' ));
+    BOOST_CHECK (!ba::any_of       ( vc, is_<char> ( '!' )));
+
+    BOOST_CHECK ( ba::any_of_equal ( vc,             'n' ));
+    BOOST_CHECK ( ba::any_of       ( vc, is_<char> ( 'n' )));
+
+    BOOST_CHECK (!ba::any_of_equal ( vi.begin(), vi.begin(),   1 ));
+    BOOST_CHECK (!ba::any_of_equal ( vc.begin(), vc.begin(), 'a' ));
+    BOOST_CHECK (!ba::any_of       ( vi.begin(), vi.begin(), is_<int>  (   1 )));
+    BOOST_CHECK (!ba::any_of       ( vc.begin(), vc.begin(), is_<char> ( 'a' )));
+
+    BOOST_CHECK ( ba::any_of_equal ( li,                                   1 ));
+    BOOST_CHECK ( ba::any_of       ( li,                       is_<int> (  1 )));
+    BOOST_CHECK ( ba::any_of_equal ( li.begin(),     li.end(),             1 ));
+    BOOST_CHECK ( ba::any_of       ( li.begin(),     li.end(), is_<int> (  1 )));
+    
+    std::list<int>::iterator l_iter = li.begin ();
+    l_iter++; l_iter++; l_iter++;
+    BOOST_CHECK ( ba::any_of_equal ( li.begin(), l_iter,             5 ));
+    BOOST_CHECK ( ba::any_of       ( li.begin(), l_iter, is_<int> (  5 )));
+    BOOST_CHECK (!ba::any_of_equal ( li.begin(), l_iter,            18 ));
+    BOOST_CHECK (!ba::any_of       ( li.begin(), l_iter, is_<int> ( 18 )));
+}
+
+
+int test_main( int , char* [] )
+{
+  test_any ();
+  return 0;
+}

test/clamp_test.cpp

@@ -0,0 +1,218 @@
+//  (C) Copyright Jesse Williamson 2009
+//  Use, modification and distribution are subject to the
+//  Boost Software License, Version 1.0. (See accompanying file
+//  LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+#include <iostream>
+#include <vector>
+
+#include <boost/config.hpp>
+#include <boost/algorithm/clamp.hpp>
+
+#include <boost/test/included/test_exec_monitor.hpp>
+
+namespace ba = boost::algorithm;
+
+bool intGreater    ( int lhs, int rhs )       { return lhs > rhs; }
+bool doubleGreater ( double lhs, double rhs ) { return lhs > rhs; }
+
+class custom {
+public:
+    custom ( int x )             : v(x)     {}
+    custom ( const custom &rhs ) : v(rhs.v) {}
+    ~custom () {}
+    custom & operator = ( const custom &rhs ) { v = rhs.v; return *this; }
+    
+    bool operator <  ( const custom &rhs ) const { return v < rhs.v; }
+    bool operator == ( const custom &rhs ) const { return v == rhs.v; }     // need this for the test
+    
+    std::ostream & print ( std::ostream &os ) const { return os << v; }
+    
+    int v;
+    };
+
+std::ostream & operator << ( std::ostream & os, const custom &x ) { return x.print ( os ); }
+
+bool customLess ( const custom &lhs, const custom &rhs ) { return lhs.v < rhs.v; }
+
+void test_ints()
+{
+
+//  Inside the range, equal to the endpoints, and outside the endpoints.
+    BOOST_CHECK_EQUAL (  3, ba::clamp (  3, 1, 10 ));
+    BOOST_CHECK_EQUAL (  1, ba::clamp (  1, 1, 10 ));
+    BOOST_CHECK_EQUAL (  1, ba::clamp (  0, 1, 10 ));
+    BOOST_CHECK_EQUAL ( 10, ba::clamp ( 10, 1, 10 ));
+    BOOST_CHECK_EQUAL ( 10, ba::clamp ( 11, 1, 10 ));
+    
+    BOOST_CHECK_EQUAL (  3, ba::clamp (  3, 10, 1, intGreater ));
+    BOOST_CHECK_EQUAL (  1, ba::clamp (  1, 10, 1, intGreater ));
+    BOOST_CHECK_EQUAL (  1, ba::clamp (  0, 10, 1, intGreater ));
+    BOOST_CHECK_EQUAL ( 10, ba::clamp ( 10, 10, 1, intGreater ));
+    BOOST_CHECK_EQUAL ( 10, ba::clamp ( 11, 10, 1, intGreater ));
+
+//  Negative numbers
+    BOOST_CHECK_EQUAL (  -3, ba::clamp (  -3, -10, -1 ));
+    BOOST_CHECK_EQUAL (  -1, ba::clamp (  -1, -10, -1 ));
+    BOOST_CHECK_EQUAL (  -1, ba::clamp (   0, -10, -1 ));
+    BOOST_CHECK_EQUAL ( -10, ba::clamp ( -10, -10, -1 ));
+    BOOST_CHECK_EQUAL ( -10, ba::clamp ( -11, -10, -1 ));
+
+//  Mixed positive and negative numbers
+    BOOST_CHECK_EQUAL (   5, ba::clamp (   5, -10, 10 ));
+    BOOST_CHECK_EQUAL ( -10, ba::clamp ( -10, -10, 10 ));
+    BOOST_CHECK_EQUAL ( -10, ba::clamp ( -15, -10, 10 ));
+    BOOST_CHECK_EQUAL (  10, ba::clamp (  10, -10, 10 ));
+    BOOST_CHECK_EQUAL (  10, ba::clamp (  15, -10, 10 ));
+
+//  Unsigned 
+    BOOST_CHECK_EQUAL (  5U, ba::clamp (  5U, 1U, 10U ));
+    BOOST_CHECK_EQUAL (  1U, ba::clamp (  1U, 1U, 10U ));
+    BOOST_CHECK_EQUAL (  1U, ba::clamp (  0U, 1U, 10U ));
+    BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 10U, 1U, 10U ));
+    BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 15U, 1U, 10U ));
+    
+//  Mixed (1)
+    BOOST_CHECK_EQUAL (  5U, ba::clamp (  5U, 1,  10 ));
+    BOOST_CHECK_EQUAL (  1U, ba::clamp (  1U, 1,  10 ));
+    BOOST_CHECK_EQUAL (  1U, ba::clamp (  0U, 1,  10 ));
+    BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 10U, 1,  10 ));
+    BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 15U, 1,  10 ));
+    
+//  Mixed (3)
+    BOOST_CHECK_EQUAL (  5U, ba::clamp (  5U, 1,  10. ));
+    BOOST_CHECK_EQUAL (  1U, ba::clamp (  1U, 1,  10. ));
+    BOOST_CHECK_EQUAL (  1U, ba::clamp (  0U, 1,  10. ));
+    BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 10U, 1,  10. ));
+    BOOST_CHECK_EQUAL ( 10U, ba::clamp ( 15U, 1,  10. ));
+    
+    short foo = 50;
+    BOOST_CHECK_EQUAL ( 56,     ba::clamp ( foo, 56.9, 129 ));
+    BOOST_CHECK_EQUAL ( 24910,  ba::clamp ( foo, 12345678, 123456999 ));
+    }
+
+
+void test_floats()
+{
+
+//  Inside the range, equal to the endpoints, and outside the endpoints.
+    BOOST_CHECK_EQUAL (  3.0, ba::clamp (  3.0, 1.0, 10.0 ));
+    BOOST_CHECK_EQUAL (  1.0, ba::clamp (  1.0, 1.0, 10.0 ));
+    BOOST_CHECK_EQUAL (  1.0, ba::clamp (  0.0, 1.0, 10.0 ));
+    BOOST_CHECK_EQUAL ( 10.0, ba::clamp ( 10.0, 1.0, 10.0 ));
+    BOOST_CHECK_EQUAL ( 10.0, ba::clamp ( 11.0, 1.0, 10.0 ));
+    
+    BOOST_CHECK_EQUAL (  3.0, ba::clamp (  3.0, 10.0, 1.0, doubleGreater ));
+    BOOST_CHECK_EQUAL (  1.0, ba::clamp (  1.0, 10.0, 1.0, doubleGreater ));
+    BOOST_CHECK_EQUAL (  1.0, ba::clamp (  0.0, 10.0, 1.0, doubleGreater ));
+    BOOST_CHECK_EQUAL ( 10.0, ba::clamp ( 10.0, 10.0, 1.0, doubleGreater ));
+    BOOST_CHECK_EQUAL ( 10.0, ba::clamp ( 11.0, 10.0, 1.0, doubleGreater ));
+
+//  Negative numbers
+    BOOST_CHECK_EQUAL (  -3.f, ba::clamp (  -3.f, -10.f, -1.f ));
+    BOOST_CHECK_EQUAL (  -1.f, ba::clamp (  -1.f, -10.f, -1.f ));
+    BOOST_CHECK_EQUAL (  -1.f, ba::clamp (   0.f, -10.f, -1.f ));
+    BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -10.f, -10.f, -1.f ));
+    BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -11.f, -10.f, -1.f ));
+
+//  Mixed positive and negative numbers
+    BOOST_CHECK_EQUAL (   5.f, ba::clamp (   5.f, -10.f, 10.f ));
+    BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -10.f, -10.f, 10.f ));
+    BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -15.f, -10.f, 10.f ));
+    BOOST_CHECK_EQUAL (  10.f, ba::clamp (  10.f, -10.f, 10.f ));
+    BOOST_CHECK_EQUAL (  10.f, ba::clamp (  15.f, -10.f, 10.f ));
+
+//  Mixed (1)
+    BOOST_CHECK_EQUAL (   5.f, ba::clamp (   5.f, -10., 10. ));
+    BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -10.f, -10., 10. ));
+    BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -15.f, -10., 10. ));
+    BOOST_CHECK_EQUAL (  10.f, ba::clamp (  10.f, -10., 10. ));
+    BOOST_CHECK_EQUAL (  10.f, ba::clamp (  15.f, -10., 10. ));
+
+//  Mixed (2)
+    BOOST_CHECK_EQUAL (   5.f, ba::clamp (   5.f, -10, 10 ));
+    BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -10.f, -10, 10 ));
+    BOOST_CHECK_EQUAL ( -10.f, ba::clamp ( -15.f, -10, 10 ));
+    BOOST_CHECK_EQUAL (  10.f, ba::clamp (  10.f, -10, 10 ));
+    BOOST_CHECK_EQUAL (  10.f, ba::clamp (  15.f, -10, 10 ));
+}
+
+void test_custom()
+{
+
+//  Inside the range, equal to the endpoints, and outside the endpoints.
+    BOOST_CHECK_EQUAL ( custom( 3), ba::clamp ( custom( 3), custom(1), custom(10)));
+    BOOST_CHECK_EQUAL ( custom( 1), ba::clamp ( custom( 1), custom(1), custom(10)));
+    BOOST_CHECK_EQUAL ( custom( 1), ba::clamp ( custom( 0), custom(1), custom(10)));
+    BOOST_CHECK_EQUAL ( custom(10), ba::clamp ( custom(10), custom(1), custom(10)));
+    BOOST_CHECK_EQUAL ( custom(10), ba::clamp ( custom(11), custom(1), custom(10)));
+
+    BOOST_CHECK_EQUAL ( custom( 3), ba::clamp ( custom( 3), custom(1), custom(10), customLess ));
+    BOOST_CHECK_EQUAL ( custom( 1), ba::clamp ( custom( 1), custom(1), custom(10), customLess ));
+    BOOST_CHECK_EQUAL ( custom( 1), ba::clamp ( custom( 0), custom(1), custom(10), customLess ));
+    BOOST_CHECK_EQUAL ( custom(10), ba::clamp ( custom(10), custom(1), custom(10), customLess ));
+    BOOST_CHECK_EQUAL ( custom(10), ba::clamp ( custom(11), custom(1), custom(10), customLess ));
+
+//  Fail!!
+//  BOOST_CHECK_EQUAL ( custom(1), ba::clamp ( custom(11), custom(1), custom(10)));
+}
+
+#define elementsof(v)   (sizeof (v) / sizeof (v[0]))
+#define a_begin(v)      (&v[0])
+#define a_end(v)        (v + elementsof (v))
+#define a_range(v)      v
+#define b_e(v)          a_begin(v),a_end(v)
+
+void test_int_range ()
+{
+    int inputs []  = { 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 19, 99, 999, -1, -3, -99, 234234 };
+    int outputs [] = { 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 10,  10, -1, -1, -1,  10 };
+    std::vector<int> results;
+    std::vector<int> in_v;
+    
+    std::copy ( a_begin(inputs), a_end(inputs), std::back_inserter ( in_v ));
+    
+    ba::clamp_range ( a_begin(inputs), a_end(inputs), std::back_inserter ( results ), -1, 10 );
+    BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
+    results.clear ();
+    ba::clamp_range ( in_v.begin (), in_v.end (), std::back_inserter ( results ), -1, 10 );
+    BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
+    results.clear ();
+
+    ba::clamp_range ( a_begin(inputs), a_end(inputs), std::back_inserter ( results ), 10, -1, intGreater );
+    BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
+    results.clear ();
+    ba::clamp_range ( in_v.begin (), in_v.end (), std::back_inserter ( results ), 10, -1, intGreater );
+    BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
+    results.clear ();
+
+    ba::clamp_range ( a_range(inputs), std::back_inserter ( results ), -1, 10 );
+    BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
+    results.clear ();
+    ba::clamp_range ( in_v, std::back_inserter ( results ), -1, 10 );
+    BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
+    results.clear ();
+        
+    ba::clamp_range ( a_range(inputs), std::back_inserter ( results ), 10, -1, intGreater );
+    BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
+    results.clear ();
+    ba::clamp_range ( in_v, std::back_inserter ( results ), 10, -1, intGreater );
+    BOOST_CHECK ( std::equal ( results.begin(), results.end (), outputs ));
+    results.clear ();
+    
+    int junk[elementsof(inputs)];
+    ba::clamp_range ( inputs, junk, 10, -1, intGreater );
+    BOOST_CHECK ( std::equal ( b_e(junk), outputs ));
+}
+
+int test_main( int , char* [] )
+{
+    test_ints ();
+    test_floats ();
+    test_custom ();
+    
+    test_int_range ();
+//    test_float_range ();
+//    test_custom_range ();
+    return 0;
+}

test/copy_n_test1.cpp

@@ -0,0 +1,85 @@
+/* 
+   Copyright (c) Marshall Clow 2011-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <boost/config.hpp>
+#include <boost/algorithm/cxx11/copy_n.hpp>
+#include <boost/test/included/test_exec_monitor.hpp>
+
+#include <string>
+#include <iostream>
+#include <vector>
+#include <list>
+
+namespace ba = boost::algorithm;
+// namespace ba = boost;
+
+template <typename Container>
+void test_sequence ( Container const &c ) {
+
+	typedef typename Container::value_type value_type;
+	std::vector<value_type> v;
+	
+//	Copy zero elements
+	v.clear ();
+	ba::copy_n ( c.begin (), 0, back_inserter ( v ));
+	BOOST_CHECK ( v.size () == 0 );
+	ba::copy_n ( c.begin (), 0U, back_inserter ( v ));
+	BOOST_CHECK ( v.size () == 0 );
+
+	if ( c.size () > 0 ) {	
+	//	Just one element
+		v.clear ();
+		ba::copy_n ( c.begin (), 1, back_inserter ( v ));
+		BOOST_CHECK ( v.size () == 1 );
+		BOOST_CHECK ( v[0] == *c.begin ());
+		
+		v.clear ();
+		ba::copy_n ( c.begin (), 1U, back_inserter ( v ));
+		BOOST_CHECK ( v.size () == 1 );
+		BOOST_CHECK ( v[0] == *c.begin ());
+
+	//	Half the elements
+		v.clear ();
+		ba::copy_n ( c.begin (), c.size () / 2, back_inserter ( v ));
+		BOOST_CHECK ( v.size () == c.size () / 2);
+		BOOST_CHECK ( std::equal ( v.begin (), v.end (), c.begin ()));
+
+	//	Half the elements + 1
+		v.clear ();
+		ba::copy_n ( c.begin (), c.size () / 2 + 1, back_inserter ( v ));
+		BOOST_CHECK ( v.size () == c.size () / 2 + 1 );
+		BOOST_CHECK ( std::equal ( v.begin (), v.end (), c.begin ()));
+	
+	//	All the elements
+		v.clear ();
+		ba::copy_n ( c.begin (), c.size (), back_inserter ( v ));
+		BOOST_CHECK ( v.size () == c.size ());
+		BOOST_CHECK ( std::equal ( v.begin (), v.end (), c.begin ()));
+		}
+	}
+
+
+void test_sequence1 () {
+	std::vector<int> v;
+	for ( int i = 5; i < 15; ++i )
+		v.push_back ( i );
+	test_sequence  ( v );
+	
+	std::list<int> l;
+	for ( int i = 25; i > 15; --i )
+		l.push_back ( i );
+	test_sequence  ( l );	
+	}
+
+
+int test_main( int , char* [] )
+{
+  test_sequence1 ();
+  return 0;
+}

test/empty_search_test.cpp

@@ -0,0 +1,83 @@
+/* 
+   Copyright (c) Marshall Clow 2010-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <string>
+
+#include <boost/algorithm/searching/boyer_moore.hpp>
+#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
+#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
+
+#include <boost/test/included/test_exec_monitor.hpp>
+
+int test_main( int argc, char *argv [] )
+{
+    const std::string cs;
+    std::string estr;
+    std::string str ( "abc" );
+    
+//  empty corpus, empty pattern
+    BOOST_CHECK ( 
+        boost::algorithm::boyer_moore_search (
+            cs.begin (), cs.end (), estr.begin (), estr.end ())
+        == cs.begin ()
+        );
+
+    BOOST_CHECK ( 
+        boost::algorithm::boyer_moore_horspool_search (
+            cs.begin (), cs.end (), estr.begin (), estr.end ())
+        == cs.begin ()
+        );
+
+    BOOST_CHECK ( 
+        boost::algorithm::knuth_morris_pratt_search (
+            cs.begin (), cs.end (), estr.begin (), estr.end ())
+        == cs.begin ()
+        );
+
+//  empty corpus, non-empty pattern
+    BOOST_CHECK ( 
+        boost::algorithm::boyer_moore_search (
+            estr.begin (), estr.end (), str.begin (), str.end ())
+        == estr.end ()
+        );
+
+    BOOST_CHECK ( 
+        boost::algorithm::boyer_moore_horspool_search (
+            estr.begin (), estr.end (), str.begin (), str.end ())
+        == estr.end ()
+        );
+
+    BOOST_CHECK ( 
+        boost::algorithm::knuth_morris_pratt_search (
+            estr.begin (), estr.end (), str.begin (), str.end ())
+        == estr.end ()
+        );
+
+//  non-empty corpus, empty pattern
+    BOOST_CHECK ( 
+        boost::algorithm::boyer_moore_search (
+            str.begin (), str.end (), estr.begin (), estr.end ())
+        == str.begin ()
+        );
+
+    BOOST_CHECK ( 
+        boost::algorithm::boyer_moore_horspool_search (
+            str.begin (), str.end (), estr.begin (), estr.end ())
+        == str.begin ()
+        );
+
+    BOOST_CHECK ( 
+        boost::algorithm::knuth_morris_pratt_search (
+            str.begin (), str.end (), estr.begin (), estr.end ())
+        == str.begin ()
+        );
+
+   (void) argv; (void) argc;
+   return 0;
+}

test/find_if_not_test1.cpp

@@ -0,0 +1,90 @@
+/* 
+   Copyright (c) Marshall Clow 2011-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <iostream>
+
+#include <boost/config.hpp>
+#include <boost/algorithm/cxx11/find_if_not.hpp>
+#include <boost/test/included/test_exec_monitor.hpp>
+
+#include <string>
+#include <vector>
+#include <list>
+
+namespace ba = boost::algorithm;
+// namespace ba = boost;
+
+template <typename Container>
+typename Container::iterator offset_to_iter ( Container &v, int offset ) {
+	typename Container::iterator retval;
+	
+	if ( offset >= 0 ) {
+		retval = v.begin ();
+		std::advance ( retval, offset );
+		}
+	else {
+		retval = v.end ();
+		std::advance ( retval, offset + 1 );
+		}
+	return retval;
+	}
+
+template <typename Container, typename Predicate>
+void test_sequence ( Container &v, Predicate comp, int expected ) {
+    typename Container::iterator res, exp;
+    
+    res = ba::find_if_not ( v.begin (), v.end (), comp );
+    exp = offset_to_iter ( v, expected );
+    std::cout << "Expected(1): " << std::distance ( v.begin (), exp ) 
+              <<       ", got: " << std::distance ( v.begin (), res ) << std::endl;
+    BOOST_CHECK ( exp == res );
+    }
+
+template <typename T>
+struct less_than {
+public:
+    less_than ( T foo ) : val ( foo ) {}
+    less_than ( const less_than &rhs ) : val ( rhs.val ) {}
+
+    bool operator () ( const T &v ) const { return v < val; }
+private:
+    less_than ();
+    less_than operator = ( const less_than &rhs );
+    T val;
+    };
+
+
+void test_sequence1 () {
+    std::vector<int> v;
+    
+    v.clear ();
+    for ( int i = 5; i < 15; ++i )
+        v.push_back ( i );
+    test_sequence ( v, less_than<int>(3),  0 ); // no elements
+    test_sequence ( v, less_than<int>(6),  1 );    // only the first element
+    test_sequence ( v, less_than<int>(10), 5 );
+    test_sequence ( v, less_than<int>(99), -1 );   // all elements satisfy 
+
+//	With bidirectional iterators.
+    std::list<int> l;
+    for ( int i = 5; i < 15; ++i )
+        l.push_back ( i );
+    test_sequence ( l, less_than<int>(3),  0 ); // no elements
+    test_sequence ( l, less_than<int>(6),  1 );    // only the first element
+    test_sequence ( l, less_than<int>(10), 5 );
+    test_sequence ( l, less_than<int>(99), -1 );   // all elements satisfy 
+
+    }
+
+
+int test_main( int , char* [] )
+{
+  test_sequence1 ();
+  return 0;
+}

test/iota_test1.cpp

@@ -0,0 +1,79 @@
+/* 
+   Copyright (c) Marshall Clow 2011-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <boost/config.hpp>
+#include <boost/algorithm/cxx11/iota.hpp>
+#include <boost/test/included/test_exec_monitor.hpp>
+
+#include <iostream>
+#include <string>
+#include <vector>
+#include <list>
+
+//	Test to make sure a sequence is "correctly formed"; i.e, ascending by one
+template <typename Iterator, typename T>
+bool test_iota_results ( Iterator first, Iterator last, T initial_value ) {
+	if ( first == last ) return true;
+	if ( initial_value != *first ) return false;
+	Iterator prev = first;
+	while ( ++first != last ) {
+		if (( *first - *prev ) != 1	)
+			return false;
+		prev = first;
+		}
+	return true;
+	}
+
+template <typename Range, typename T>
+bool test_iota_results ( const Range &r, T initial_value ) {
+	return test_iota_results (boost::begin (r), boost::end (r), initial_value );
+}
+
+
+void test_ints () {
+	std::vector<int> v;
+	std::list<int> l;
+
+	v.clear ();	v.reserve ( 10 );
+	boost::algorithm::iota ( v.begin (), v.end (), 23 );
+	BOOST_CHECK ( test_iota_results ( v.begin (), v.end (), 23 ));
+	
+	v.clear ();	v.reserve ( 19 );
+	boost::algorithm::iota ( v, 18 );
+	BOOST_CHECK ( test_iota_results ( v, 18 ));
+	
+	v.clear ();
+	boost::algorithm::iota_n ( std::back_inserter(v), 99, 20 );
+	BOOST_CHECK ( test_iota_results ( v, 99 ));
+	
+/*
+	l.clear (); l.reserve ( 5 );
+	boost::algorithm::iota ( l.begin (), l.end (), 123 );
+	BOOST_CHECK ( test_iota_results ( l.begin (), l.end (), 123 ));
+	
+	l.clear (); l.reserve ( 9 );
+	boost::algorithm::iota ( l.begin (), l.end (), 87 );
+	BOOST_CHECK ( test_iota_results ( l.begin (), l.end (), 87 ));
+*/
+
+	l.clear ();
+	boost::algorithm::iota_n ( std::back_inserter(l), 99, 20 );
+	BOOST_CHECK ( test_iota_results ( l, 99 ));
+	
+	l.clear ();
+	boost::algorithm::iota_n ( std::front_inserter(l), 123, 20 );
+	BOOST_CHECK ( test_iota_results ( l.rbegin (), l.rend (), 123 ));
+	}
+
+
+int test_main( int , char* [] )
+{
+  test_ints ();
+  return 0;
+}

test/is_partitioned_test1.cpp

@@ -0,0 +1,63 @@
+/* 
+   Copyright (c) Marshall Clow 2011-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <iostream>
+
+#include <boost/config.hpp>
+#include <boost/algorithm/cxx11/is_partitioned.hpp>
+#include <boost/test/included/test_exec_monitor.hpp>
+
+#include <string>
+#include <vector>
+#include <list>
+
+namespace ba = boost::algorithm;
+// namespace ba = boost;
+
+template <typename T>
+struct less_than {
+public:
+    less_than ( T foo ) : val ( foo ) {}
+    less_than ( const less_than &rhs ) : val ( rhs.val ) {}
+
+    bool operator () ( const T &v ) const { return v < val; }
+private:
+    less_than ();
+    less_than operator = ( const less_than &rhs );
+    T val;
+    };
+
+
+void test_sequence1 () {
+    std::vector<int> v;
+    
+    v.clear ();
+    for ( int i = 5; i < 15; ++i )
+        v.push_back ( i );
+    BOOST_CHECK ( ba::is_partitioned ( v, less_than<int>(3)));		// no elements
+    BOOST_CHECK ( ba::is_partitioned ( v, less_than<int>(6)));		// only the first element
+    BOOST_CHECK ( ba::is_partitioned ( v, less_than<int>(10)));	// in the middle somewhere
+    BOOST_CHECK ( ba::is_partitioned ( v, less_than<int>(99)));	// all elements satisfy 
+
+//	With bidirectional iterators.
+    std::list<int> l;
+    for ( int i = 5; i < 15; ++i )
+        l.push_back ( i );
+    BOOST_CHECK ( ba::is_partitioned ( l.begin (), l.end (), less_than<int>(3)));		// no elements
+    BOOST_CHECK ( ba::is_partitioned ( l.begin (), l.end (), less_than<int>(6)));		// only the first element
+    BOOST_CHECK ( ba::is_partitioned ( l.begin (), l.end (), less_than<int>(10)));	// in the middle somewhere
+    BOOST_CHECK ( ba::is_partitioned ( l.begin (), l.end (), less_than<int>(99)));		// all elements satisfy 
+    }
+
+
+int test_main( int , char* [] )
+{
+  test_sequence1 ();
+  return 0;
+}

test/is_permutation_test1.cpp

@@ -0,0 +1,49 @@
+/* 
+   Copyright (c) Marshall Clow 2011-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <iostream>
+
+#include <boost/config.hpp>
+#include <boost/algorithm/cxx11/is_permutation.hpp>
+#include <boost/test/included/test_exec_monitor.hpp>
+
+#include <string>
+#include <vector>
+#include <list>
+
+namespace ba = boost::algorithm;
+// namespace ba = boost;
+
+void test_sequence1 () {
+    std::vector<int> v, v1;
+    
+    v.clear ();
+    for ( std::size_t i = 5; i < 15; ++i )
+        v.push_back ( i );
+    v1 = v;
+    BOOST_CHECK ( ba::is_permutation ( v.begin (), v.end (), v.begin ()));  // better be a permutation of itself!
+    BOOST_CHECK ( ba::is_permutation ( v.begin (), v.end (), v1.begin ()));    
+
+//  With bidirectional iterators.
+    std::list<int> l;
+    std::copy ( v.begin (), v.end (), std::back_inserter ( l ));
+    BOOST_CHECK ( ba::is_permutation ( l.begin (), l.end (), l.begin ()));  // better be a permutation of itself!
+    BOOST_CHECK ( ba::is_permutation ( l.begin (), l.end (), v1.begin ()));
+    for ( std::size_t i = 0; i < l.size (); ++i ) {
+        l.push_back ( *l.begin ()); l.pop_front (); // rotation
+        BOOST_CHECK ( ba::is_permutation ( l.begin (), l.end (), v1.begin ()));
+        }   
+    }
+
+
+int test_main( int , char* [] )
+{
+  test_sequence1 ();
+  return 0;
+}

test/none_of_test.cpp

@@ -0,0 +1,96 @@
+/* 
+   Copyright (c) Marshall Clow 2010-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <boost/config.hpp>
+#include <boost/algorithm/cxx11/none_of.hpp>
+#include <boost/test/included/test_exec_monitor.hpp>
+
+#include <functional>
+#include <vector>
+#include <list>
+
+template<typename T>
+struct is_ : public std::unary_function<T, bool> {
+    is_ ( T v ) : val_ ( v ) {}
+    ~is_ () {}
+    bool operator () ( T comp ) const { return val_ == comp; }
+private:
+    is_ (); // need a value
+
+    T val_;
+    };
+
+namespace ba = boost::algorithm;
+
+void test_none()
+{
+//  Note: The literal values here are tested against directly, careful if you change them:
+    int some_numbers[] = { 1, 5, 0, 18, 1 };
+    std::vector<int> vi(some_numbers, some_numbers + 5);
+    std::list<int>   li(vi.begin(), vi.end ());
+    
+    int some_letters[] = { 'a', 'q', 'n', 'y', 'n' };
+    std::vector<char> vc(some_letters, some_letters + 5);
+    
+    BOOST_CHECK ( ba::none_of_equal ( vi,                                  100 ));
+    BOOST_CHECK ( ba::none_of       ( vi,                       is_<int> ( 100 )));
+    BOOST_CHECK ( ba::none_of_equal ( vi.begin(),     vi.end(),            100 ));
+    BOOST_CHECK ( ba::none_of       ( vi.begin(),     vi.end(), is_<int> ( 100 )));
+
+    BOOST_CHECK (!ba::none_of_equal ( vi,                                    1 ));
+    BOOST_CHECK (!ba::none_of       ( vi,                       is_<int> (   1 )));
+    BOOST_CHECK (!ba::none_of_equal ( vi.begin(),     vi.end(),              1 ));
+    BOOST_CHECK (!ba::none_of       ( vi.begin(),     vi.end(), is_<int> (   1 )));
+
+    BOOST_CHECK ( ba::none_of_equal ( vi.end(),       vi.end(),              0 ));
+    BOOST_CHECK ( ba::none_of       ( vi.end(),       vi.end(), is_<int> (   0 )));
+
+//   5 is not in { 0, 18, 1 }, but 1 is
+    BOOST_CHECK ( ba::none_of_equal ( vi.begin() + 2, vi.end(),              5 ));
+    BOOST_CHECK ( ba::none_of       ( vi.begin() + 2, vi.end(), is_<int> (   5 )));
+    BOOST_CHECK (!ba::none_of_equal ( vi.begin() + 2, vi.end(),              1 ));
+    BOOST_CHECK (!ba::none_of       ( vi.begin() + 2, vi.end(), is_<int> (   1 )));
+
+//  18 is not in { 1, 5, 0 }, but 5 is
+    BOOST_CHECK ( ba::none_of_equal ( vi.begin(),     vi.begin() + 3,            18 ));
+    BOOST_CHECK ( ba::none_of       ( vi.begin(),     vi.begin() + 3, is_<int> ( 18 )));
+    BOOST_CHECK (!ba::none_of_equal ( vi.begin(),     vi.begin() + 3,             5 ));
+    BOOST_CHECK (!ba::none_of       ( vi.begin(),     vi.begin() + 3, is_<int> (  5 )));
+    
+    BOOST_CHECK ( ba::none_of_equal ( vc,             'z' ));
+    BOOST_CHECK ( ba::none_of       ( vc, is_<char> ( 'z' )));
+
+    BOOST_CHECK (!ba::none_of_equal ( vc,             'a' ));
+    BOOST_CHECK (!ba::none_of       ( vc, is_<char> ( 'a' )));
+
+    BOOST_CHECK (!ba::none_of_equal ( vc,             'n' ));
+    BOOST_CHECK (!ba::none_of       ( vc, is_<char> ( 'n' )));
+
+    BOOST_CHECK ( ba::none_of_equal ( vi.begin(), vi.begin(),   1 ));
+    BOOST_CHECK ( ba::none_of_equal ( vc.begin(), vc.begin(), 'a' ));
+    BOOST_CHECK ( ba::none_of       ( vi.begin(), vi.begin(), is_<int>  (   1 )));
+    BOOST_CHECK ( ba::none_of       ( vc.begin(), vc.begin(), is_<char> ( 'a' )));
+
+    BOOST_CHECK ( ba::none_of_equal ( li,                                  100 ));
+    BOOST_CHECK ( ba::none_of       ( li,                       is_<int> ( 100 )));
+    BOOST_CHECK ( ba::none_of_equal ( li.begin(),     li.end(),            100 ));
+    BOOST_CHECK ( ba::none_of       ( li.begin(),     li.end(), is_<int> ( 100 )));
+    
+    std::list<int>::iterator l_iter = li.begin ();
+    l_iter++; l_iter++; l_iter++;
+    BOOST_CHECK ( ba::none_of_equal ( li.begin(), l_iter,            18 ));
+    BOOST_CHECK ( ba::none_of       ( li.begin(), l_iter, is_<int> ( 18 )));
+    BOOST_CHECK (!ba::none_of       ( li.begin(), l_iter, is_<int> (  5 )));
+}
+
+int test_main( int , char* [] )
+{
+  test_none();
+  return 0;
+}

test/one_of_test.cpp

@@ -0,0 +1,101 @@
+/* 
+   Copyright (c) Marshall Clow 2008-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <boost/config.hpp>
+#include <boost/algorithm/cxx11/one_of.hpp>
+#include <boost/test/included/test_exec_monitor.hpp>
+
+#include <functional>
+#include <vector>
+#include <list>
+
+template<typename T>
+struct is_ : public std::unary_function<T, bool> {
+    is_ ( T v ) : val_ ( v ) {}
+    ~is_ () {}
+    bool operator () ( T comp ) const { return val_ == comp; }
+private:
+    is_ (); // need a value
+
+    T val_;
+    };
+
+namespace ba = boost::algorithm;
+
+void test_one ()
+{
+//  Note: The literal values here are tested against directly, careful if you change them:
+    int some_numbers[] = { 1, 1, 2, 3, 5 };
+    std::vector<int> vi(some_numbers, some_numbers + 5);
+    std::list<int>   li(vi.begin(), vi.end ());
+    
+    int some_letters[] = { 'a', 'q', 'n', 'y', 'n' };
+    std::vector<char> vc(some_letters, some_letters + 5);
+    
+    BOOST_CHECK (!ba::one_of_equal ( vi,                                  1 ));
+    BOOST_CHECK (!ba::one_of       ( vi,                       is_<int> ( 1 )));
+    BOOST_CHECK (!ba::one_of_equal ( vi.begin(),     vi.end(),            1 ));
+    BOOST_CHECK (!ba::one_of       ( vi.begin(),     vi.end(), is_<int> ( 1 )));
+
+    BOOST_CHECK (!ba::one_of_equal ( vi,                                  0 ));
+    BOOST_CHECK (!ba::one_of       ( vi,                       is_<int> ( 0 )));
+    BOOST_CHECK (!ba::one_of_equal ( vi.begin(),     vi.end(),            0 ));
+    BOOST_CHECK (!ba::one_of       ( vi.begin(),     vi.end(), is_<int> ( 0 )));
+    
+    BOOST_CHECK ( ba::one_of_equal ( vi,                                  2 ));
+    BOOST_CHECK ( ba::one_of       ( vi,                       is_<int> ( 2 )));
+    BOOST_CHECK ( ba::one_of_equal ( vi.begin(),     vi.end(),            2 ));
+    BOOST_CHECK ( ba::one_of       ( vi.begin(),     vi.end(), is_<int> ( 2 )));
+
+//  Check for a match at the end
+    BOOST_CHECK ( ba::one_of_equal ( vi,                                  5 ));
+    BOOST_CHECK ( ba::one_of       ( vi,                       is_<int> ( 5 )));
+    BOOST_CHECK ( ba::one_of_equal ( vi.begin(),     vi.end(),            5 ));
+    BOOST_CHECK ( ba::one_of       ( vi.begin(),     vi.end(), is_<int> ( 5 )));
+
+    BOOST_CHECK ( ba::one_of_equal ( vi.begin() + 1, vi.end(),            1 ));
+    BOOST_CHECK ( ba::one_of       ( vi.begin() + 1, vi.end(), is_<int> ( 1 )));
+    
+    BOOST_CHECK ( ba::one_of_equal ( vc.begin() + 1, vc.begin() + 2,             'q' ));
+    BOOST_CHECK ( ba::one_of       ( vc.begin() + 1, vc.begin() + 2, is_<char> ( 'q' )));
+
+    BOOST_CHECK (!ba::one_of_equal ( vc, '!' ));
+    BOOST_CHECK (!ba::one_of       ( vc, is_<char> ( '!' )));
+    
+    BOOST_CHECK (!ba::one_of_equal ( vc, 'n' ));
+    BOOST_CHECK (!ba::one_of       ( vc, is_<char> ( 'n' )));
+
+//  Empty range check
+    BOOST_CHECK (!ba::one_of_equal ( vi.begin(), vi.begin(),   1 ));
+    BOOST_CHECK (!ba::one_of_equal ( vc.begin(), vc.begin(), 'a' ));
+    BOOST_CHECK (!ba::one_of       ( vi.begin(), vi.begin(), is_<int>  (   1 )));
+    BOOST_CHECK (!ba::one_of       ( vc.begin(), vc.begin(), is_<char> ( 'a' )));
+    
+    BOOST_CHECK (!ba::one_of_equal ( li,                                  1 ));
+    BOOST_CHECK (!ba::one_of       ( li,                       is_<int> ( 1 )));
+    BOOST_CHECK (!ba::one_of_equal ( li.begin(),     li.end(),            1 ));
+    BOOST_CHECK (!ba::one_of       ( li.begin(),     li.end(), is_<int> ( 1 )));
+    
+    std::list<int>::iterator l_iter = li.begin ();
+    l_iter++; l_iter++; l_iter++;
+    BOOST_CHECK (!ba::one_of_equal ( li.begin(), l_iter,            1 ));
+    BOOST_CHECK (!ba::one_of       ( li.begin(), l_iter, is_<int> ( 1 )));
+    BOOST_CHECK ( ba::one_of_equal ( li.begin(), l_iter,            2 ));
+    BOOST_CHECK ( ba::one_of       ( li.begin(), l_iter, is_<int> ( 2 )));
+    BOOST_CHECK (!ba::one_of_equal ( li.begin(), l_iter,            3 ));
+    BOOST_CHECK (!ba::one_of       ( li.begin(), l_iter, is_<int> ( 3 )));
+
+}
+
+
+int test_main( int , char* [] )
+{
+  test_one ();
+  return 0;
+}

test/ordered_test.cpp

@@ -0,0 +1,127 @@
+//  Copyright (c) 2010 Nuovation System Designs, LLC
+//    Grant Erickson <gerickson@nuovations.com>
+//
+//  Reworked by Marshall Clow; August 2010
+//
+//  Distributed under the Boost Software License, Version 1.0. (See
+//  accompanying file LICENSE_1_0.txt or copy at
+//  http://www.boost.org/LICENSE_1_0.txt)
+//
+//  See http://www.boost.org/ for latest version.
+
+#include <algorithm>
+#include <iostream>
+
+#include <boost/algorithm/cxx11/ordered.hpp>
+#include <boost/test/included/test_exec_monitor.hpp>
+
+using namespace boost;
+
+/* Preprocessor Defines */
+
+#define elementsof(v)   (sizeof (v) / sizeof (v[0]))
+#define a_begin(v)      (&v[0])
+#define a_end(v)        (v + elementsof (v))
+#define a_range(v)      v
+#define b_e(v)          a_begin(v),a_end(v)
+
+namespace ba = boost::algorithm;
+
+static void
+test_ordered(void)
+{
+    const int strictlyIncreasingValues[] = { 1, 2, 3, 4, 5 };
+    const int strictlyDecreasingValues[] = { 9, 8, 7, 6, 5 };
+    const int increasingValues[] = { 1, 2, 2, 2, 5 };
+    const int decreasingValues[] = { 9, 7, 7, 7, 5 };
+    const int randomValues[] = { 3, 6, 1, 2, 7 };
+    const int constantValues[] = { 7, 7, 7, 7, 7 };
+          int nonConstantArray[] = { 7, 7, 7, 7, 7 };
+    const int inOrderUntilTheEnd [] = { 0, 1, 2, 3, 4, 5, 6, 7, 6 };
+
+    // Test a strictly increasing sequence
+    BOOST_CHECK (  ba::is_strictly_increasing (b_e(strictlyIncreasingValues)));
+    BOOST_CHECK (  ba::is_increasing          (b_e(strictlyIncreasingValues)));
+    BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(strictlyIncreasingValues)));
+    BOOST_CHECK ( !ba::is_decreasing          (b_e(strictlyIncreasingValues)));
+
+    BOOST_CHECK (  ba::is_strictly_increasing (a_range(strictlyIncreasingValues)));
+    BOOST_CHECK (  ba::is_increasing          (a_range(strictlyIncreasingValues)));
+    BOOST_CHECK ( !ba::is_strictly_decreasing (a_range(strictlyIncreasingValues)));
+    BOOST_CHECK ( !ba::is_decreasing          (a_range(strictlyIncreasingValues)));
+
+    // Test a strictly decreasing sequence
+    BOOST_CHECK ( !ba::is_strictly_increasing (b_e(strictlyDecreasingValues)));
+    BOOST_CHECK ( !ba::is_increasing          (b_e(strictlyDecreasingValues)));
+    BOOST_CHECK (  ba::is_strictly_decreasing (b_e(strictlyDecreasingValues)));
+    BOOST_CHECK (  ba::is_decreasing          (b_e(strictlyDecreasingValues)));
+
+    // Test an increasing sequence
+    BOOST_CHECK ( !ba::is_strictly_increasing (b_e(increasingValues)));
+    BOOST_CHECK (  ba::is_increasing          (b_e(increasingValues)));
+    BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(increasingValues)));
+    BOOST_CHECK ( !ba::is_decreasing          (b_e(increasingValues)));
+
+    // Test a decreasing sequence
+    BOOST_CHECK ( !ba::is_strictly_increasing (b_e(decreasingValues)));
+    BOOST_CHECK ( !ba::is_increasing          (b_e(decreasingValues)));
+    BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(decreasingValues)));
+    BOOST_CHECK (  ba::is_decreasing          (b_e(decreasingValues)));
+
+    // Test a random sequence
+    BOOST_CHECK ( !ba::is_strictly_increasing (b_e(randomValues)));
+    BOOST_CHECK ( !ba::is_increasing          (b_e(randomValues)));
+    BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(randomValues)));
+    BOOST_CHECK ( !ba::is_decreasing          (b_e(randomValues)));
+
+    // Test a constant sequence
+    BOOST_CHECK ( !ba::is_strictly_increasing (b_e(constantValues)));
+    BOOST_CHECK (  ba::is_increasing          (b_e(constantValues)));
+    BOOST_CHECK ( !ba::is_strictly_decreasing (b_e(constantValues)));
+    BOOST_CHECK (  ba::is_decreasing          (b_e(constantValues)));
+    
+    // Test an empty sequence
+    BOOST_CHECK (  ba::is_strictly_increasing (strictlyIncreasingValues, strictlyIncreasingValues));
+    BOOST_CHECK (  ba::is_increasing          (strictlyIncreasingValues, strictlyIncreasingValues));
+    BOOST_CHECK (  ba::is_strictly_decreasing (strictlyIncreasingValues, strictlyIncreasingValues));
+    BOOST_CHECK (  ba::is_decreasing          (strictlyIncreasingValues, strictlyIncreasingValues));
+    
+    // Test a one-element sequence
+    BOOST_CHECK (  ba::is_strictly_increasing (strictlyIncreasingValues, strictlyIncreasingValues+1));
+    BOOST_CHECK (  ba::is_increasing          (strictlyIncreasingValues, strictlyIncreasingValues+1));
+    BOOST_CHECK (  ba::is_strictly_decreasing (strictlyIncreasingValues, strictlyIncreasingValues+1));
+    BOOST_CHECK (  ba::is_decreasing          (strictlyIncreasingValues, strictlyIncreasingValues+1));
+
+    // Test a two-element sequence
+    BOOST_CHECK (  ba::is_strictly_increasing (strictlyIncreasingValues, strictlyIncreasingValues+2));
+    BOOST_CHECK (  ba::is_increasing          (strictlyIncreasingValues, strictlyIncreasingValues+2));
+    BOOST_CHECK ( !ba::is_strictly_decreasing (strictlyIncreasingValues, strictlyIncreasingValues+2));
+    BOOST_CHECK ( !ba::is_decreasing          (strictlyIncreasingValues, strictlyIncreasingValues+2));
+    
+    // Test underlying routines
+    BOOST_CHECK (  ba::is_sorted_until ( b_e(strictlyIncreasingValues),     std::less<int>()) ==      a_end(strictlyIncreasingValues));
+    BOOST_CHECK (  ba::is_sorted_until ( a_range(strictlyIncreasingValues), std::less<int>()) == boost::end(strictlyIncreasingValues));
+
+    BOOST_CHECK ( ba::is_sorted_until ( b_e(nonConstantArray),     std::less<int>()) !=      a_end(nonConstantArray));
+    BOOST_CHECK ( ba::is_sorted_until ( a_range(nonConstantArray), std::less<int>()) != boost::end(nonConstantArray));
+
+    BOOST_CHECK ( ba::is_sorted_until ( b_e(randomValues),     std::less<int>()) == &randomValues[2] );
+    BOOST_CHECK ( ba::is_sorted_until ( a_range(randomValues), std::less<int>()) == &randomValues[2] );
+
+    BOOST_CHECK ( ba::is_sorted_until ( b_e(randomValues),     std::less<int>()) == &randomValues[2] );
+    BOOST_CHECK ( ba::is_sorted_until ( a_range(randomValues), std::less<int>()) == &randomValues[2] );
+
+    BOOST_CHECK ( ba::is_sorted_until ( a_range(inOrderUntilTheEnd), std::less<int>()) == &inOrderUntilTheEnd[8] );
+
+//  For zero and one element collections, the comparison predicate should never be called
+    BOOST_CHECK ( ba::is_sorted_until ( a_begin(randomValues), a_begin(randomValues),     std::equal_to<int>()) == a_begin(randomValues));
+    BOOST_CHECK ( ba::is_sorted_until ( a_begin(randomValues), a_begin(randomValues) + 1, std::equal_to<int>()) == a_begin(randomValues) + 1);
+
+}
+
+int test_main( int, char * [] )
+{
+    test_ordered ();
+
+    return 0;
+}

test/partition_copy_test1.cpp

@@ -0,0 +1,87 @@
+/* 
+   Copyright (c) Marshall Clow 2011-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <iostream>
+
+#include <boost/config.hpp>
+#include <boost/algorithm/cxx11/partition_copy.hpp>
+#include <boost/test/included/test_exec_monitor.hpp>
+
+#include <boost/algorithm/cxx11/all_of.hpp>
+#include <boost/algorithm/cxx11/none_of.hpp>
+#include <string>
+#include <vector>
+#include <list>
+
+namespace ba = boost::algorithm;
+// namespace ba = boost;
+
+template <typename Container, typename Predicate>
+void test_sequence ( const Container &c, Predicate comp ) {
+    std::vector<typename Container::value_type> v1, v2;
+    
+    v1.clear (); v2.clear ();
+    ba::partition_copy ( c.begin (), c.end (), 
+                std::back_inserter (v1), std::back_inserter (v2), comp );
+//  std::cout << "Sizes(1): " << c.size () << " -> { " << v1.size () << ", " << v2.size () << " }" << std::endl;
+    BOOST_CHECK ( v1.size () + v2.size () == c.size ());
+    BOOST_CHECK ( ba::all_of  ( v1.begin (), v1.end (), comp ));
+    BOOST_CHECK ( ba::none_of ( v2.begin (), v2.end (), comp ));
+
+    v1.clear (); v2.clear ();
+    ba::partition_copy ( c, std::back_inserter (v1), std::back_inserter ( v2 ), comp );
+//  std::cout << "Sizes(2): " << c.size () << " -> { " << v1.size () << ", " << v2.size () << " }" << std::endl;
+    BOOST_CHECK ( v1.size () + v2.size () == c.size ());
+    BOOST_CHECK ( ba::all_of  ( v1, comp ));
+    BOOST_CHECK ( ba::none_of ( v2, comp ));
+    }
+
+template <typename T>
+struct less_than {
+public:
+    less_than ( T foo ) : val ( foo ) {}
+    less_than ( const less_than &rhs ) : val ( rhs.val ) {}
+
+    bool operator () ( const T &v ) const { return v < val; }
+private:
+    less_than ();
+    less_than operator = ( const less_than &rhs );
+    T val;
+    };
+
+bool is_even ( int v ) { return v % 2 == 0; }
+
+void test_sequence1 () {
+    std::vector<int> v;
+    
+    v.clear ();
+    for ( int i = 5; i < 15; ++i )
+        v.push_back ( i );
+    test_sequence ( v, less_than<int>(3));      // no elements
+    test_sequence ( v, less_than<int>(6));      // only the first element
+    test_sequence ( v, less_than<int>(10));
+    test_sequence ( v, less_than<int>(99));     // all elements satisfy 
+
+//  With bidirectional iterators.
+    std::list<int> l;
+    for ( int i = 5; i < 16; ++i )
+        l.push_back ( i );
+    test_sequence ( l, less_than<int>(3));      // no elements
+    test_sequence ( l, less_than<int>(6));      // only the first element
+    test_sequence ( l, less_than<int>(10));
+    test_sequence ( l, less_than<int>(99));     // all elements satisfy 
+
+    }
+
+
+int test_main( int , char* [] )
+{
+  test_sequence1 ();
+  return 0;
+}

test/partition_point_test1.cpp

@@ -0,0 +1,98 @@
+/* 
+   Copyright (c) Marshall Clow 2011-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <iostream>
+
+#include <boost/config.hpp>
+#include <boost/algorithm/cxx11/partition_point.hpp>
+#include <boost/test/included/test_exec_monitor.hpp>
+
+#include <string>
+#include <vector>
+#include <list>
+
+namespace ba = boost::algorithm;
+// namespace ba = boost;
+
+template <typename Container>
+typename Container::iterator offset_to_iter ( Container &v, int offset ) {
+	typename Container::iterator retval;
+	
+	if ( offset >= 0 ) {
+		retval = v.begin ();
+		std::advance ( retval, offset );
+		}
+	else {
+		retval = v.end ();
+		std::advance ( retval, offset + 1 );
+		}
+	return retval;
+	}
+
+template <typename Container, typename Predicate>
+void test_sequence ( Container &v, Predicate comp, int expected ) {
+    typename Container::iterator res, exp;
+    
+    res = ba::partition_point ( v.begin (), v.end (), comp );
+    exp = offset_to_iter ( v, expected );
+    std::cout << "Expected(1): " << std::distance ( v.begin (), exp ) 
+              <<       ", got: " << std::distance ( v.begin (), res ) << std::endl;
+    BOOST_CHECK ( exp == res );
+
+//  Duplicate the last element; this checks for any even/odd problems
+    v.push_back ( * v.rbegin ());
+    res = ba::partition_point ( v.begin (), v.end (), comp );
+    exp = offset_to_iter ( v, expected );
+    std::cout << "Expected(2): " << std::distance ( v.begin (), exp ) 
+              <<       ", got: " << std::distance ( v.begin (), res ) << std::endl;
+    BOOST_CHECK ( exp == res );
+    }
+
+template <typename T>
+struct less_than {
+public:
+    less_than ( T foo ) : val ( foo ) {}
+    less_than ( const less_than &rhs ) : val ( rhs.val ) {}
+
+    bool operator () ( const T &v ) const { return v < val; }
+private:
+    less_than ();
+    less_than operator = ( const less_than &rhs );
+    T val;
+    };
+
+
+void test_sequence1 () {
+    std::vector<int> v;
+    
+    v.clear ();
+    for ( int i = 5; i < 15; ++i )
+        v.push_back ( i );
+    test_sequence ( v, less_than<int>(3),  0 ); // no elements
+    test_sequence ( v, less_than<int>(6),  1 );    // only the first element
+    test_sequence ( v, less_than<int>(10), 5 );
+    test_sequence ( v, less_than<int>(99), -1 );   // all elements satisfy 
+
+//	With bidirectional iterators.
+    std::list<int> l;
+    for ( int i = 5; i < 15; ++i )
+        l.push_back ( i );
+    test_sequence ( l, less_than<int>(3),  0 ); // no elements
+    test_sequence ( l, less_than<int>(6),  1 );    // only the first element
+    test_sequence ( l, less_than<int>(10), 5 );
+    test_sequence ( l, less_than<int>(99), -1 );   // all elements satisfy 
+
+    }
+
+
+int test_main( int , char* [] )
+{
+  test_sequence1 ();
+  return 0;
+}

test/search_fail1.cpp

@@ -0,0 +1,26 @@
+/* 
+   Copyright (c) Marshall Clow 2010-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <vector>
+#include <boost/algorithm/searching/boyer_moore.hpp>
+
+int main( int argc, char *argv [] )
+{
+    std::vector<char>   cv;
+    std::vector<int>    iv;
+    
+//  Should fail to compile because the underlying types are different
+//  They are (almost certainly) different sizes
+    (void) boost::algorithm::boyer_moore_search (
+        cv.begin (), cv.end (), iv.begin (), iv.end ());
+
+   
+   (void) argv; (void) argc;
+   return 0;
+}

test/search_fail2.cpp

@@ -0,0 +1,27 @@
+/* 
+   Copyright (c) Marshall Clow 2010-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <vector>
+#include <boost/cstdint.hpp>
+#include <boost/algorithm/searching/boyer_moore.hpp>
+
+int main( int argc, char *argv [] )
+{
+    std::vector<boost::uint8_t> cv;
+    std::vector<boost:: int8_t> iv;
+    
+//  Should fail to compile because the underlying types are different
+//  They are the same size, but one is signed, and the other is not.
+    (void) boost::algorithm::boyer_moore_search (
+        cv.begin (), cv.end (), iv.begin (), iv.end ());
+
+   
+   (void) argv; (void) argc;
+   return 0;
+}

test/search_fail3.cpp

@@ -0,0 +1,20 @@
+/* 
+   Copyright (c) Marshall Clow 2010-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <vector>
+#include <boost/algorithm/searching/boyer_moore.hpp>
+
+int main( int argc, char *argv [] )
+{
+//  Should fail to compile because the search objects are not default-constructible
+    boost::algorithm::boyer_moore<std::vector<char>::iterator> bm;
+   
+   (void) argv; (void) argc;
+   return 0;
+}

test/search_test1.cpp

@@ -0,0 +1,272 @@
+/* 
+   Copyright (c) Marshall Clow 2010-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <boost/algorithm/searching/boyer_moore.hpp>
+#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
+#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
+
+#include <boost/test/included/test_exec_monitor.hpp>
+
+#include <iostream>
+#include <string>
+#include <vector>
+
+
+namespace ba = boost::algorithm;
+
+template <typename Iter>
+std::string make_str ( Iter first, std::size_t len ) {
+    std::string retVal ( len + 2, '\'' );
+    std::copy ( first, first+len, retVal.begin () + 1);
+    return retVal;
+    }
+
+namespace {
+
+//  Check using iterators
+    template<typename Container>
+    void check_one_iter ( const Container &haystack, const std::string &needle, int expected ) {
+        typedef typename Container::const_iterator iter_type;
+        typedef std::string::const_iterator pattern_type;
+
+        iter_type hBeg = haystack.begin ();
+        iter_type hEnd = haystack.end ();
+        pattern_type nBeg = needle.begin ();
+        pattern_type nEnd = needle.end ();
+
+        iter_type it0  = std::search                     (hBeg, hEnd, nBeg, nEnd);
+        iter_type it1  = ba::boyer_moore_search          (hBeg, hEnd, nBeg, nEnd);
+        iter_type it1r = ba::boyer_moore_search          (haystack, nBeg, nEnd);
+        iter_type it2  = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd);
+        iter_type it3  = ba::knuth_morris_pratt_search   (hBeg, hEnd, nBeg, nEnd);
+        const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
+
+        std::cout << "(Iterators) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
+        try {
+            if ( it0 != it1 ) {
+                throw std::runtime_error ( 
+                    std::string ( "results mismatch between std::search and boyer-moore search" ));
+                }
+
+            if ( it1 != it1r ) {
+                throw std::runtime_error ( 
+                    std::string ( "results mismatch between iterator and range boyer_moore search" ));
+                }
+
+            if ( it1 != it2 ) {
+                throw std::runtime_error ( 
+                    std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
+                }
+
+            if ( it1 != it3 )
+                throw std::runtime_error ( 
+                    std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
+
+            }
+
+        catch ( ... ) {
+            std::cout << "Searching for: " << needle << std::endl;
+            std::cout << "Expected: " << expected << "\n";
+            std::cout << "  std:    " << std::distance ( hBeg, it0 ) << "\n";
+            std::cout << "  bm:     " << std::distance ( hBeg, it1 ) << "\n";
+            std::cout << "  bm(r):  " << std::distance ( hBeg, it1r ) << "\n";
+            std::cout << "  bmh:    " << std::distance ( hBeg, it2 ) << "\n";
+            std::cout << "  kpm:    " << std::distance ( hBeg, it3 )<< "\n";
+            std::cout << std::flush;
+            throw ;
+            }
+
+        BOOST_CHECK_EQUAL ( dist, expected );
+        }
+
+//  Check using pointers
+//    We're assuming that the container implements contiguous storage here.
+    template<typename Container>
+    void check_one_pointer ( const Container &haystack, const std::string &needle, int expected ) {
+        typedef const typename Container::value_type *ptr_type;
+        ptr_type hBeg = haystack.size () == 0 ? NULL : &*haystack.begin ();
+        ptr_type hEnd = hBeg + haystack.size ();
+        ptr_type nBeg = needle.size () == 0 ? NULL : &*needle.begin ();
+        ptr_type nEnd = nBeg + needle.size ();
+
+        ptr_type it0  = std::search                     (hBeg, hEnd, nBeg, nEnd);
+        ptr_type it1  = ba::boyer_moore_search          (hBeg, hEnd, nBeg, nEnd);
+        ptr_type it2  = ba::boyer_moore_horspool_search (hBeg, hEnd, nBeg, nEnd);
+        ptr_type it3  = ba::knuth_morris_pratt_search   (hBeg, hEnd, nBeg, nEnd);
+        const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
+
+        std::cout << "(Pointers) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
+        try {
+            if ( it0 != it1 ) {
+                throw std::runtime_error ( 
+                    std::string ( "results mismatch between std::search and boyer-moore search" ));
+                }
+
+            if ( it1 != it2 ) {
+                throw std::runtime_error ( 
+                    std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
+                }
+
+            if ( it1 != it3 )
+                throw std::runtime_error ( 
+                    std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
+
+            }
+
+        catch ( ... ) {
+            std::cout << "Searching for: " << needle << std::endl;
+            std::cout << "Expected: " << expected << "\n";
+            std::cout << "  std:    " << std::distance ( hBeg, it0 ) << "\n";
+            std::cout << "  bm:     " << std::distance ( hBeg, it1 ) << "\n";
+            std::cout << "  bmh:    " << std::distance ( hBeg, it2 ) << "\n";
+            std::cout << "  kpm:    " << std::distance ( hBeg, it3 )<< "\n";
+            std::cout << std::flush;
+            throw ;
+            }
+
+        BOOST_CHECK_EQUAL ( dist, expected );
+        }
+
+//  Check using objects
+    template<typename Container>
+    void check_one_object ( const Container &haystack, const std::string &needle, int expected ) {
+        typedef typename Container::const_iterator iter_type;
+        typedef std::string::const_iterator pattern_type;
+
+        iter_type hBeg = haystack.begin ();
+        iter_type hEnd = haystack.end ();
+        pattern_type nBeg = needle.begin ();
+        pattern_type nEnd = needle.end ();
+
+        ba::boyer_moore<pattern_type>          bm_r  = ba::make_boyer_moore ( needle );
+        ba::boyer_moore<pattern_type>          bm    ( nBeg, nEnd );
+        ba::boyer_moore_horspool<pattern_type> bmh   ( nBeg, nEnd );
+        ba::knuth_morris_pratt<pattern_type>   kmp   ( nBeg, nEnd );
+        
+        iter_type it0  = std::search  (hBeg, hEnd, nBeg, nEnd);
+        iter_type it1  = bm           (hBeg, hEnd);
+        iter_type it1r = bm           (haystack);
+        iter_type rt1  = bm_r         (hBeg, hEnd);
+        iter_type rt1r = bm_r         (haystack);
+        iter_type it2  = bmh          (hBeg, hEnd);
+        iter_type it3  = kmp          (hBeg, hEnd);
+        const int dist = it1 == hEnd ? -1 : std::distance ( hBeg, it1 );
+
+        std::cout << "(Objects) Pattern is " << needle.length () << ", haysstack is " << haystack.length () << " chars long; " << std::endl;
+        try {
+            if ( it0 != it1 ) {
+                throw std::runtime_error ( 
+                    std::string ( "results mismatch between std::search and boyer-moore search" ));
+                }
+
+            if ( it1 != it1r ) {
+                throw std::runtime_error ( 
+                    std::string ( "results mismatch between iterator and range boyer_moore search(1)" ));
+                }
+
+            if ( it1 != rt1 ) {
+                throw std::runtime_error ( 
+                    std::string ( "results mismatch between iterator and range boyer_moore search(2)" ));
+                }
+
+            if ( rt1 != rt1r ) {
+                throw std::runtime_error ( 
+                    std::string ( "results mismatch between iterator and range boyer_moore search(3)" ));
+                }
+
+            if ( it1 != it2 ) {
+                throw std::runtime_error ( 
+                    std::string ( "results mismatch between boyer-moore and boyer-moore-horspool search" ));
+                }
+
+            if ( it1 != it3 )
+                throw std::runtime_error ( 
+                    std::string ( "results mismatch between boyer-moore and knuth-morris-pratt search" ));
+
+            }
+
+        catch ( ... ) {
+            std::cout << "Searching for: " << needle << std::endl;
+            std::cout << "Expected: " << expected << "\n";
+            std::cout << "  std:    " << std::distance ( hBeg, it0 ) << "\n";
+            std::cout << "  bm:     " << std::distance ( hBeg, it1 ) << "\n";
+            std::cout << "  bm(r1):  " << std::distance ( hBeg, it1r ) << "\n";
+            std::cout << "  bm(r2):  " << std::distance ( hBeg, rt1 ) << "\n";
+            std::cout << "  bm(r3):  " << std::distance ( hBeg, rt1r ) << "\n";
+            std::cout << "  bmh:    " << std::distance ( hBeg, it2 ) << "\n";
+            std::cout << "  kpm:    " << std::distance ( hBeg, it3 )<< "\n";
+            std::cout << std::flush;
+            throw ;
+            }
+
+        BOOST_CHECK_EQUAL ( dist, expected );
+        }
+
+
+    template<typename Container>
+    void check_one ( const Container &haystack, const std::string &needle, int expected ) {
+        check_one_iter ( haystack, needle, expected );
+        check_one_pointer ( haystack, needle, expected );
+        check_one_object ( haystack, needle, expected );
+        }
+    }
+
+
+int test_main( int , char* [] )
+{
+    std::string haystack1 ( "NOW AN FOWE\220ER ANNMAN THE ANPANMANEND" );
+    std::string needle1   ( "ANPANMAN" );
+    std::string needle2   ( "MAN THE" );
+    std::string needle3   ( "WE\220ER" );
+    std::string needle4   ( "NOW " );   //  At the beginning
+    std::string needle5   ( "NEND" );   //  At the end
+    std::string needle6   ( "NOT FOUND" );  // Nowhere
+    std::string needle7   ( "NOT FO\340ND" );   // Nowhere
+
+    std::string haystack2 ( "ABC ABCDAB ABCDABCDABDE" );
+    std::string needle11  ( "ABCDABD" );
+
+    std::string haystack3 ( "abra abracad abracadabra" );
+    std::string needle12  ( "abracadabra" );
+
+    std::string needle13   ( "" );
+    std::string haystack4  ( "" );
+
+    check_one ( haystack1, needle1, 26 );
+    check_one ( haystack1, needle2, 18 );
+    check_one ( haystack1, needle3,  9 );
+    check_one ( haystack1, needle4,  0 );
+    check_one ( haystack1, needle5, 33 );
+    check_one ( haystack1, needle6, -1 );
+    check_one ( haystack1, needle7, -1 );
+
+    check_one ( needle1, haystack1, -1 );   // cant find long pattern in short corpus
+    check_one ( haystack1, haystack1, 0 );  // find something in itself
+    check_one ( haystack2, haystack2, 0 );  // find something in itself
+
+    check_one ( haystack2, needle11, 15 );
+    check_one ( haystack3, needle12, 13 );
+
+    check_one ( haystack1, needle13, 0 );   // find the empty string 
+    check_one ( haystack4, needle1, -1 );  // can't find in an empty haystack
+
+//  Mikhail Levin <svarneticist@gmail.com> found a problem, and this was the test
+//  that triggered it.
+
+  const std::string mikhail_pattern =   
+"GATACACCTACCTTCACCAGTTACTCTATGCACTAGGTGCGCCAGGCCCATGCACAAGGGCTTGAGTGGATGGGAAGGA"
+"TGTGCCCTAGTGATGGCAGCATAAGCTACGCAGAGAAGTTCCAGGGCAGAGTCACCATGACCAGGGACACATCCACGAG"
+"CACAGCCTACATGGAGCTGAGCAGCCTGAGATCTGAAGACACGGCCATGTATTACTGTGGGAGAGATGTCTGGAGTGGT"
+"TATTATTGCCCCGGTAATATTACTACTACTACTACTACATGGACGTCTGGGGCAAAGGGACCACG"
+;
+    const std::string mikhail_corpus = std::string (8, 'a') + mikhail_pattern;
+
+    check_one ( mikhail_corpus, mikhail_pattern, 8 );
+    return 0;
+    }

test/search_test2.cpp

@@ -0,0 +1,145 @@
+/* 
+   Copyright (c) Marshall Clow 2010-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <boost/algorithm/searching/boyer_moore.hpp>
+#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
+#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
+
+#include <boost/test/included/test_exec_monitor.hpp>
+
+#include <iostream>
+#include <algorithm>
+#include <vector>
+
+typedef std::vector<char> vec;
+#define NUM_TRIES   100
+
+#define runOne(call, refDiff)   { \
+    std::clock_t bTime, eTime;                              \
+    bTime = std::clock ();                                  \
+    for ( i = 0; i < NUM_TRIES; ++i ) {                     \
+        res = boost::algorithm::call                        \
+            ( haystack.begin (), haystack.end (),           \
+                        needle.begin (), needle.end ());    \
+        if ( res != exp ) {                                 \
+            std::cout << "On run # " << i << " expected "   \
+                << exp - haystack.begin () << " got "       \
+                << res - haystack.begin () << std::endl;    \
+            throw std::runtime_error                        \
+                ( "Unexpected result from " #call );        \
+            }                                               \
+        }                                                   \
+    eTime = std::clock ();                                  \
+    printRes ( #call, eTime - bTime, refDiff ); }
+
+#define runObject(obj, refDiff) { \
+    std::clock_t bTime, eTime;                              \
+    bTime = std::clock ();                                  \
+    boost::algorithm::obj <vec::const_iterator>             \
+                s_o ( needle.begin (), needle.end ());      \
+    for ( i = 0; i < NUM_TRIES; ++i ) {                     \
+        res = s_o ( haystack.begin (), haystack.end ());    \
+        if ( res != exp ) {                                 \
+            std::cout << "On run # " << i << " expected "   \
+            << exp - haystack.begin () << " got "           \
+            << res - haystack.begin () << std::endl;        \
+            throw std::runtime_error                        \
+            ( "Unexpected result from " #obj " object" );   \
+            }                                               \
+        }                                                   \
+    eTime = std::clock ();                                  \
+    printRes ( #obj " object", eTime - bTime, refDiff ); }
+    
+
+
+namespace {
+
+    vec ReadFromFile ( const char *name ) {
+        std::ifstream in ( name, std::ios_base::binary | std::ios_base::in );
+        vec retVal;
+        std::istream_iterator<char, char> begin(in);
+        std::istream_iterator<char, char> end;
+        
+        std::copy ( begin, end, std::back_inserter ( retVal ));
+        return retVal;
+        }
+    
+    void printRes ( const char *prompt, unsigned long diff, unsigned long stdDiff ) {
+        std::cout 
+            << std::setw(34) << prompt << " "
+            << std::setw(6)  << (  1.0 * diff) / CLOCKS_PER_SEC << " seconds\t"
+            << std::setw(5)  << (100.0 * diff) / stdDiff << "% \t" 
+            << std::setw(12) << diff;
+        if ( diff > stdDiff ) 
+            std::cout << " !!";
+        std::cout << std::endl;
+        }
+    
+    void check_one ( const vec &haystack, const vec &needle, int expected ) {
+        std::size_t i;
+        std::clock_t sTime;
+        unsigned long stdDiff;
+        
+        vec::const_iterator res;
+        vec::const_iterator exp;        // the expected result
+        
+        if ( expected >= 0 )
+            exp = haystack.begin () + expected;
+        else if ( expected == -1 )
+            exp = haystack.end ();      // we didn't find it!
+        else if ( expected == -2 )
+            exp = std::search ( haystack.begin (), haystack.end (), needle.begin (), needle.end ());
+        else    
+            throw std::logic_error ( "Expected must be -2, -1, or >= 0" );
+
+        std::cout << "Pattern is " << needle.size ()   << " entries long" << std::endl;
+        std::cout << "Corpus  is " << haystack.size () << " entries long" << std::endl;
+
+    //  First, the std library search
+        sTime = std::clock ();
+        for ( i = 0; i < NUM_TRIES; ++i ) {
+            res = std::search ( haystack.begin (), haystack.end (), needle.begin (), needle.end ());
+            if ( res != exp ) {
+                std::cout << "On run # " << i << " expected " << exp - haystack.begin () << " got " << res - haystack.begin () << std::endl;
+                throw std::runtime_error ( "Unexpected result from std::search" );
+                }
+            }
+        stdDiff = std::clock () - sTime;
+        printRes ( "std::search", stdDiff, stdDiff );
+
+        runOne    ( boyer_moore_search,          stdDiff );
+        runObject ( boyer_moore,                 stdDiff );
+        runOne    ( boyer_moore_horspool_search, stdDiff );
+        runObject ( boyer_moore_horspool,        stdDiff );
+        runOne    ( knuth_morris_pratt_search,   stdDiff );
+        runObject ( knuth_morris_pratt,          stdDiff );
+        }
+    }
+
+int test_main( int , char* [] )
+{
+    vec c1  = ReadFromFile ( "search_test_data/0001.corpus" );
+    vec p1b = ReadFromFile ( "search_test_data/0001b.pat" );
+    vec p1e = ReadFromFile ( "search_test_data/0001e.pat" );
+    vec p1n = ReadFromFile ( "search_test_data/0001n.pat" );
+    vec p1f = ReadFromFile ( "search_test_data/0001f.pat" );
+    
+    std::cout << std::ios::fixed << std::setprecision(4);
+//  std::cout << "Corpus is " << c1.size () << " entries long\n";
+    std::cout << "--- Beginning ---" << std::endl;
+    check_one ( c1, p1b, 0 );       //  Find it at position zero
+    std::cout << "---- Middle -----" << std::endl;
+    check_one ( c1, p1f, -2 );      //  Don't know answer
+    std::cout << "------ End ------" << std::endl;
+    check_one ( c1, p1e, c1.size() - p1e.size ());  
+    std::cout << "--- Not found ---" << std::endl;
+    check_one ( c1, p1n, -1 );      //  Not found
+    
+    return 0;
+    }

test/search_test3.cpp

@@ -0,0 +1,145 @@
+/* 
+   Copyright (c) Marshall Clow 2010-2012.
+
+   Distributed under the Boost Software License, Version 1.0. (See accompanying
+   file LICENSE_1_0.txt or copy at http://www.boost.org/LICENSE_1_0.txt)
+
+    For more information, see http://www.boost.org
+*/
+
+#include <boost/algorithm/searching/boyer_moore.hpp>
+#include <boost/algorithm/searching/boyer_moore_horspool.hpp>
+#include <boost/algorithm/searching/knuth_morris_pratt.hpp>
+
+#include <boost/test/included/test_exec_monitor.hpp>
+
+#include <iostream>
+#include <algorithm>
+#include <vector>
+#include <string>
+
+typedef std::vector<std::string> vec;
+#define NUM_TRIES   100
+
+#define runOne(call, refDiff)   { \
+    std::clock_t bTime, eTime;                              \
+    bTime = std::clock ();                                  \
+    for ( i = 0; i < NUM_TRIES; ++i ) {                     \
+        res = boost::algorithm::call                        \
+            ( haystack.begin (), haystack.end (),           \
+                        needle.begin (), needle.end ());    \
+        if ( res != exp ) {                                 \
+            std::cout << "On run # " << i << " expected "   \
+                << exp - haystack.begin () << " got "       \
+                << res - haystack.begin () << std::endl;    \
+            throw std::runtime_error                        \
+                ( "Unexpected result from " #call );        \
+            }                                               \
+        }                                                   \
+    eTime = std::clock ();                                  \
+    printRes ( #call, eTime - bTime, refDiff ); }
+    
+#define runObject(obj, refDiff) { \
+    std::clock_t bTime, eTime;                              \
+    bTime = std::clock ();                                  \
+    boost::algorithm::obj <vec::const_iterator>             \
+                s_o ( needle.begin (), needle.end ());      \
+    for ( i = 0; i < NUM_TRIES; ++i ) {                     \
+        res = s_o ( haystack.begin (), haystack.end ());    \
+        if ( res != exp ) {                                 \
+            std::cout << "On run # " << i << " expected "   \
+            << exp - haystack.begin () << " got "           \
+            << res - haystack.begin () << std::endl;        \
+            throw std::runtime_error                        \
+            ( "Unexpected result from " #obj " object" );   \
+            }                                               \
+        }                                                   \
+    eTime = std::clock ();                                  \
+    printRes ( #obj " object", eTime - bTime, refDiff ); }
+    
+
+namespace {
+
+    vec ReadFromFile ( const char *name ) {
+        std::ifstream in ( name, std::ios_base::binary | std::ios_base::in );
+        std::string temp;
+        vec retVal;
+        while ( std::getline ( in, temp ))
+            retVal.push_back ( temp );
+        
+        return retVal;
+        }
+    
+    void printRes ( const char *prompt, unsigned long diff, unsigned long stdDiff ) {
+        std::cout 
+            << std::setw(34) << prompt << " "
+            << std::setw(6)  << (  1.0 * diff) / CLOCKS_PER_SEC << " seconds\t"
+            << std::setw(5)  << (100.0 * diff) / stdDiff << "% \t" 
+            << std::setw(12) << diff;
+        if ( diff > stdDiff ) 
+            std::cout << " !!";
+        std::cout << std::endl;
+        }
+    
+    void check_one ( const vec &haystack, const vec &needle, int expected ) {
+        std::size_t i;
+        std::clock_t sTime;
+        unsigned long stdDiff;
+        
+        vec::const_iterator res;
+        vec::const_iterator exp;        // the expected result
+        
+        if ( expected >= 0 )
+            exp = haystack.begin () + expected;
+        else if ( expected == -1 )
+            exp = haystack.end ();      // we didn't find it1
+        else if ( expected == -2 )
+            exp = std::search ( haystack.begin (), haystack.end (), needle.begin (), needle.end ());
+        else    
+            throw std::logic_error ( "Expected must be -2, -1, or >= 0" );
+
+        std::cout << "Pattern is " << needle.size ()   << " entries long" << std::endl;
+        std::cout << "Corpus  is " << haystack.size () << " entries long" << std::endl;
+
+    //  First, the std library search
+        sTime = std::clock ();
+        for ( i = 0; i < NUM_TRIES; ++i ) {
+            res = std::search ( haystack.begin (), haystack.end (), needle.begin (), needle.end ());
+            if ( res != exp ) {
+                std::cout << "On run # " << i << " expected " << exp - haystack.begin () << " got " << res - haystack.begin () << std::endl;
+                throw std::runtime_error ( "Unexpected result from std::search" );
+                }
+            }
+        stdDiff = std::clock () - sTime;
+        printRes ( "std::search", stdDiff, stdDiff );
+
+        runOne    ( boyer_moore_search,          stdDiff );
+        runObject ( boyer_moore,                 stdDiff );
+        runOne    ( boyer_moore_horspool_search, stdDiff );
+        runObject ( boyer_moore_horspool,        stdDiff );
+        runOne    ( knuth_morris_pratt_search,   stdDiff );
+        runObject ( knuth_morris_pratt,          stdDiff );
+        }
+    }
+
+int test_main( int , char* [] )
+{
+    vec c1  = ReadFromFile ( "search_test_data/0001.corpus" );
+    vec p1b = ReadFromFile ( "search_test_data/0002b.pat" );
+    vec p1e = ReadFromFile ( "search_test_data/0002e.pat" );
+    vec p1n = ReadFromFile ( "search_test_data/0002n.pat" );
+    vec p1f = ReadFromFile ( "search_test_data/0002f.pat" );
+
+    std::cout << std::ios::fixed << std::setprecision(4);
+//  std::cout << "Corpus is " << c1.size () << " entries long\n";
+    std::cout << "--- Beginning ---" << std::endl;
+    check_one ( c1, p1b, 0 );       //  Find it at position zero
+    std::cout << "---- Middle -----" << std::endl;
+    check_one ( c1, p1f, -2 );      //  Don't know answer
+    std::cout << "------ End ------" << std::endl;
+    check_one ( c1, p1e, c1.size() - p1e.size ());  
+    std::cout << "--- Not found ---" << std::endl;
+    check_one ( c1, p1n, -1 );      //  Not found
+    
+    return 0;
+    }

test/search_test_data/0001b.pat

@@ -0,0 +1,2 @@
+TU0AKgAfhPqScHN4dnZ2e3p5e3h7eXl4dnd1dnV3enp5dnd3dHV1dHNzd3l3eHh5
+eXZ4dXd2dHNwcHFwcXBxc3h0dHN1eHVzcXV1dXV2c3h5dHV3eHVwcHF

test/search_test_data/0001e.pat

@@ -0,0 +1,2 @@
+iBJbmMuLCBhbGwg
+cmlnaHRzIHJlc2VydmVkLgAAAAA=

test/search_test_data/0001f.pat

@@ -0,0 +1,2 @@
+q/y9PZ3uHj5ufo6UJDQ0NFQz8+RUZBQEBAOzo6Ozs4Nz06Ojs4Ojo9PT47Ojk0
+Nzc7OjQ6NzU6OjgxMzg1OjY2NjU3NTU1Nzc3NTU1NzU

test/search_test_data/0001n.pat

@@ -0,0 +1,2 @@
+TIzMjIyMjM0MjM1nTQzNTc3MzY1NDU2NzQ2MjEwMjU1MTQ2NzU0NDI1
+NDMyMzQxMzQ0NDU1MjU2NTc5NzU1NDc4ODY1

test/search_test_data/0002b.pat

@@ -0,0 +1,170 @@
+TU0AKgAfhPqScHN4dnZ2e3p5e3h7eXl4dnd1dnV3enp5dnd3dHV1dHNzd3l3eHh5
+eXZ4dXd2dHNwcHFwcXBxc3h0dHN1eHVzcXV1dXV2c3h5dHV3eHVwcHF1d3V0dXJy
+cXNzcHBwcHJyc3R0dXl7eHJycnF1dHV2d3h4eHV0cnRycXN1dXN0c3R0c3R0cXJx
+cHNxb3B0c29scHFybm9sbGpscXJ1c3NycXN0cHFvb3JzdHBycG9vb29vb29ubXBt
+bG9vcW5tbGptb3Fwb3Bwb25vbXFtbGtvbGlrbnBuamxsbW1rbW1vbm1ub3Btamxw
+bWpsbG9xcG5ua2tpamhqZ2hnam5saWhsbG1nZmZnZ2lnamtxa2ppZWZmZWlrZ2hp
+Z2hraWRmZ2psa2pmZWVkZmplZWZiYF1gZGVlYmJiY2RhY2NiYVxdW1xgXl9iZV9d
+X11hXF5gZWJhYF5dXWFmYl9hXl5gXmBhZGFhYV1cYWFiX2FgXFxgYF5iYmNiYWRk
+YWFjYGFgXl9jYmVlZGZiYV1cXFtbW1pYV1dVV1VWVlFQT1FRUVBRTkxLSktNTVFP
+UU1RUVBSUlBPUlNTUVRWWFpcVldXWldXVVhYVlpbWV1dX1tbW11fYWFdXV5iY2Rg
+YFxeYmNmZGJgYFxdYmdjYWFhYGJoZGReXF9gX2BhYWJhXltdXVtaXGJlYV5gYF9f
+XVxcX2JiYWJkZmNjZGNhYmFcW15dXmBgX1xdYF5fXF5eX15bWV1dXl9eWlldXGJf
+XmFgXVpcXF1dXlpdXl9dXWRlYF5cXFtfYF1eYl1hX1xbXV1ZV1hZWltbW1peW1lb
+XlteW1xeXlxbXVpYW11dY19fW1xfX2NhXV5hZWNfX2FjZGJlZmVoaWtlY2FkXl5f
+YWJjX19fX15dXWBjYmJeWlteXVlaXmBeXF1fXVxdXFtaW19dXFtfWllZWVxeXlxb
+XV9eW1xcXF5cW1paVVdbWVteW1pbWlZeYV1ZV1tYVlVWV1hbWVhcWVhVWlhbWFtX
+V1ZWWFtXVlZaVlRVVVdVVldWVlNRU1NTUVNXVVlZWVZVVFNWVlRTU1JVV1ZWVFRU
+UVFVWVpZWlZWWFpYWllcXVpYWFdWWFxbWFlYWVhVVVRVV1dZWllYV1lcXVpcWVhY
+V1VbW1tVVVdaXFpXVlZZW1leW1lWWFdaXVpXWlZXW1xdXFxgX1xYXVxcXFhaW1tb
+WlxcWltdWldXVldXWVZVUVJVWFlcW1tcWVpgXF9hX11aWVpdXFxeXFtbX19aW1lb
+W1paWlxdXVpaXVxeX1xdX2JjYV9gYl9cW1xbWFpeXl1gYGBgYFtdY2JhYmBgYGBe
+YGJkY2NjYmNjYGNiY2JgX19hYV1gX2BgX19hZWRiZWJjZWVgYmFiZGRmaWdmYWJj
+YmJjZGFhY2FhY2RkZmVmY2FhYWVnaWVjZGNhY2RlZWZqZ2doZ2RjZGRmaGVlZmZm
+Z2dnaGhoZ2hmY2VmZWZjZWNlaWdlZmVoZ2hpamlra2hram1samtqZWpuc2tpa21u
+bmtraWtqYWNmZmZmZGVpZ2p0kMLk8vv+/////////5drcHZ1dnd7fHt6end0c3V1
+dnR0d3l3d3Z3fH16dnV2d3h0d3l2d3h4dXZ3d3d3dnBucW5vb3BxdHR3d3Jzd3Vz
+dndzc3V6eHVyc3JydXZxc3Z1d3V0eHZ1c3Bvc3V0dnR0dXR0dHd4dnRxc3J0c3d3
+dXNycXd1dnVzcHJ0d3h0dHFwcXFzc3N0dXFxcXFwcHFwcnFycHJwcHJzc3Fwc3Nx
+cnRyc29ucHJ0cnBwb29ub3Fwc3R0cnJubnBycG1ucHBxcXBuc3FwbGpoamlsb3By
+c25qaW1tcW1qbXFua25xb21vcG9tbG5qa2doaW1sbGpqamxsaWpmZ2VlZ2tqZ2Zn
+amVoa2tvZ2ttamxpamlmZmdoZ2dnZ2traWZmaGlpa2loaGdmZ2ZoZmRnZ2ZmZ2Vl
+ZmJiZWBhYmBhZGBhX2BfXVxfYmJkZF5dY2JjYWNhY2BgXl5gXl5dXl5cXFxgZGVh
+Xl5eXlxeXl5iYl9fYF9iYWFhZWRkY2RgX2BhX19gY2VlZWRkZF1gYV9bWV1dWVxX
+WldXVlZVU1BQUE5QUU9SUU5NUE9OTk9NT1FRUk5PUVRUUVJSVFVYWVpXVldVVlRV
+V1dZXl9bW1pYWVhaXl9gXl5bYGJhYWFhX19jZGZmZGJgYF9eX19fYWRmX2RgYWBe
+XmFhYWNhYmBeXV5eW1xdYF5dX2NiX19hX11dYmVoY2RlZWFeYF5fXV5hYGFgYF9i
+Y19dXl5dYGNgXFZbXlxZWVxhYl5gYF9cXV1cXFxdX19gYVxZW11dX2NjXF5eXF5e
+Xl9eYGJfXl9eW1xcX11ZW1xdW15eW11gXl1dW11cX15dXl1cXF5iX2BgYV9iYmJf
+XF1mY2NiamZiYWNiY2JiYmVpbGdkYGBmY2VoY11dXFxcX15iYmFiYmBeW19hX19h
+XV5aYlxZWlxcW1xcW2BfW1hZXF5cXVtcXlxbWldYW1xcXVpYWFlYWllbW1paWFpe
+XFtYWFdUU1ZVWFhVWFteWFdYW1pYVlhVU1RVWVZXVVdXVVFSU1ZWVFNSVVtSUlJT
+UlNUVVVWVVVWVVJWVVVTVldXXFlXVVlbVVNUWVtXWVtVVVZVWltZWltYVVVZWVlY
+V1ZXWVVUV1dXWl1dW1tcX1lZWl5cXVtcWVVXXFxZXVxZVVRUWVlcWVZWWFhaWFtd
+WV5YVlZZWVxbXFxdXFtbXl5dXVtbWV5dYF9cXl9eXF9iXl5bWlhbWltZWFpgXlpa
+W15iXF1jYVtcYGBfXVpbXFxcWlxbXFtZXFxaWllaXl1aW11gXV5fX19fX19hXl5f
+YGFgYWBhXmBiXlxfXFtcXmBgYmJkYWJgYmNgYGJiYWBfX19jZWBeYWJgYFxcY2Vj
+ZGJfX2JiYWNmY2RjYmFhYWFjYWNpZmNjZ2ZkZGBiYmVmZ2VjYmNlZV9iZWhlZWJi
+Y2JmZWdoZWVoZmdrZ2VmZmhmZGRkZ2VmZmVkZmppZmVnaGhqamhiZmZnaWdnamZm
+ZmtubGtpZWhna21rZmRpaWVlZ2l0bGtrbG1obmdmamZnaGVkZGNobYekwePx+///
+////////l2pzdnh3fHt8enp5fnl2d3Vyc3d5eXd1d3d3eXx+eHp3eHR0d3d6enl1
+dHNzc3d1dXNwcHJ0c3Byc3V3eXVycnZ5enl3dnh3dnJxdHZ3dXh8eHl1dXZ3dnZ1
+dHV0ent2dXl3dXV1d3h3dnZ3enV0d3d0dXN3dXZ1dnd3d3h6eHZzc3JwcnN0dHJy
+cXFub3FycW9vcHBvbGxsbXFzcHF1c3N0dHR0c3Bvc3N1cnFvcW9tbXFzcm5ub3Bw
+b21ucXBxcXBvc3Bvbm5sa25sbW1vbnJ0b2trbWpqbGtsbnFxcG9vbm1xbm5tbGpp
+amtqbm1rbW9sa21taWhoZmlqaGlramxqaWdraGdqaWluam9ua2psamhkZmxpaWpq
+aWVlZWdnaGZjY2RpZmZnZmZmZ2ZnZGFhZWNgZGJhY11dXV5hXF9lZGRiY2JhYV5f
+YGZgYF5fYWJgYmBgX15gZF9eYF1gYlxeYV5fYV5eYF5gYWJkX2JhZGNlZGJjYmFh
+YWNgY2VhZGZkY2JgYWBjY15fXFtaWllaXFlYVlNRUVNTUU5PUlNSVlRPU09PUVJS
+U1FNT1JVUk9RU1NRU1NSVFRWVllWWFtXWFhaWlpeXl1hYV9cXV5fXl9gXmFgYGBh
+ZmJjYmJjYV9fX19dYWFiZmRiYWBeX2FcW15fYWBfXmNkX11cXF1cXVxfYl9hYWJd
+X2BhY2JjX2BkZGFgYWFfYWFgYF9eX2JiZGVjY19dYF9eXV1eXF9hXmBeXF1fXV9b
+XGFhY2FkX11dW1peXl9hYWJgX19jYV5dYGFgYGBdWV5cXV9hYGBcX2BhYF5gZWBb
+X19dXWBeXl1eYWNhXl1eYGFhYGFgYWFhZGNiZGZoZWdnZWNgXWFhX2NlY2NjYGBl
+Y2NjY11bXl9eXmBiYGFgXF9kYF5iYF9iYl9cW15aWV5fXFtaWVpdW1xfYGBfXV5d
+XFtcWlhXVlZWWFhYV1ZWV1daWlhbWlpcXFhaWFdYVldYWFlZWWFYWltYWVhSVFdV
+VlpWV1RYV1VTVFRYVVRWU1RUVVhWVVRUVFZXVFVXV1VWV1ZYV1lcbltbWV5ZWlpX
+V1VSWFtfW1laXV5bWFpZWlpYWVhYW1hYV1daWVlZV15dWlxgXVpZWV1hXFpbW1dY
+WlpZVldXWlpWVlZXWlhaWVlZWVpZW1xbWltcWVhaXVxdWVxZWVtaX2BfXFlaWVte
+XV5dXV9eXF9bW1xbXl9hXFdcXlxbWVpbXFpcWF1gXV9gYF9aW11cX15dX19gXFtY
+WVtZW1tdXWBiYWBfXV5cXV5dX15eXV1iZWRhYWFiYF9eYmBeXV5dYWBdXWBlY2Fh
+YWRfYF9hY2RhZGJjZGZjYmJfYV5fZGJkYWBgYGBjY2RlaGNhY2BjYF9eYWJgY2Vk
+Y2JlZWRhYmRlY2FjY2RjY2RjY2NjYWBkY2NjZGVjYWRnaGhramtqZmdnZmhoZ2pn
+aGhoZmhpa2lpaGhoZ2hlZmdqaGZsbWhpamlqamppa21qaGhmaGxqZWVra25sbW5p
+aWhraWprbW1pZ2ZoZ2hsfKXG4/D7//////////+UbnR5e3t6eHmAfH58eHZ2dHd2
+d3x3dHZ2dnl4eHt8fHh4dXVydXR3eXd2dXR4d3Z1dXZ1dnhydHd5d3ZzdHV4dXR2
+eX13dnV2dHN1eXh4eHd3dnd2d3Z3dXZ3dXZ3eXh5dnR4eHV2eHt8e3l1d3d1dndz
+dXV2d3Z1eHh0dXR2d3V0dnNxcXFvb29yc3FucnJycW9ycnBvbG5ycXF0cnNyc3Nz
+cnFydHFvcHFycnNucXJvb3FzcHBxc3NxcG1ucG9wb3NxcXJwa2xtbXFwbnJtbnFv
+b25uamtqbG1scHJwa25tbXBycG9tbW5vbnBvb2xtb2xxbmtsbGtpamtrbGtnamlq
+a2pnaGhmZmptaGhoaGxqaGhpaGhpaWlpZmVkZWdoZ2lmY2RgYmhmamdlamdhYWNg
+X2BgYmNhYV1eYWFmZGRkZF9cXWBgX19fY2NdYWFiYWJhXl5kYWJhXF5eX19hYmZi
+Xl1gYmJiYV5iY2FhYmRhX2BlYWFiY2FfYWJhYmRjZGJeYmNmZGBhYmFaWVpaXFtZ
+V1ZUU1NSVVVXWVNSUE5NT1JPTk1NT09OUlVOTk1PU1NRU1JTVFRRU1NWV1dXWlhb
+W19bX11cX15fXFpeXV1dXV9fX15hYGBhZWJhX2FhYGBeXmFmZmJhYV9fYWFeXl1b
+XFxcXWJgYGFgXV5eW1peX2BgYF5iY2RiYV9gYmFhX2BhYmNiYWBhYWJfYWFfYF1f
+YWBgY19fXV5kYVlcX2FgYF1eW11gX15dXGBgX11hXltbW1teX2FdX15cW11cXF1e
+X2BfYGRmW1tfYFxeYWNiX15dXmBcXF5gX2RfW2BjYmFhY19bWl9hXl9hYmBeYWVk
+YmRiYmNjY2NjY2FjZGNgZGJjYmBfX19eYmJeXl1eXF5gXV1dXV1cXFtbW15fXV1e
+XlxdW1xeXmBbWVpYVltgYF5dXV1eWVlbW1xZVlZVWFhcXl1aWllWWllbXVxbWFha
+WFpbW1lZVldXVVZdV1daW1hYV1hVV1hTV1VUWFlXVVNVVVJSVVVWVlJWVlZWVFRW
+U1VVUlVUV1RWUlJYVldXVFdcXVlYV1JQVVlTVVZXV1ZTU1dYV1VUWV5bV1RWV1pY
+WFlbWldZWlpaWFdZXVlcXlpcXFlcWltfW1hZWltZXVteWFRSV1hZWlpZWFhXWFla
+WFheWVtZV1laW1tcWFlcXF1eXVtYWlpbXF1dX1xbWltcXl5hYVtZWl5ZWVxeXV5d
+XltaVlhaWVxcW1pbXV5eXlxdXV9eWllbW1tfXlxeXWBeXGFeXl5gX2BfXlxgY2Ji
+YWFhZWJgXWBfYV9dXl1cX2BeXl9eXFtcX19gX15hY2NgY2NnZWFjY2FkZGJjZGJi
+Y2BhYmNkY2NhYWJjZWJiYGJkY2BhZWVmYmRkZmVmZGNiX2FkZGNkZGJjZWRlZGJi
+YmRjYmhjYGJmaGlmY2NnZWhlaWtramhmZmZqZGhpaGZnZmRnaGloZGhqbW9tamdp
+bGtubGlsbmxpbW9wbGtra3ZoZGdpamhnZmhpaGhtbW1ra21qaGt+psnk8Pr+////
+/////3ZnbnV6fHh2eHp7fHx6d3h3dXV6eHd5dXNzc3h5eXl1d3d3d3h2dnd0dXR0
+d3h5eXh6dnV1cXR1dHV1dHR2d3h3d3p4enp5c3Z3dXV0dXl4dXV4eXt5dnZ0dnp5
+eHZ4dnd1dnNzdHJ4fHx8eX16eXh2dnR0dHV2eHV0eXRycnB0cnNwc3dzb3FvcXNv
+b3Fyc3Bxc3JwbmxucXJycnRzcXBwdHV1dnVzdHJvcnFycnZxcXFxcXJwb3BvcXRw
+bXFvbXBubGpwcXFtbG5ub25xcW9rbG1tbGxta2xrcnRxcm5qaWxra25wb3Byc3Zw
+b2xsbWtub21ra2xpam5tbG9ybGxrampramlpbHVza21maGxqaGhnaWxrbHBsa2tp
+amhnZ2ZmZWViYGNjZmRjZWRoZ2VhX2JjY2JiYGFhYGBfY2dnY2FiY2BiX19fX2Fh
+YWJgY2JjYGFgYV9dXF5fYFxfYWJkYmJeX2BiYmFiYGFkZGJfX19iZGlhYGBkZGJj
+YmRlZWRhYWBhYmBcXV1dXVxbW1xbW1ZXVFBXVFNUUFRUUk5RVldQT1FPTkxMT1JR
+UFFRUFBRU1NRUFBRU1RRUlRVUlNWWFhaWV1eW1tdX2BgXllYXV1bXWBgZWNgYV9g
+X2JfX2JlY2VmZ2RmZWZiYl9fX19hX2BeW15hYF9dW15gYWRiXVlbXF9hYmNjZWBm
+YmFdY2RkYWFhXV9gZGFhY2JeY2FeXmFgXl9iYl5dYGFcX15dYF5dXVpZXGBfXl1d
+W19gYF9cXF1cXl1bX2JeXl9aW11cXF5fYGBhY2ReYF9dYWFjYmFfXlxcXVtdXlpe
+X19lY2NgYWBeYmJdXl1hY2JiYl5fYGBhYmRkZGJjY2JjYmJiYGFiYmBfXV5eXV1g
+Y2VgX1xbW1teXVpZW15fXVxeXVteW1lZW1pcXFxfW1tZWmBeWl1eXV1eXlxYWlxc
+WlhZWFlYWFdbWltdWVlZXFlaW1xaWFdYXFtaWFhYVVZZWVhYWVdWVVZZWFxXW1lU
+WVhVU1dXU1JVVVZYWVlaWllYWVZWVldWV1hWVlhXXllYV1ZYVlZVW1lYWFRUU1RX
+VlZYWVlYWFhTWFZYW1xaW1lYWVtZVVZXWVpXWltZXFxaWFpXWV9fWltYVVhdWlla
+WltZV1hYWVxbV1hWWFxbWl1cWlddWVlbW11aV1daXFlZW1xbWlpeW1pdW1lXW11e
+W1tbXFhaXl1bX19cW1tcXF5cXF1aV15eWlpbWl5cXlxcWltcXFxbWlpcXFxdXV1i
+X1tcX11gX2BhYWNhYF1eYmJfXmFnZWBeX2JeX2FfX2FjYWNeX2BfYmRkYWBfXl1f
+YmNgX2BiYGFhYmNmZmZlZmRjZGVlZWZkYF9kZGNfXl9gX2BjZWVlYmJhZGJlZGJl
+Y2JkZmRjY2ZnZGVkaGZlamJiYGRlZGNhY2hoZGNiaGVpZmtpZmBkZ2plYmRnaWdl
+ZWdpZGZnaGdkZGlta2pqaGlnZ2RoamlmZ2pta2lqa2tqbG1sbGtqZmtsamhqbGlr
+aGloa2dnbmpwZ2lra3uly+Hv+P7/////////cHR9e3x6d3Z3eX16eXh3d3p6dnh3
+e3l0dnVxc3Z3dnd5dHV2eXh1c3N0d3Z4eXl8fXyAenl4c3RzcnJ2enZ2dnV0dnl+
+e3d0c3V2dXR4eHh2dnZ1eHZ2dHh4d3V3dXR1dnZ1dHR0dHd3eX97eXl2d3R1dnd2
+dnd5c3JzdXJ1c3Z3dXZ2eXRwc3FycHBwbnBvbnB3dXV1c3RwcW9ydXJzcnR3eHZ1
+eHR0dXRzb29wc3FwbXBtb21ubWxtcnNxbm1rb3Fubm9ubm5vbmlqbmxpamxvbW1s
+bm9vb3FycHJsamtra21rbW1vcG5xb25tbGlpbWttbmxsbGxpa2hoamtrbWxqamxt
+bW9ub21rbnBoamdlZ2ppbW5tbW1vbmxqZWdmY2VlZGNjZWZlYmVjZGBiZGBfYmJp
+Z2NkZWNgX2NjYmNhX15lZWBdYF5iXVxbYWBgYmJgYF5gX15cX19jY2BeXmBfYGJi
+YV9gYmFfYWJjYF5gY2RiX2FdYWJlZGRkZWVmZ2NhX2FhXmNiXVtcXV1dXVxaWFZX
+WFVUUlNTU1VTVVNVT05QUFFNTU5MTU9RT1JTUFBRU1BRU1VUVVVTU1NWVFZaW1pY
+WlpaX11eX15cXVxdXlteXF5hZF9fX2BiYWFgXmBhYmJiZGVkY2RjYGBfXWBiXVxg
+YWJhX19jYF9hYGFfXFpbXWJjYmFgYGFiYmNiY2VhXV9fZmNkYWFiZGNjYF5cXVtb
+Xl5eX2RkZF9eXF5dYF5hXlxbXFlYW2FiY2JfYlxZXl5dXV9dXV5gXl1cW1tbWVpd
+Yl9fYl9eY2FdXV5eXlxdXFtbXmBgYGJiYmhlX2FeXl5fYF9fX11fYGBiYGFiYWFl
+Y2NiYmBiYWJnZ2FfY2NgX2JkYmNlYl9fYFxdXV5fXVxZWlpdXF1cYF9gX19eXlla
+XWBiXlxYWFxcXVtdXFpfXmFgW1lbWlpYW1pbW1tZWFtdYF1aWVpZXWFfWFZUVlZX
+WVtaWFZWWVZUV1dYWFVUVFZVWFxcXVtaW1hWVlVUU1ZXWVhbWFlWVFhaW1lYVlVU
+V1pYVllZWFdaW1pYWFtVVlpcWlRUWFdXWVlWWVtbW15YWVtbXFtXWllWVVdZVlZY
+V1hZWFlYV1daVVZZV1tcXF5cW1paWVheXl5dW1xcWVpbWFhXWllYW1hZXlpWXFxc
+W15aWVpZWllZW15dWlxbW1lbXVxaXF5cXFpaWlpbXVtcXFxcXl1aWFpcYWNfXFxc
+XF1dX2FaWVtaWVpbXVxbVltaWVpfXF1cYWBeYWFeX19dX2FfXmBfX2NqZGFfYGJg
+YGBjY2VhYGFmZGFgYWJgYV9eXl5fYmNiYWJiYF9eX15gYGBiYGFjZGNjY2JjZmdj
+ZGFhX2JfYGJhY2RjYWRjYmNiZGBkZmZmZWRkZmVmZmVlZGlmZ2lpaGZmZWdkZWRl
+aWhjY2FjZmNmaGlnZmtqZ2dkZWdkZWVkZGdkZ2hpamhoZ2ltZmZnZWVlY2dpamtr
+a25wbWppbW9vcHFxb2xxbGxva2xoamlpaWprbGprb21mZ2h3gqDN4u/3/f//////
+//9ueHx9fnx5eHl8eXp7fnl4eX14e3l5d3l3dHV0dXZ4dHZ1c3N0dXRzdnR3eXd4
+dHV6e359eXd4dnZ5d3d3dXZzdHZ0eHh3d3h3dXh1cnB0c3R2d3Zyc3R4enp3eXh4
+dnd2d3p7e3x6dXh2eHd2dHd5dHR0dXd5d3V0dXR1dHRzdnZ3eHhzdHd4eHJxbmxu
+b29wcnJzdnV0dXBydnNxcHFwcnV2dHd1dHV3dXRycnRzdHFtb3FxcXBubm9wbG9w
+b29vbnFycXBsbW1xc3Jtbm9ubW9ubWxtb25wdG9tbm1wcWttbW5sbWtwbnFsamps
+bGtoaWtvcW9tbGxsa25vbWtoaWtsa2psa2tpbWxqbGloZ2loaWtsbG5tbGxraWlq
+a2lnZWVlY2JiYGJnY2JkZV9hY2JjYmBga2dhYWNkY2ZkYWBfXmBgXlpdYl9bW11h
+ZGRhX19fXGFcXWFfX19hXmBhYGBiZGZlY11cXWNkY2ZmYmJgXl9eXmFhZGFjY2Nm
+Z2hmZGJjYl9eYGNhXl9eXFpcXVxbXFhWU1FRUlNSUE1OUFFNTE1NTUxPT0xKT1JY
+U1JSUE9SVFZTUlJTVVdZWlhZWlhZWVhdXF9hXV9cXVxeYl9dYWBdXV9gYl9fXmBg
+ZGNfX2NjY2NkYl9jYGFjY2FfYV5gYV9gY2JhYV9lXWBiXmFjX2BfXV9eXF5dX2Bf
+ZWNkZWhmX19dYF9jYmFfY2NhXF1dYV1dXFxdXl9gYGFdXGBeXmFhXFtdXVxcXl5g
+YmFeXVtcYGBcXl9dYFxfXl9fXl9eXV1eYWBeXVxdYGNhX2FfYWFgYV9eYGNgYWJj
+X19gX11cXl5dXl5hX19hYWFkZGJiZGNiYmJjYWFjY2FfXmFkY2RlZmdhX2BhXmBi
+ZGRiY19dXVxZXF1eXV1gYV9eYl5hX19eX2JdWl1cXVxcXmFeXF5eXV5bXmBkXFla
+WFtbWltbWllbW1hbWVlZWltZW1hXWFdaWlpZW1tVVldYV1ZXWFRWU1NWV1hYWVpY
+V1hWVlRTV1ZXVlVTUVNaVlVUWFdVVVNUWl5bWldYWFpbWlhZV1ZYVldcWltaWVdY
+WVdVV1lbW1hXWFpXVVZWVlVUV1dZVVVVVVZVWFpXVlhaWlpYWFtaXWFdWllZWltb
+W1pbW1lYWVxZWFhUVlhZXF9bWVtYXFxcW1pdXV5YWFlXWltcWldaWVlbW1pXV1pa
+W15hXVxgXVlZW11aW1laW11bXF1ZWmBcXFxdXF9cX15aWlpZXFteWl1gYl9hW1la
+Xl1eXV1eXV9dXl1dXV9hYGFhX11dX2BgX2RlZWNlYl9hYWNgX2BfW1tdXV9iZGJg
+YF9gYGNiYGFjZ2FgZGFgYWVhY2ZkZWdgYGBmZGFgYWFiYmBfY2RlZWRkZGVkYmVn
+Z2RnamdoZ2VjY2ZnZGJiZmplZmVlaGNkZ2ZmZWFiY2ZmZ2trbGtpZ2hqa2xqaGZn

test/search_test_data/0002e.pat

@@ -0,0 +1,120 @@
+5eXl5uXk5eTl5eXl5eXm5eXl5eXl5ebl5ufl5efl5ebm5+bm5ubm5ebm5ufm5ufm
+5uXm5+bl5+bl5ufm5+bm5ebn5ufm5ubn5+bm5+bm6Ofn5+fm6Ofn5+jn5ubn6Ofn
+5+fm5+fn5+fn6Ofo5ujo5+fo5+fn6Ofo6Ojn6Ojn5+nn5+fn5+jn5+fo5+fo6Ojn
+6Ofn5+np6Ofo5ufo6Ojn6Ojn6Ojn5+no5+bn6Ofn5+fn5ufn5+fo5+fo5+fm6Obn
+6Ofn5+jo6Ofo6Ojn6Ojo6Ono6eno6ejo5+jo6Ojo6Ono6Ono5Ofo6Ono6ejo6Orp
+6ejp6enp6Ojo6Onq6Onp6ejo6eno6enp6eno6ejp6Onp6enp6unp6eno6Onp6unp
+6ejp6enq6ejp6unp6enp6Ono6eno6uno6enp6Orp6enq6uno6unp6enp6erp6Orq
+6Onq6eno6unp6unp6urp6urq6enp6urq6uno6urp6erp6erq6urp6urq6erq6uvr
+6erq6enq6ejq6urp6uvr6erq6urp6unq6unq6Orp6+nq6unp6err6unp6+rp6urp
+6ejq6erp6enp6erp6erp6eno6ujp6unq6+rq6urp6+vq6uvr6urq6urp6+rq6urr
+6+nq6unq6urq6uvr6+rq6uvr6+rq6uvq6+rr6urr6uvr6+vr6+vq6+vr6+zr6+vr
+6+zr6+rr6uvr6+rr6urq6+vr6uzr6+zs6+zs6+zr6+zs7Ovr7Ozr7O3r7Ozs7Ozs
+7e3s7ezr6+3r7Ozs7e3t7O7t7O3t7ezt7u3t7u3t7u3t7+/t7e7u7+7u7+3u7+7v
+7u7u7u7v7+/w7u/v7/Dv7+/w7+/v7u/w7+/w8O/w8PDw8PDw8PHy8PHw8PHx8PLx
+8fLx8vGVjoV7dW1kYmJYVlRVVFRWVldZW1xdYGJjZmlqbG5wcnZ3en1+gYKFh4qL
+jY6OkZKTlJaXmZqdnqGjpqipq6yur7Gxs7S0tLa2uLm5u7u9vr7AwMHCw8PDxsbI
+ycrJy8zNz8/S09PU1dfX2dnZ2dja2tra2tvb2tra2tvb29rb3Nzd3d3d3t/e3d/f
+3t/f39/f197f39/f3+Df39/e3t7e3t/f3d7d3t7e397e39/e3uDg4ODg4OHh4ODg
+4d/f3+De3uDf39/g3d7d3Nza29va2tja2tnZ2NjW1tjX1tbW1tXU1dXV1dXV1dXV
+1dXW1dTT09PS0tLS0dHS0NHR09PS09LT0tTU1NPT0tPT09TS09PT0tLR09PT09PT
+09TU1NTU1NTU1dXV1dXU1dXV1dXV1dXW1tXX2NfX19fX2djZ2dnZ2drZ2tvb2trb
+29vc29vb29vc3Nzd3N7d3d/e3d7e397f3t7e39/f3uDg3t/g4OHg4ODh4d/h4OHh
+4OHh4eHh4eHi4uLi4uLj4ePi4+Li4uPj4+Pi4uPj4+Pj4+Ti5OPj4+Xj5eTk5OTk
+5OXj5OTk5OTk5OTk5OTj5OPj4+Tk5OTj5uXl5OXl5OTl5eTl5OXl5ebl5ebk5eXl
+5ubk5OXn5ubl5eXl5uXl5+Xk5eXl5ebl5ebm5ubl5uXm5ufn5uXn5ubn5ubm5+fm
+5ubl5ubn5ufm5ufm5ujn5ubn5+fn5ufm5+jo6Ofn5ubm5+bm5+fn5ufn5+fo6Ofo
+5+bn5+jn5ujn5+fn5+fo6Ofo6Ojn6Ofo6Ofn6Ojp5ufo6Ojo6ejn6efn6eno6ejo
+6Ojo5+fn6Ojp6Ojo6ejo5+no6Ojo6Ofo5+fo6Onp6Ojn6Obn6Ofm5+fn6Ojn6Ojo
+5+jo6Ojo5+jo6Ofo6Onp6Ojo6Ojn6Ojo6Ojo6eno6ejo6enp6Ojp6ejp6unp6Onp
+6enp6Onp6Onp6eno6Ono6enp6enp6Ono6enp6OXp6Ojq6ero6unp6unp6enp6unp
+6unp6eno6enp6urq6enp6enq6unq6enp6erq6urq6unq6unp6Orp6enp6erq6erp
+6erp6urq6urq6enq6+rp6urq6unp6ujp6unq6enq6evq6unq6unq6uvq6unq6urq
+6+vp6ujq6unq6urp6unq6unp6+rq6evq6urp6unq6+rq6urq6erp6urr6+nq6urp
+6unq6+nq6erp6erq6erq6erp6urq6urq6evq6enp6enp6ero6unq6+nr6urq6+rr
+6urq6uvr6urq6+vr6+vq6+zq6+vr6+vq6urr6+rr6+vr6urr6urq6+zr6+rq6+vr
+6+vr6uzt6uvr6+vr6+vr7Ovs6+vs6+zs6+vs6+rr6+rr6+vr6+vr6+vr6+zr6+zt
+7Ozr7Ovr7Ovr6+zt6+zs7e3t7O3s7O3t7ezt7O3t7ezs7O3u7ezt7O3s7u3t7e3u
+7ezu7e3u7e/u7u3u7+3u7u/u7u/v7u/u7+/v8O/v7+/v7+/v8PDv7/Dv7+7v7/Dx
+8PDw8PDx8PHv8fHy8PHw8fDx8fHw8fHy8vLy8qOdlpGLhH56dXRycHFxcnR1d3l6
+fH+ChIeJi42PkpSWmZyfoaKmqKqrra+vsLK0s7W3uLm6vL2+wMLExcfGyMrKzczN
+zs/OztDQ0tLT09TV1tbW1dfY2NfY2dra2trc3Nzd3N7e3t7e39/f39/f4ODg4ODg
+4eHg3+Hh4eDg4OHg4ODh4uHh4OHh4uHh4eHj4eHi4OHh4uHi4eDh4eHg4eHh4eHi
+4eHg4eHg4eDi4eLg4eLj4+Li4+Li4+Hi4eLg4eHh4uHi4uLh4OHg4eDh4N/e4ODf
+4ODf397e3d/f3d7f393e3t/d3t7d3d7d3d3d3d3d3tze3d3c3tzb3d3d3Nzc3N3d
+3d3e3d3d3d3d3d3d3t7e3tze3d3e3d3e3dzf3d7e3d7d3t7d3t7e3t7e3t7e3t7f
+3eDg3+Df4N/f4ODf4N/g4N/g4ODh4OHh4eHg4eDi4eHi4OHh4uHh4uLh4eLi4uLj
+4eLj4uLj4+Lh4uPj5OLj5OLj5OPk4+Tk4uPj4+Tj4+Ti5OPk4+Pj5OTl5OXj5OTj
+5OPk4+Tk5OXk5eXl5eXl5ubm5eXl5eXm5uXk5eTl5ubl5eXk5Obl5eTj5OXl5OTl
+5uXm5ubl4+bl5uXl5ebk5uXl5eXm5uTm5ubn5ubm5uXn5ubm5ufl5ebm5uXm5+Xm
+5ufm5+fm5ebm5ubn5ujn5ubl5ubn5ufn5ufn5+fn6Ojn5+fn5+jn5+fm5ufm5+fo
+5+fn5+nn5ufn5+bm6Ofm6Ojn5+jo6ejn6Ofp6Ojo5+jo6ejo6Ojn5+jp6ejo6Ojo
+6eno6Ojo6Onp6efn6ejo6Ojo6ejo6enp6Ojo6ejo6eno6ejp6eno6ejo6Ojn6Ono
+6Ojp6enp6Ojp5+fo6Ojn6Ojo6ejo6ejo6enp6Ofo6ejo6ejp6Ojo6eno6ejp6erp
+6Ono6Ojo6eno6eno6enq6erp6uno6ero6Orp6unp6erp6unq6unq6urp6uno6ero
+6Orp5eno6erq6urp6unp6erp6Onr6erp6+nq6unq6enq6+nq6urp6urq6erp6urp
+6urq6urq6urq6urq6+rp6+rq6uvq6Orq6unr6urs6urr6urp6unq6urq6urq6+rq
+6erp6urp6urq6urq6urq6err6err6+rq6+rr6urq6+rr6urr6urq6+vq6uvq6+zq
+6urr6uvr6+vq6+rr6urr6uvq6uvq6uvq6+vr6urq6err6evq6uvr6urr6urp6urq
+6+rq6unp6urq6urq6urq6uvq6urq6+vr6+vr6+vr6uvs7Ovr6+rq6+vq6+vq6+vq
+6+vq6+vr6urr6+zq6uzr6+zr6uvs6uvs6+zr6+zr6+zs6+vr6uzs7Ozs6+vq6+zr
+6+zs6+zr6+zs6+zs7Ovr7Ovs7Ovs7Ozs7Ozs7Ozs7O3s7Ozs7Ozt7O3s7Ozs7u3t
+7e3t7O3t7e3t7e3t7u3u7e3u7e3t7e3t7e7t7u7u7u7u7u3v7u3v7+/u7+7u7+7w
+7+7u7u/w8O7v7+/w8O/x8PDv8PDw8fHw7/Dv8fHx8fDx8fHx8fHx8fHw8fHx8vLy
+8vLxs6+qpqGcmJWRkI6Oj5CQkZOVl5mbnaCipKepq62wsrS2uLu9vsDDxMXGx8jI
+yszNzc7P0NDS0tLU1dXY2NjY2dnc3Nvc3Nzc3Nzd3d3d3t7e397e4N/f39/g4eHh
+4OLg4eHh4eHi4eLh4uDh4uHi4eLi4uPi4+Hh4ePh4uHi4+Lh4uLj4uLi4uPi4uLj
+4uPi4uLi4uLi4+Pi4uPi4uHi4uPj4uLj4uLi4uPh4eLi4uLi4+Li4+Pj4+Li4+Pj
+4uLi4uLi4uPi4+Lh4uHi4uLi4uPi4eHi4eDh4eHf4eHh4eLi4OLh4ODg4eDh4eHh
+4eDh4eDh4eLf4eHg4N/h4ODi4ODg4OHh4eDg4OHh4eDh4uDg4uHi4eLg4OHh4eDh
+4OHg4uHh4eHh4eDg4eHi4eHi4eHi4eLh4uLi4uHi4uLi4uPj4uPj4uHi5OPk4+Pj
+4+Pj4uPk5OLi5OPj4+Pk5OTi4+Pj5OPk5OPj5OPk5OPk5OTk5OXk5OTk4+Tl5eTk
+5eXk4+Tk5OTk5OXk5OXl5eXk5eXm5eXk5OXk5uXl5ebl5uXl5ubn5eXm5ubl5ubm
+5uXl5eXm5uXm5uXl5eXl5eXk5eXm5uXl5ubn5ubl5ubl5+Xm5ubm5ubn5ubn5efm
+5+fm5ubn5+fn6Ofn5+fm5ufo5ubn5+bm5+fn5+fn5+fn5+jm6Ofn5ujn5+fn5+fn
+6Ojo6Ojn6Ojn5+jo6Ofn6Ofo5+fn5+jo6Ofo5+jn5+jn5+jn5+jn6Ojo5+jo6Ono
+5+no6Ofo6Ojo6Ofp6ejn6Ojo6Onn6Onp6enp6eno6efo5+jo6Ono6Ojo6enp6Ojo
+6enp6enp6Ojq6Ojo6eno6Onp6ejp6unp6ujq6unq6enp6Ojp6Orp6Onp6enq6enq
+6eno6Onp6eno6ejp6eno6Onp6erp6ejq6eno6erp6enp6enq6urp6Onq6unp6urp
+6+nq6enp6enq6unp6erp6+nq6enp6unp6enp6erq6unr6uvq6erp6+rp6erp6unq
+6urq6urp6urq6err6uvq6urq6urp6+rq6uvr6uvq6+rp6urq6urq6uvp6+nq6urr
+6unq6+vq6+rr6urq6urq6uvq6urp6urq6urr6urq6urq6urr6+rr6urq6uvq6urr
+6uvq6erq6uvr6+rr6urr7Ovq6uvr6+vr6+vq6+vr6+rq6+rr6+vr6urq6+vr6uvq
+6uvq6+vq6+zq6uvr6+rq6uvq6+rq6urr6+vq6urq6+rq6urq6uvr6+vq6+rq6uvr
+6+zr6+vr6uvr6+vr6+vs6+vr6+vr7Ozr7Orr7evr6+rr6uvs6+vr6+rq6+zs6+vs
+7Ovs7Ozs7Ovs6+zs7Ozs7Ovs6+zs7Ovs7Ovs6+zs7O3s7Ovs7Ozr7Ozr7Ozs7Ozs
+7O3s7O3s7e3t7Ozr7Ozs7uzt7ezs7O3t7uzs7e3t7uzt7ezu7e7t7u3u7u7u7e7u
+7e7u7u/u7u/v7e/u7+7v7+/v7u/u7u/w7+/v7u/w7vHv7u/v7vDw8PDw8PHx8fHx
+8PDw8fDx8PLx8vLx8fDw8fHy8vLy8vLy8/MAEAEAAAMAAAABBJcAAAEBAAMAAAAB
+Bt4AAAECAAMAAAABAAgAAAEDAAMAAAABAAEAAAEGAAMAAAABAAEAAAERAAQAAAAQ
+AB+FwAESAAMAAAABAAEAAAEVAAMAAAABAAEAAAEWAAMAAAABAG8AAAEXAAQAAAAQ
+AB+GAAEaAAUAAAABAB+GQAEbAAUAAAABAB+GSAEcAAMAAAABAAEAAAEoAAMAAAAB
+AAIAAAFTAAMAAAABAAEAAIdzAAcAAASkAB+GUAAAAAAAAAAIAAH9gQAD+voABfhz
+AAf17AAJ82UAC/DeAA3uVwAP69AAEelJABPmwgAV5DsAF+G0ABnfLQAb3KYAHdof
+AAH9eQAB/XkAAf15AAH9eQAB/XkAAf15AAH9eQAB/XkAAf15AAH9eQAB/XkAAf15
+AAH9eQAB/XkAAf15AAGq2yWAAAAAIAAAJYAAAAAgAAAAAASkYXBwbAIgAABzY25y
+R1JBWVhZWiAH0wAHAAEAAAAAAABhY3NwQVBQTAAAAABub25lAAAAAAAAAAAAAAAA
+AAAAAAAA9tYAAQAAAADTLWFwcGyYcjd2/nI/x5EwPxA3BfUzAAAAAAAAAAAAAAAA
+AAAAAAAAAAAAAAAAAAAAAAAAAAVkZXNjAAAA5AAAAEF3dHB0AAAAwAAAABRrVFJD
+AAAA1AAAAA5jcHJ0AAAEYAAAAEFkc2NtAAABKAAAAzZYWVogAAAAAAAA81EAAQAA
+AAEWzGN1cnYAAAAAAAAAAQHNAABkZXNjAAAAAAAAABVTY2FubmVyIEdyYXkgUHJv
+ZmlsZQAAAAAAAAAAAAAAFVNjYW5uZXIgR3JheSBQcm9maWxlAAAAAG1sdWMAAAAA
+AAAADwAAAAxlblVTAAAAKAAAAw5lc0VTAAAAMAAAAYpkYURLAAAAPAAAAjZkZURF
+AAAAOgAAAeJmaUZJAAAAMgAAAMRmckZVAAAALgAAATBpdElUAAAALAAAAuJubE5M
+AAAAKAAAAnJub05PAAAAKAAAAbpwdEJSAAAALgAAArRzdlNFAAAAOgAAAPZqYUpQ
+AAAAGgAAAV5rb0tSAAAAGgAAApp6aFRXAAAAEgAAAXh6aENOAAAAGgAAAhwAUwBr
+AGEAbgBuAGUAcgBpAG4AIABIAGEAcgBtAGEAYQAtAHAAcgBvAGYAaQBpAGwAaQBH
+AHIA5QBzAGsAYQBsAGUAcAByAG8AZgBpAGwAIABmAPYAcgAgAEIAaQBsAGQAbADk
+AHMAYQByAGUAUAByAG8AZgBpAGwAIABHAHIAaQBzACAAZAB1ACAAUwBjAGEAbgBu
+AGUAdQByMLkwrTDjMMowsDDsMKQw1zDtMNUwoTCkMOtjg2PPVmhwcJaOgnJfaWPP
+j/AAUABlAHIAZgBpAGwAIABHAHIAaQBzACAAcABhAHIAYQAgAEUAcwBjAOEAbgBl
+AHIARwByAOUAdABvAG4AZQBzAGsAYQBuAG4AZQByAHAAcgBvAGYAaQBsAEcAcgBh
+AHUAcwB0AHUAZgBlAG4ALQBQAHIAbwBmAGkAbAAgAGYA/AByACAAUwBjAGEAbgBu
+AGUAcmJrY89O6gAgAEcAcgBhAHkAIGPPj/Blh072AEcAcgDlAHQAbwBuAGUAYgBl
+AHMAawByAGkAdgBlAGwAcwBlACAAdABpAGwAIABTAGMAYQBuAG4AZQByAEcAcgBp
+AGoAcwBwAHIAbwBmAGkAZQBsACAAUwBjAGEAbgBuAGUAcsKkzpCxCAAgAEcAcgBh
+AHkAINUEuFzTDMd8AFAAZQByAGYAaQBsACAAQwBpAG4AegBhACAAZABlACAAUwBj
+AGEAbgBuAGUAcgBQAHIAbwBmAGkAbABvACAARwByAGkAZwBpAG8AIABTAGMAYQBu
+AG4AZQByAFMAYwBhAG4AbgBlAHIAIABHAHIAYQB5ACAAUAByAG8AZgBpAGwAZQAA
+dGV4dAAAAABDb3B5cmlnaHQgMjAwMyBBcHBsZSBDb21wdXRlciBJbmMuLCBhbGwg
+cmlnaHRzIHJlc2VydmVkLgAAAAA=

test/search_test_data/0002f.pat

@@ -0,0 +1,136 @@
+TUxOT1JVUFNUVlVRT1VYWVdXUlJUT1FPU1VPT01PUE9WVlFSUFJRTkxKTU1PTEtJ
+R0JDR0RDQEBBQD8/PDs/PD0+Pz44NzY1NjY5ODw5OT08Nzk5ODs8QUNBQj9BQUND
+QklLSk5KSU9TXlhLT0xWUlFaVFdMTVdVW1VgWVdWXV9dWFtWUlFSTkVERTk1NTUz
+MzUzNjU0ODg1ODY2Nzk6PTo6P0NETE1JR1RSTFBISkpKVVVLSUpUTU5STVZRVFpT
+Vk5XXGBYUFhVWFJTV19kXVdVUFdVVlZUW1xbWlhZV1pcWE9TWlRWWVlXUE1MTlJD
+PDo8Ozo+P0pOTVhWVFJWW15oYFxbXlpUVlpZXFhYVVdXUFlcYFhUVFdaW1RQXVxc
+XltXUVBSTU1RUVRYVVNNSU1RUFFWVFFST05QUk9OSU5QTk1KS1BVSkxLTE5LT1RO
+VlRZWlZYVE1FRkVHR0ZLSU9LTlFOXWaJo7CspZ2WlZOJfXFmYmFqdG9eS0E+OTk4
+ODtBQTw9Ojg5PD5EQT8/P0BAPDc6OEE+Pzo+QENAPDtBQENDRkNDR0A6QEQ8ODU0
+MTQ3NTg3Mzc2NDg0OTs/RUpTS05JT1xYWVlUXFZWVVtdWVlXUE5TUlJQT1BUVlZR
+VFVYW1NRTkxMUlZUUEtMTk9PTE1MSERESUpLSkxJRklJSUtLRkRJSEVCRENERUZE
+QkNBQ0JEQ0FAPjk6PDo3OTc3ODU2ODY2NTc+Rk9YYmdqaGhna3B3e3x+gYGBgYaH
+iYuKi4uKioWCfXdwbmpnaWlsb3eCiIuMjYmJjo6SkJCTl5ORjIaBfnZnVEc/Ojo6
+ODo7P0RJSkxPUlVWWVhWVlVSVFFRT05JRkVARD5BPkBCRERDQ0ZGRUdFSUpKSkpK
+SklOS0xNTkxOT05MS0tMTk9NT1ZWU1dZWl1eXWJkZ2hqbm91dXV4fH5/gYB/gYOC
+hYmGiIiHh4iGh4qLi4qMjY2Li4uLjZKTlpeWlpSPjo+SkZOQkpGRlZiXlpaZmZuZ
+mZibl5mZmJiampual5aYnKCpr7KqmImGiJWosbzAvLu5u7i1tbGwsbKzt7a8vcC/
+vL29vr6/v7q8vLq8vrq4ube1tLe3t7S0ta2ysrK1tKyginBfXVhTUlBOTVBMTU9M
+S0tLSUpLSkhJSkdPT05KSUdNS0lJSE1LSkxKTk9MTUtNSk9OTUxPUU5NUE9OT0xM
+Tk5QUVFQUU9QUVJSVFVSUlNTU1JRTlJTUFBSVFRSUlFTT09RUlBSUVNTUU9QUVNV
+VVVVUVFSU1FVU1JSUFFSU1hUUVFPUVRQUVJRU1NUVVZYWFZWWlhYVFFVWFhXVlhW
+WFhaWltbWF5bV1dYVlhbWFZYWVlaWVlYV1laWVpZV1taWVlaWlpaWVtcXV1cXF1d
+YF9dYF5dXV1dYF5bXV1cWlxWV1dYV1ZWWFdYV1ZZXIO9ydPa3uHk5efo6el7enh5
+ent8eHd1dnl2dnh6enl4eXdwZ1pMR0VFSkVEQz09Q0hKQ0A/P0I/PEJCQT4+PTpA
+RURFQ0RHQ0RBPT5ARkhJSkxMTk1JS05QTklKTk5QUVNUU1FXU1ddWVVRUFFTU1JQ
+UlBQT0tRVVVVU1JSUFJNSktPT0tJSUhHREVFQ0dEQkNAPj0+PTw7Ozs6OTw2Nzk4
+ODg6PDs5OTg3Nzs4Ojw7Ozw9PURBQkQ/RktGS0tISUpRVU5RTUpTT1lTV1VOVlNc
+WV1cWVddY1xdXllPT1JVT0pAODc1MzU5Njc6OTs3Njg2NTc7ODg4OTg+Q0dPUEpH
+VVRMUUxRSkpUTklOSVNSTU1KV1RSWlFYVFRVWVdNUFJeVFRVYWFdXVZQUVVYV1VZ
+VFdYWVhZXGVhVlRbW1pXUU1LTFBMTkhAOTg6OTk7Q1BSVVldWFpeXmFhY2VjXlNR
+U1BXWFVVUVZYWFdWU1NTVVZaV09WWVlaWlNQTUtOUE1OUlhZVFFXUE1NUFBQTlFS
+UFJWTU1OS0pRSkVJUFBNSkpNUEtPVFVXV1lXVldXU0hGRUdJSVBJSUhOVE9RWnWU
+qauroZiVkYl8c2xmY2VrdWlSQTs6Ozg7OTw8Oz08PDw7Ozw7PTtAPj09Pj1BQUJA
+OTo+QUQ9OD1FQUM+RUJCOzY9Q0E4ODU0NDY2NjQ0MzI1Njg4Oz1ESkpISkpTWlhY
+W1ZZV1hTVldOUVNOTE5OUlFQVFlYU01XV1dWU09MSktOUlRTUU1PT0xQTklFR0ZL
+TU1LS0dHR0dJSkpGRUNGSExHQ0RDREVBQD9APz5AOzs+QD88Pjw4NjY0Njc5Nzg7
+QUpTXmRmaGdoaGxwdHp7fXmBh4eHhoyQj5CNjYuJhYJ8dnN1b2xtbGtze4SJjI6M
+iImOj5KUlpWVk5GQi4B3a11RRj5APkFAQUFCSEpLTVBQU1hYWFZWV1NRUlBQTkxJ
+RkdDQT5AP0NDQkNARERJR0lJRkhHSUtQUE1MS0tNTExNTE1NT1FSUFBVVVVXWF1f
+XmNjZGdsbG5zdXZ1dnt9f4CDg4F/goOFhYaGh4uHhoWJi4mKi4mIiouNjIuMkZGR
+lpSUj5GQkpKSkpWTkpaXl5OVlpmbmpiYmZmZmJqWlZeYl5iZmp+jqrO5s6aTgXeB
+mK64vby7urq9ure0srSztba1t7m9vsDDwr69vb+9uru+wL69vbi3tbSztbq1tLe4
+rrOztrW1saylknplXFZUVVNPTU9PTk5NTU1NSkhISkpJR0lKS0lKUEpKS0xPTVBL
+TUxKS01KTExMTkpPTktQUE5PT09QTU5NUFBSUlNST1BPT05ST05PUVFTVlJSU1NS
+UlRTUVJTUVBRUU5RTlFSU1NQTk5NUFVTUlBSUVBRVFRTU1NSVFJQUlVUVlNUVFFS
+UFNVU1JUVVVWVVZXV1VWV1dWVVVYWVhZW1pYWVtdXF5aW1hZWFZZWVhYWlpYV1dY
+WFZXW1tZWFlYWVhWWVlZXFxcW11cXltcXltdXlxdX19dXl5bXVtbWFlYV1VXV1ZU
+VlVVVVdgfLvJ0dre4eTm5+jp6nl7e3x7eHp6dnh5dnd4dXd4dnZ5cmlgUkhCQEJH
+QEM/PkFCRERBQERDQz4/QkU7PD1CPkBBQUFAQEFDR0I9PENCR0dISEdJTklMT01P
+UlFNUFBRUlJZVVVWV1ZUU1hSVFZVUlJTUlBRUVNTVFVSUFFOUE5NTExPTUtIREhH
+RENDQkJFQj5APkE/Pz87Oj08Oz04Nzc4NzxBODQ1Nzc4Ozo6Ojg2OTs7Ozs+QT9D
+SUdISEZGRkpQS01LRElHTEpLVVRaWVhZXFtZVlhgX1xXV1BVblVUSkA5NzQ1NDc1
+NTQzNDQ0NDg1Njc2NTg7PD8+PkpJTUZNT0dPS1JNSFBLRkxIS0hLSk1UVFlgVl5X
+UVJUVUxRT1ZVUlFZXVpWVFJTVllZV1dUVFtaWltfZl1VWFtcVlZVT0tTUElIR0Q5
+NzY3Njk/SVJWWmxlWlxdWWBpYV9kV1JUUVJcWlhTT1NSV1pTVFNTVlVXVlZVWFJU
+WlNPS01VVVpaWVVYV1VWUU5QTk5PUFVRTE1LS0xIRU5KSEpOTk1JR01MSVBVWlxT
+VFhcWFpZTkdDQEFFS0VISElTUU9WYniWpqiooJeOhn92a2NgYGZwbV5JOzs/QkI7
+ODs9OkA+PDw6OT1APj4+SDw6Oz4/QkA7O0A9Pz5CPDs8QTxDQkJJPzpBPzo8Ozg2
+NzQ3NjczMjQ2Nzg7PT9HS0RJR01SUldSUE9OT01VWFJWVE5LTlFTUlBSVldSVFhW
+VFJWUVBNTEhLTFJUTExNS05OSUZITE1LS0pKT0pGREVGRkdIRklKSUlERURCQ0NC
+Q0E+PDk9QD9BPzw6ODo4OTo9Ojg5PUdQW2VqamlrbWttcnd6fH19fYKDiI2Ojo2N
+jo6LjIiIhX58eXVzcW9sb3d/hIyOkI+Lio6QkZOYlpSTjYuHgXJkWE1IRD89QEJF
+RUZMT0xPUVNUVlhaW1lXVVNSUlJPTUtNS0dDQUJEQkJDRUZGR0hFR0dHQ0dHSEtI
+SEtJS05LS0xSUVNQTlFUUlVZWFlcXWFlZ2hsbW9zcnV8fH9+fX+AgYGBg4SEg4KD
+hYOCh4eHh4eJi4qKi4uOjI2KjpGSlZWUmZaSkpeWkI6TmJWYmpiXmJiampuXnJmY
+lpaZmJqYmZmbnJ2jrLGwsbSwopSDfIeXrLu/vr28urq4s7OzsrK0trW3ubu8v8G/
+v7++vr27ur27vLy7ubW2uby7t7e1ube1tbe2tLW0sa+mmIFmWldXUlBRT0xOS0xO
+TVJPTUtKR0lKTEpKTUpJSUlLTUxJTE1PUExJS0tNS0xOTU5MS0xLS09PUVFTUE9R
+UFNSU1FRVFJNT09OTlBQUlNSUVBRT1JUVFFPUVRUUVNRUE5QUVFSUFFPSk5RUE9P
+UVNTVlFRTFBPUVJSUlJRT09SUlBQUE9RUlJTVVVTVFVWV1ZYWFZYV1hVVVRTV1ta
+W11bWVxaXV1aWlpcWllZWllaXV5bV1dXWFpZWldXWVpZVlVXWVlbXFxaXF9cX11f
+XFxcX15iYWBdXFhaW1pfXFtZV1RWVllXU1NXW2Z9usjT2d/h4+bn6OnpeXp7enl7
+d3t7enl6eHp4eHl1dG9rZFtRSkdDQkBAQUY/PEVESUREREM9QUFEQUVBPT9BPT8/
+Pz8+QT5BRENHQkNFRkhJS0xNTkxQTE1SU1NQUlNRUlVWVVVZWlZVU1VWU1ZWVFJQ
+VlJPUFNXWFZVU1RUUFFPTkxISEdJTEpGREJCQUBAQENHQj07PTo8OzU5Nzc4ODg3
+Nzg1ODk4ODc5Ozg6ODk3OTk4PD5FQj5AQEBFREU/QlFPSklIR0dHSkxUU1xZUVVZ
+YFhPU2BaV1RYUU9UWFZKQDo3NzI0NTAyNjQ0Ozg4Njc2Nzk5ODw6Ozo+S0ZLRUdF
+Q1RMWlVMUU9KT0pPTFVWSlVTVFtTWlNUVlJSTFNOUlRQSlRUWVdaWVVSUldZWlVT
+U1dUU1pdXFZXW15VVVVOTldSTUdHRzo2NzU2OTk+TV1eYmJYX11aYGleX2lYTVJR
+Vl5gXFhRUVNYXFJSWl1ZVlFWWlJSU1JcVVhTTlhYWFNTU1lYVVhSTU9RUVRTT05F
+SEhJRk9NS01OTU9KS1FJTFFRUlNUV1FTV1xdX1lRSERBQkJHRkpJRVJRU1dVYnqW
+pKekno+Jg3pybWhkZW1yZ1BEPDw+PTs3PDpEQ0E9Ozs7PDs/PEdCOjk9Oz1AQkA9
+QEFEQj06Ojw7PT9ASUhAPEFCPDg4OTczNDM2NDQ1MzU2ODk6PD5FRk1JUE5WXlJU
+UkxMTFVVT1BSUFRVVk5ISlNVVVRWWFRUVltYWE9LTUtKSkxJSUhLTU9NSUlMTkxI
+TU9NR0NHSElLS0xISkhKRkNBQ0RCREJCQz49PDtAPjw6ODg5PDs5Ozg2OkBLWGNo
+am1tbWtubXB1enp7e36Bg4aGiZKRjo2NjY2LiIiFhoKCd3Vua25vdH2DjI6NjIyO
+kpGQkpOVko+NiYN4aV5XU01LSUI+PUNHTFFSU05RUlVUWVtcXFZUUlFUU1FPTkxK
+R0ZCQUBAQUFEQz5CR0pIR0hESUhHRElKSklLS05MUFJVU1JRU1VaWFxdX19iY2lr
+bW9ycnR3enp5e318fX9/gH6Cg4SFgIOFhoeGh4mMiouOjo6PjY+MjY2RlJKSlJuX
+lZSUlZaQkpKWl5qTk5aYmpqbm5yampyam5mWl5uenZ+lqK2ytby9tqmcmJiRjJit
+uL6/vru6uLKuq62vs7a2t7e6u73BwcHAwcG/vcC9vLm4u7e4t7i4ur29urq4tre6
+uLa5trWzs62onohtXFVUVFJRT01NS0tKS05RS0tKS0xPTklJS0pJSUdLTEtJTEpO
+S0tHSUpNT05QTk5LS0xQTlBPUFJRTVBRTk9OT05PUlJPUlBQTk9QUFFRT1FRVVNU
+VFRTUlFWU1JQU1JRUFNVV1RPT1BRT1FSUVNUU1JOTlBPUFBQU1RSUVBSUVNSUVNR
+UVNVVFRTVVRWVFJTVlhXWVdXU1NTWFtbWl5dXFlZWFhZWFxYVlpYWFlbWVpZWVZX
+V1dYWVhYWFdXVVRZW1pZWlxdW1peXl1cXGBgX19gYV9fW1pZW1lcW1hWVFVXVVlW
+U1NVaoS8ytPa3uLk5+jo6el4eXh1eXh9eHt7e3t4eHZ1eHh0cm5jWEtLTEY/PTs8
+P0NGSklGREVBOz0+RD9BRENAPkE/Oj0+P0A9Pz0+Q0NCQkRJSUlKSUtMTEpLTFBU
+VlVUVlZSWVteXFpYU1RXWFlVWFlXV1VTVVJPUlZaVldTUVJRUVFOUE1KTE1LSElF
+QUVEQkVCRUNERD8/Pjs8QDw6Ojo6Ozw5Nzk5PDc2NDQ4Ojg6OTk4Ojc4PEQ7Oj0/
+PUNCRkNBSUtHSERJTEdKR1BLUVlVV1ZiV1BLU1JVVVZWU1RbWVBJQzo9NzY3NzYy
+Mjc3ODg0MzU3OTk/Pjo8Oz1ERk9FRkVJSklXUkxWUVBRSlFPV1ZHTU9SXlVdVVdc
+VlZMUk1QWVJRUFNZWF5eWU9PU1VWVFRSWFBPVllbWlZYWVdUVFFYXFhTUkxKQTo0
+MjQ1OT5DVFhPV1paYFtgX15gX1FPUlRUWltbVlNPUVdWUlhXXVZVVldaVlNWVllZ
+VFNPTVNRTVFPUlNUUVVUUlhVU1ZRS0lLRk1LSFFPTVFNTUpLT01LUlRMTVNVU1BU
+V1tiWFVQSUNDQEVDSEhHVVJYWlBYXn6Ypqiil4qBfHp4cGttcHNtYFBDOz47Ojo3
+OT07ODo7Oz88OjxAREA8Pj07OjxBQTw4PUFEQTxAPTtBRUVGR0U+QEI+ODUzMzc2
+Njc4ODQxNDY3OTs8P0RKR0hSTlVfVVtRT09RU1VSUVJTU1JQS05OTVJXVVZUUVNY
+VVRSTUxOSUtMSktKTEpJTEpKRkdLTE1NT01NSklJSktOTkpGREdGQUFERUREREI9
+Pj4/Ozc5ODo5Njc6OTs5NzpBSlhja21vb3RxcHBucnp9eXl6fH+EhIWGjo2Njo+N
+j4+MiYuLhH54cm5tb3BzfYaLjo6MjpKSkpORlJeWkpCHfnNrYVdWVVRMQj0/RE9V
+UVJQUVFRVFtcXF1dXFlWVlZXV1FRTk9NS0VDQ0FBQUFAP0FER0dHR0dHSUhKSkxL
+TEpJTlJOUFFUVlNWVltcYGBfZGhnaW5wcnR2dXh6eXt8f4GBgoKAg4GBgoODgoSE
+iIiHio6Ni4+Sk46KjY6Qk5WVkpGUlJOSlpKSlJWTkpOYmJiYmZial5iZm5mZmpye
+nZ+foKGip7Cyt7e5vLyznpKcn5aVorO5wcC/wLm2sa2rrK+zuLa4uL2/v768vMDA
+wsG+wL68vra1tLK1tri8vbi6ubi2tre3tra1tbW4trGroY1tW1hUVFNNTk5KSktP
+T0tLSkpMSktNTExLS0tLSkxKSUlMTUtLSk5JSE1OTk9MTE9RT0xNUFBRU1BPTU1P
+UFBTUlFPUlFOUVNRUFFRUU9OUFFTU1NTUlNUVFJTUU5QUlJUVVRUU1ZST1BPUFFS
+UVBOUVJPUFJSUFJRU1NRUFFSVFNSVFNUVFFRU1RXVlVXVFlYWFhZWFhVWFZUWFdX
+XV1cWFdYWVdaWFdaVVVaWVlaWVdaWVlYVVdaWVlXWFlbWFdYWVpdW1xcXlpbX2Fj
+YmBhYV9fX15cXl9aWFlVUFZWV1lYWVlXU1VvorzJ0tre4eTm5+jq6nl3d3l4d3h6
+ent8fHh2dXN1d3NxbGFUSkdGSEM7Pj89QUhJRkZFQ0RFQ0JCQj09PTg8PUE7Oj4+
+Qz0/QEFDQkVHR0pJSUxLTU1MTExLT1FSVFNTVVRVWFdXV1ZRUlNWVlVXWFlXWlta
+VFZXWlxZV1VTVVBTUU1NTEtNS05MR0pMSEVER0ZISEVERD4+Ozs6Ozs6OTk6Ojc1
+NTY5ODY2Njg2NzY4ODk3PDo4Pjw8PD9CRUFBPT5GRkVLTEZLTVFKSkxSW1daV11Z
+SlJWVlNSV1pUU1dXVlZQQjo7OTU1NDMyNjc0NTZINzc3OTo8PT07QUJDUkpOS0hN
+R1RRTlRQTlFIUFJVVEhSUVJgV1ZSWmFeYFJVTk5VUlJQV1lUVVZQSk5OUVZYVFBP
+UFNUWV1XUlRZWFlXVFVcXlpWWFBCOTIyMzc2PUNNV01TWlpbW1paXl1VVFZXVVZZ
+V1lcUk1OU1BVXVlaVlNTUVNYVVVbUk9VT05JTE9SUU9QUVZVUlNVWFlUS05LTFFU
+V09SUFNSUVRNSkpNUk5OV1FNVFpSTlRcYVxYW1FKQ0JER0NFR0hTTFFUTlVWbYma
+paOelImBfXx7dnRxcXBpWkY9Oj1COTQ5Ozs7QTk6Pzw7Ozs/QEJDPDo6PkBFPjtA
+QkRFQjk6PUJGREZEQkFCRj04MzQ1ODk1NTM5NzQ0NTk6Oj49P0JFSFRRWFlSXFNS
+VlZXVVRTU1ZTUFNNTU5PUFRUV1lRTk5SU09MTU5PUVBKS01MSkhIS0pJR0hDR0tL
+TUtFSk1OS0tIR0VHRkhEQ0NGRENBPj89PT87PDs4Ojw4OTo4Njk9QUxZZG1vb3By
+cnFzcnR2fH99eHh7gISHjJKJjpGRk5WSkpKOiomIgHx0cm5vcXV+hIeLjo+SlZiY
+mJWUlZmSjIJ4cG1jVE5NTkxIQ0ZMVFhXVldUVldYXWBiX19gXFxbWlhXU1FPTk1L

test/search_test_data/0002n.pat

@@ -0,0 +1,136 @@
+TUxOT1JVUFNUVlVRT1VYWVdXUlJUT1FPU1VPT01PUE9WVlFSUFJRTkxKTU1PTEtJ
+R0JDR0RDQEBBQD8/PDs/PD0+Pz44NzY1NjY5ODw5OT08Nzk5ODs8QUNBQj9BQUND
+QklLSk5KSU9TXlhLT0xWUlFaVFdMTVdVW1VgWVdWXV9dWFtWUlFSTkVERTk1NTUz
+MzUzNjU0ODg1ODY2Nzk6PTo6P0NETE1JR1RSTFBISkpKVVVLSUpUTU5STVZRVFpT
+Vk5XXGBYUFhVWFJTV19kXVdVUFdVVlZUW1xbWlhZV1pcWE9TWlRWWVlXUE1MTlJD
+PDo8Ozo+P0pOTVhWVFJWW15oYFxbXlpUVlpZXFhYVVdXUFlcYFhUVFdaW1RQXVxc
+XltXUVBSTU1RUVRYVVNNSU1RUFFWVFFST05QUk9OSU5QTk1KS1BVSkxLTE5LT1RO
+VlRZWlZYVE1FRkVHR0ZLSU9LTlFOXWaJo7CspZ2WlZOJfXFmYmFqdG9eS0E+OTk4
+ODtBQTw9Ojg5PD5EQT8/P0BAPDc6OEE+Pzo+QENAPDtBQENDRkNDR0A6QEQ8ODU0
+MTQ3NTg3Mzc2NDg0OTs/RUpTS05JT1xYWVlUXFZWVVtdWVlXUE5TUlJQT1BUVlZR
+VFVYW1NRTkxMUlZUUEtMTk9PTE1MSERESUpLSkxJRklJSUtLRkRJSEVCRENERUZE
+QkNBQ0JEQ0FAPjk6PDo3OTc3ODU2ODY2NTc+Rk9YYmdqaGhna3B3e3x+gYGBgYaH
+iYuKi4uKioWCfXdwbmpnaWlsb3eCiIuMjYmJjo6SkJCTl5ORjIaBfnZnVEc/Ojo6
+ODo7P0RJSkxPUlVWWVhWVlVSVFFRT05JRkVARD5BPkBCRERDQ0ZGRUdFSUpKSkpK
+SklOS0xNTkxOT05MS0tMTk9NT1ZWU1dZWl1eXWJkZ2hqbm91dXV4fH5/gYB/gYOC
+hYmGiIiHh4iGh4qLi4qMjY2Li4uLjZKTlpeWlpSPjo+SkZOQkpGRlZiXlpaZmZuZ
+mZibl5mZmJiampual5aYnKCpr7KqmImGiJWosbzAvLu5u7i1tbGwsbKzt7a8vcC/
+vL29vr6/v7q8vLq8vrq4ube1tLe3t7S0ta2ysrK1tKyginBfXVhTUlBOTVBMTU9M
+S0tLSUpLSkhJSkdPT05KSUdNS0lJSE1LSkxKTk9MTUtNSk9OTUxPUU5NUE9OT0xM
+Tk5QUVFQUU9QUVJSVFVSUlNTU1JRTlJTUFBSVFRSUlFTT09RUlBSUVNTUU9QUVNV
+VVVVUVFSU1FVU1JSUFFSU1hUUVFPUVRQUVJRU1NUVVZYWFZWWlhYVFFVWFhXVlhW
+WFhaWltbWF5bV1dYVlhbWFZYWVlaWVlYV1laWVpZV1taWVlaWlpaWVtcXV1cXF1d
+YF9dYF5dXV1dYF5bXV1cWlxWV1dYV1ZWWFdYV1ZZXIO9ydPa3uHk5efo6el7enh5
+ent8eHd1dnl2dnh6enl4eXdwZ1pMR0VFSkVEQz09Q0hKQ0A/P0I/PEJCQT4+PTpA
+RURFQ0RHQ0RBPT5ARkhJSkxMTk1JS05QTklKTk5QUVNUU1FXU1ddWVVRUFFTU1JQ
+UlBQT0tRVVVVU1JSUFJNSktPT0tJSUhHREVFQ0dEQkNAPj0+PTw7Ozs6OTw2Nzk4
+ODg6PDs5OTg3Nzs4Ojw7Ozw9PURBQkQ/RktGS0tISUpRVU5RTUpTT1lTV1VOVlNc
+WV1cWVddY1xdXllPT1JVT0pAODc1MzU5Njc6OTs3Njg2NTc7ODg4OTg+Q0dPUEpH
+VVRMUUxRSkpUTklOSVNSTU1KV1RSWlFYVFRVWVdNUFJeVFRVYWFdXVZQUVVYV1VZ
+VFdYWVhZXGVhVlRbW1pXUU1LTFBMTkhAOTg6OTk7Q1BSVVldWFpeXmFhY2VjXlNR
+U1BXWFVVUVZYWFdWU1NTVVZaV09WWVlaWlNQTUtOUE1OUlhZVFFXUE1NUFBQTlFS
+UFJWTU1OS0pRSkVJUFBNSkpNUEtPVFVXV1lXVldXU0hGRUdJSVBJSUhOVE9RWnWU
+qauroZiVkYl8c2xmY2VrdWlSQTs6Ozg7OTw8Oz08PDw7Ozw7PTtAPj09Pj1BQUJA
+OTo+QUQ9OD1FQUM+RUJCOzY9Q0E4ODU0NDY2NjQ0MzI1Njg4Oz1ESkpISkpTWlhY
+W1ZZV1hTVldOUVNOTE5OUlFQVFlYU01XV1dWU09MSktOUlRTUU1PT0xQTklFR0ZL
+TU1LS0dHR0dJSkpGRUNGSExHQ0RDREVBQD9APz5AOzs+QD88Pjw4NjY0Njc5Nzg7
+QUpTXmRmaGdoaGxwdHp7fXmBh4eHhoyQj5CNjYuJhYJ8dnN1b2xtbGtze4SJjI6M
+iImOj5KUlpWVk5GQi4B3a11RRj5APkFAQUFCSEpLTVBQU1hYWFZWV1NRUlBQTkxJ
+RkdDQT5AP0NDQkNARERJR0lJRkhHSUtQUE1MS0tNTExNTE1NT1FSUFBVVVVXWF1f
+XmNjZGdsbG5zdXZ1dnt9f4CDg4F/goOFhYaGh4uHhoWJi4mKi4mIiouNjIuMkZGR
+lpSUj5GQkpKSkpWTkpaXl5OVlpmbmpiYmZmZmJqWlZeYl5iZmp+jqrO5s6aTgXeB
+mK64vby7urq9ure0srSztba1t7m9vsDDwr69vb+9uru+wL69vbi3tbSztbq1tLe4
+rrOztrW1saylknplXFZUVVNPTU9PTk5NTU1NSkhISkpJR0lKS0lKUEpKS0xPTVBL
+TUxKS01KTExMTkpPTktQUE5PT09QTU5NUFBSUlNST1BPT05ST05PUVFTVlJSU1NS
+UlRTUVJTUVBRUU5RTlFSU1NQTk5NUFVTUlBSUVBRVFRTU1NSVFJQUlVUVlNUVFFS
+UFNVU1JUVVVWVVZXV1VWV1dWVVVYWVhZW1pYWVtdXF5aW1hZWFZZWVhYWlpYV1dY
+WFZXW1tZWFlYWVhWWVlZXFxcW11cXltcXltdXlxdX19dXl5bXVtbWFlYV1VXV1ZU
+VlVVVVdgfLvJ0dre4eTm5+jp6nl7e3x7eHp6dnh5dnd4dXd4dnZ5cmlgUkhCQEJH
+QEM/PkFCRERBQERDQz4/QkU7PD1CPkBBQUFAQEFDR0I9PENCR0dISEdJTklMT01P
+UlFNUFBRUlJZVVVWV1ZUU1hSVFZVUlJTUlBRUVNTVFVSUFFOUE5NTExPTUtIREhH
+RENDQkJFQj5APkE/Pz87Oj08Oz04Nzc4NzxBODQ1Nzc4Ozo6Ojg2OTs7Ozs+QT9D
+SUdISEZGRkpQS01LRElHTEpLVVRaWVhZXFtZVlhgX1xXV1BVblVUSkA5NzQ1NDc1
+NTQzNDQ0NDg1Njc2NTg7PD8+PkpJTUZNT0dPS1JNSFBLRkxIS0hLSk1UVFlgVl5X
+UVJUVUxRT1ZVUlFZXVpWVFJTVllZV1dUVFtaWltfZl1VWFtcVlZVT0tTUElIR0Q5
+NzY3Njk/SVJWWmxlWlxdWWBpYV9kV1JUUVJcWlhTT1NSV1pTVFNTVlVXVlZVWFJU
+WlNPS01VVVpaWVVYV1VWUU5QTk5PUFVRTE1LS0xIRU5KSEpOTk1JR01MSVBVWlxT
+VFhcWFpZTkdDQEFFS0VISElTUU9WYniWpqiooJeOhn92a2NgYGZwbV5JOzs/QkI7
+ODs9OkA+PDw6OT1APj4+SDw6Oz4/QkA7O0A9Pz5CPDs8QTxDQkJJPzpBPzo8Ozg2
+NzQ3NjczMjQ2Nzg7PT9HS0RJR01SUldSUE9OT01VWFJWVE5LTlFTUlBSVldSVFhW
+VFJWUVBNTEhLTFJUTExNS05OSUZITE1LS0pKT0pGREVGRkdIRklKSUlERURCQ0NC
+Q0E+PDk9QD9BPzw6ODo4OTo9Ojg5PUdQW2VqamlrbWttcnd6fH19fYKDiI2Ojo2N
+jo6LjIiIhX58eXVzcW9sb3d/hIyOkI+Lio6QkZOYlpSTjYuHgXJkWE1IRD89QEJF
+RUZMT0xPUVNUVlhaW1lXVVNSUlJPTUtNS0dDQUJEQkJDRUZGR0hFR0dHQ0dHSEtI
+SEtJS05LS0xSUVNQTlFUUlVZWFlcXWFlZ2hsbW9zcnV8fH9+fX+AgYGBg4SEg4KD
+hYOCh4eHh4eJi4qKi4uOjI2KjpGSlZWUmZaSkpeWkI6TmJWYmpiXmJiampuXnJmY
+lpaZmJqYmZmbnJ2jrLGwsbSwopSDfIeXrLu/vr28urq4s7OzsrK0trW3ubu8v8G/
+v7++vr27ur27vLy7ubW2uby7t7e1ube1tbe2tLW0sa+mmIFmWldXUlBRT0xOS0xO
+TVJPTUtKR0lKTEpKTUpJSUlLTUxJTE1PUExJS0tNS0xOTU5MS0xLS09PUVFTUE9R
+UFNSU1FRVFJNT09OTlBQUlNSUVBRT1JUVFFPUVRUUVNRUE5QUVFSUFFPSk5RUE9P
+UVNTVlFRTFBPUVJSUlJRT09SUlBQUE9RUlJTVVVTVFVWV1ZYWFZYV1hVVVRTV1ta
+W11bWVxaXV1aWlpcWllZWllaXV5bV1dXWFpZWldXWVpZVlVXWVlbXFxaXF9cX11f
+XFxcX15iYWBdXFhaW1pfXFtZV1RWVllXU1NXW2Z9usjT2d/h4+bn6OnpeXp7enl7
+d3t7enl6eHp4eHl1dG9rZFtRSkdDQkBAQUY/PEVESUREREM9QUFEQUVBPT9BPT8/
+Pz8+QT5BRENHQkNFRkhJS0xNTkxQTE1SU1NQUlNRUlVWVVVZWlZVU1VWU1ZWVFJQ
+VlJPUFNXWFZVU1RUUFFPTkxISEdJTEpGREJCQUBAQENHQj07PTo8OzU5Nzc4ODg3
+Nzg1ODk4ODc5Ozg6ODk3OTk4PD5FQj5AQEBFREU/QlFPSklIR0dHSkxUU1xZUVVZ
+YFhPU2BaV1RYUU9UWFZKQDo3NzI0NTAyNjQ0Ozg4Njc2Nzk5ODw6Ozo+S0ZLRUdF
+Q1RMWlVMUU9KT0pPTFVWSlVTVFtTWlNUVlJSTFNOUlRQSlRUWVdaWVVSUldZWlVT
+U1dUU1pdXFZXW15VVVVOTldSTUdHRzo2NzU2OTk+TV1eYmJYX11aYGleX2lYTVJR
+Vl5gXFhRUVNYXFJSWl1ZVlFWWlJSU1JcVVhTTlhYWFNTU1lYVVhSTU9RUVRTT05F
+SEhJRk9NS01OTU9KS1FJTFFRUlNUV1FTV1xdX1lRSERBQkJHRkpJRVJRU1dVYnqW
+pKekno+Jg3pybWhkZW1yZ1BEPDw+PTs3PDpEQ0E9Ozs7PDs/PEdCOjk9Oz1AQkA9
+QEFEQj06Ojw7PT9ASUhAPEFCPDg4OTczNDM2NDQ1MzU2ODk6PD5FRk1JUE5WXlJU
+UkxMTFVVT1BSUFRVVk5ISlNVVVRWWFRUVltYWE9LTUtKSkxJSUhLTU9NSUlMTkxI
+TU9NR0NHSElLS0xISkhKRkNBQ0RCREJCQz49PDtAPjw6ODg5PDs5Ozg2OkBLWGNo
+am1tbWtubXB1enp7e36Bg4aGiZKRjo2NjY2LiIiFhoKCd3Vua25vdH2DjI6NjIyO
+kpGQkpOVko+NiYN4aV5XU01LSUI+PUNHTFFSU05RUlVUWVtcXFZUUlFUU1FPTkxK
+R0ZCQUBAQUFEQz5CR0pIR0hESUhHRElKSklLS05MUFJVU1JRU1VaWFxdX19iY2lr
+bW9ycnR3enp5e318fX9/gH6Cg4SFgIOFhoeGh4mMiouOjo6PjY+MjY2RlJKSlJuX
+lZSUlZaQkpKWl5qTk5aYmpqbm5yampyam5mWl5uenZ+lqK2ytby9tqmcmJiRjJit
+uL6/vru6uLKuq62vs7a2t7e6u73BwcHAwcG/vcC9vLm4u7e4t7i4ur29urq4tre6
+uLa5trWzs62onohtXFVUVFJRT01NS0tKS05RS0tKS0xPTklJS0pJSUdLTEtJTEpO
+S0tHSUpNT05QTk5LS0xQTlBPUFJRTVBRTk9OT05PUlJPUlBQTk9QUFFRT1FRVVNU
+VFRTUlFWU1JQU1JRUFNVV1RPT1BRT1*SUVNUU1JOTlBPUFBQU1RSUVBSUVNSUVNR
+UVNVVFRTVVRWVFJTVlhXWVdXU1NTWFtbWl5dXFlZWFhZWFxYVlpYWFlbWVpZWVZX
+V1dYWVhYWFdXVVRZW1pZWlxdW1peXl1cXGBgX19gYV9fW1pZW1lcW1hWVFVXVVlW
+U1NVaoS8ytPa3uLk5+jo6el4eXh1eXh9eHt7e3t4eHZ1eHh0cm5jWEtLTEY/PTs8
+P0NGSklGREVBOz0+RD9BRENAPkE/Oj0+P0A9Pz0+Q0NCQkRJSUlKSUtMTEpLTFBU
+VlVUVlZSWVteXFpYU1RXWFlVWFlXV1VTVVJPUlZaVldTUVJRUVFOUE1KTE1LSElF
+QUVEQkVCRUNERD8/Pjs8QDw6Ojo6Ozw5Nzk5PDc2NDQ4Ojg6OTk4Ojc4PEQ7Oj0/
+PUNCRkNBSUtHSERJTEdKR1BLUVlVV1ZiV1BLU1JVVVZWU1RbWVBJQzo9NzY3NzYy
+Mjc3ODg0MzU3OTk/Pjo8Oz1ERk9FRkVJSklXUkxWUVBRSlFPV1ZHTU9SXlVdVVdc
+VlZMUk1QWVJRUFNZWF5eWU9PU1VWVFRSWFBPVllbWlZYWVdUVFFYXFhTUkxKQTo0
+MjQ1OT5DVFhPV1paYFtgX15gX1FPUlRUWltbVlNPUVdWUlhXXVZVVldaVlNWVllZ
+VFNPTVNRTVFPUlNUUVVUUlhVU1ZRS0lLRk1LSFFPTVFNTUpLT01LUlRMTVNVU1BU
+V1tiWFVQSUNDQEVDSEhHVVJYWlBYXn6Ypqiil4qBfHp4cGttcHNtYFBDOz47Ojo3
+OT07ODo7Oz88OjxAREA8Pj07OjxBQTw4PUFEQTxAPTtBRUVGR0U+QEI+ODUzMzc2
+Njc4ODQxNDY3OTs8P0RKR0hSTlVfVVtRT09RU1VSUVJTU1JQS05OTVJXVVZUUVNY
+VVRSTUxOSUtMSktKTEpJTEpKRkdLTE1NT01NSklJSktOTkpGREdGQUFERUREREI9
+Pj4/Ozc5ODo5Njc6OTs5NzpBSlhja21vb3RxcHBucnp9eXl6fH+EhIWGjo2Njo+N
+j4+MiYuLhH54cm5tb3BzfYaLjo6MjpKSkpORlJeWkpCHfnNrYVdWVVRMQj0/RE9V
+UVJQUVFRVFtcXF1dXFlWVlZXV1FRTk9NS0VDQ0FBQUFAP0FER0dHR0dHSUhKSkxL
+TEpJTlJOUFFUVlNWVltcYGBfZGhnaW5wcnR2dXh6eXt8f4GBgoKAg4GBgoODgoSE
+iIiHio6Ni4+Sk46KjY6Qk5WVkpGUlJOSlpKSlJWTkpOYmJiYmZial5iZm5mZmpye
+nZ+foKGip7Cyt7e5vLyznpKcn5aVorO5wcC/wLm2sa2rrK+zuLa4uL2/v768vMDA
+wsG+wL68vra1tLK1tri8vbi6ubi2tre3tra1tbW4trGroY1tW1hUVFNNTk5KSktP
+T0tLSkpMSktNTExLS0tLSkxKSUlMTUtLSk5JSE1OTk9MTE9RT0xNUFBRU1BPTU1P
+UFBTUlFPUlFOUVNRUFFRUU9OUFFTU1NTUlNUVFJTUU5QUlJUVVRUU1ZST1BPUFFS
+UVBOUVJPUFJSUFJRU1NRUFFSVFNSVFNUVFFRU1RXVlVXVFlYWFhZWFhVWFZUWFdX
+XV1cWFdYWVdaWFdaVVVaWVlaWVdaWVlYVVdaWVlXWFlbWFdYWVpdW1xcXlpbX2Fj
+YmBhYV9fX15cXl9aWFlVUFZWV1lYWVlXU1V#orzJ0tre4eTm5+jq6nl3d3l4d3h6
+ent8fHh2dXN1d3NxbGFUSkdGSEM7Pj89QUhJRkZFQ0RFQ0JCQj09PTg8PUE7Oj4+
+Qz0/QEFDQkVHR0pJSUxLTU1MTExLT1FSVFNTVVRVWFdXV1ZRUlNWVlVXWFlXWlta
+VFZXWlxZV1VTVVBTUU1NTEtNS05MR0pMSEVER0ZISEVERD4+Ozs6Ozs6OTk6Ojc1
+NTY5ODY2Njg2NzY4ODk3PDo4Pjw8PD9CRUFBPT5GRkVLTEZLTVFKSkxSW1daV11Z
+SlJWVlNSV1pUU1dXVlZQQjo7OTU1NDMyNjc0NTZINzc3OTo8PT07QUJDUkpOS0hN
+R1RRTlRQTlFIUFJVVEhSUVJgV1ZSWmFeYFJVTk5VUlJQV1lUVVZQSk5OUVZYVFBP
+UFNUWV1XUlRZWFlXVFVcXlpWWFBCOTIyMzc2PUNNV01TWlpbW1paXl1VVFZXVVZZ
+V1lcUk1OU1BVXVlaVlNTUVNYVVVbUk9VT05JTE9SUU9QUVZVUlNVWFlUS05LTFFU
+V09SUFNSUVRNSkpNUk5OV1FNVFpSTlRcYVxYW1FKQ0JER0NFR0hTTFFUTlVWbYma
+paOelImBfXx7dnRxcXBpWkY9Oj1COTQ5Ozs7QTk6Pzw7Ozs/QEJDPDo6PkBFPjtA
+QkRFQjk6PUJGREZEQkFCRj04MzQ1ODk1NTM5NzQ0NTk6Oj49P0JFSFRRWFlSXFNS
+VlZXVVRTU1ZTUFNNTU5PUFRUV1lRTk5SU09MTU5PUVBKS01MSkhIS0pJR0hDR0tL
+TUtFSk1OS0tIR0VHRkhEQ0NGRENBPj89PT87PDs4Ojw4OTo4Njk9QUxZZG1vb3By
+cnFzcnR2fH99eHh7gISHjJKJjpGRk5WSkpKOiomIgHx0cm5vcXV+hIeLjo+SlZiY
+mJWUlZmSjIJ4cG1jVE5NTkxIQ0ZMVFhXVldUVldYXWBiX19gXFxbWlhXU1FPTk1L